Previous Article | Next Article 
Infection and Immunity, February 2000, p. 463-469, Vol. 68, No. 2
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Cleavage of a Recombinant Human Immunoglobulin A2
(IgA2)-IgA1 Hybrid Antibody by Certain Bacterial IgA1
Proteases
Bernard W.
Senior,1
James I.
Dunlop,1
Margaret R.
Batten,1
Mogens
Kilian,2 and
Jenny M.
Woof1,*
Department of Molecular and Cellular
Pathology, University of Dundee Medical School, Ninewells Hospital,
Dundee DD1 9SY, United Kingdom,1 and
Department of Medical Microbiology and Immunology,
University of Aarhus, DK-8000 Aarhus C, Denmark2
Received 9 August 1999/Returned for modification 8 September
1999/Accepted 29 October 1999
 |
ABSTRACT |
To understand more about the factors influencing the cleavage of
immunoglobulin A1 (IgA1) by microbial IgA1 proteases, a recombinant human IgA2/IgA1 hybrid molecule was generated. In the hybrid, termed
IgA2/A1 half hinge, a seven-amino-acid sequence corresponding to one
half of the duplicated sequence making up the IgA1 hinge was
incorporated into the equivalent site in IgA2. Insertion of the IgA1
half hinge into IgA2 did not affect antigen binding capacity or the
functional activity of the hybrid molecule, as judged by its ability to
bind to IgA Fc
receptors and trigger respiratory bursts in
neutrophils. Although the IgA2/A1 hybrid contained only half of the
IgA1 hinge, it was found to be cleaved by a variety of different
bacterial IgA1 proteases, including representatives of those that
cleave IgA1 in the different duplicated halves of the hinge, namely,
those of Prevotella melaninogenica, Streptococcus pneumoniae, S. sanguis, Neisseria
meningitidis types 1 and 2, N. gonorrhoeae types 1 and 2, and Haemophilus influenzae type 2. Thus, for these
enzymes the recognition site for IgA1 cleavage is contained within half
of the IgA1 hinge region; additional distal elements, if required, are
provided by either an IgA1 or an IgA2 framework. In contrast, the
IgA2/A1 hybrid appeared to be resistant to cleavage with S. oralis and some H. influenzae type 1 IgA1 proteases,
suggesting these enzymes require additional determinants for efficient
substrate recognition.
 |
INTRODUCTION |
Secretory IgA (S-IgA) protects
mucous membranes from attack by pathogenic microorganisms. It acts by
neutralizing toxins, enzymes, and viruses, agglutinating bacteria, and
preventing bacterial adhesion to mucous membranes by blocking receptors
and, by virtue of its hydrophilic nature, causing repelling
interactions with the mucosal epithelium (16, 18, 38, 40).
The ability of S-IgA to carry out its defensive effector functions is
dependent on its structural integrity. The physicochemical nature of
S-IgA renders it resistant to most types of proteolytic attack
(20). However, a few pathogenic bacteria such as
Streptococcus pneumoniae, Haemophilus influenzae,
Neisseria meningitidis, N. gonorrhoeae, and
Prevotella melaninogenica, which cause infections at mucous
membranes leading to diseases like pneumonia, meningitis, gonorrhea,
and periodontitis, produce a variety of enzymes called IgA1 proteases
(for reviews, see references 15, 26, and
35). They are so named because they cleave only
human IgA1 and not the IgA2 isotype. These enzymes may be important
virulence factors because they are produced in vivo (3, 14),
convalescing patients from infections with these bacteria have
neutralizing antibodies to the enzymes (5, 9, 11), and the
related but nonpathogenic species of these bacteria do not produce them
(26). Moreover, some may have a role in virulence by
mechanisms additional to or distinct from that arising through IgA1
cleavage (19, 30).
IgA2 is resistant to IgA1 proteases because it lacks a sequence of 16 amino acids which is present in the hinge region of IgA1 and which is
the cleavage site for all IgA1 proteases. The sequence, which is rich
in proline, threonine, and serine, is unusual in that it contains a
repeat of two identical and contiguous sequences each of eight amino
acids. Although the IgA1 proteases belong to widely different families,
i.e., serine proteases, metallo proteases, and thiol proteases, they
are all highly specific post-proline endopeptidases. The IgA1 proteases
of the different bacteria always cleave at either Pro-Ser (type 1 enzymes) or Pro-Thr (type 2 enzymes) peptide bonds. However, they are
extremely specific in that one enzyme of a given organism cleaves the
specific peptide bond in only one of the duplicated eight amino acid
sequences and not at the equivalent site in the other duplicated
eight-amino-acid sequence (Fig. 1).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1.
Simplified structure of monomeric serum IgA showing the
amino acid sequence of the hinge region of IgA1, IgA2m(1), and the
IgA2/A1 half hinge and the cleavage sites of different bacterial IgA1
proteases.
|
|
To understand more about the factors influencing the cleavage of IgA by
microbial IgA1 proteases, a recombinant hybrid IgA molecule was
constructed such that an amino acid sequence representing half of the
duplicated hinge region of IgA1 was incorporated into the equivalent
position in IgA2. The functional activity and sensitivity of the
recombinant hybrid IgA2/A1 molecule to a variety of microbial IgA1
proteases were then determined.
 |
MATERIALS AND METHODS |
Primers.
Primer A1H6 (5'
GCGCGCGGATCCGGTCCAACCGCAGGCCC 3') contained a
BamHI site (italics) and annealed about 150 bp upstream of
the CH1 exon of human IgA2m(1). Primer A1H2 (5'
AGATGGGGTAGGTGGAGTTGAGGGAACTGGAGTGG 3') contained
nucleotides complementary to nucleotides 675 to 688 of the coding
strand for the CH1 region of human IgA2m(1) and (in italics)
nucleotides complementary to nucleotides 667 to 687 of human IgA1,
coding for half of the hinge region. Primer A1H3 (5'
TCAACTCCACCTACCCCATCTCCACCTCCCCCATG 3') contained (in italics) the nucleotides coding for half the hinge region, i.e., nucleotides 667 to 687, of human IgA1, followed by nucleotides 689 to
702 of the coding strand for the CH2 region of human IgA2m(1). Primer
A1H5 (5' CCACCTCTGACTTGA 3') was complementary to
nucleotides 424 to 438 of the vector pSP73. All primers were made by
the Oligonucleotide Synthesis Laboratory, Department of Biochemistry,
University of Dundee.
Construction of IgA2/A1 half hinge expression vector.
A
plasmid bearing the gene for the CH1, CH2, and CH3 domains of the
chain of human IgA2m(1) downstream of the mouse VNP gene
(25) was cleaved with BamHI and XhoI,
and the 1.4-kb fragment containing bp 1 to 737 of the
2
constant region was ligated into BamHI-XhoI-cut
pSP73 (Promega, Southampton, United Kingdom). The resultant plasmid was
used as a template for PCR overlap extension mutagenesis
(13) using flanking primers A1H6 and A1H5 and internal primers A1H2 and A1H3. Thus, a fragment containing half of the hinge
region of human IgA1 inserted between the CH1 and CH2 regions of human
IgA2m(1) was engineered. Following digestion with BamHI and
XhoI, the PCR product was ligated into the
BamHI-XhoI-cut site of the original IgA2
expression vector, replacing the wild-type sequence in this region.
Sequencing of the PCR-amplified region was performed by the
dideoxy-chain termination method (7).
Preparation of recombinant hybrid IgA2/A1 half hinge
immunoglobulin.
CHO-K1 cells were maintained as described
previously (25). CHO-K1 cells stably transfected previously
with an appropriate mouse
light (L) chain (25) were
seeded in tissue culture-grade petri dishes and transfected with the
IgA2/A1 hybrid expression vector by using calcium phosphate as
described previously (25). Positive transfectants were
isolated by selection for the bacterial xanthine-guanine
phosphoribosyltransferase selectable marker by growth in medium
supplemented with hypoxanthine and thymidine (HT supplement; Life
Technologies, Paisley, United Kingdom), xanthine (0.25 mg/ml), and
mycophenolic acid (10 µg/ml). Several resistant colonies were picked,
and cell lines producing the highest yields of IgA were identified by
an enzyme-linked immunosorbent assay measuring binding to the antigen
NIP (3-nitro-4-hydroxy-5-iodophenylacetate) as described previously
(25) before expansion into large cultures. Recombinant
antibodies were purified from supernatants of CHO-K1 transfectants by
affinity chromatography on NIP-Sepharose as described previously
(25). The purified antibodies were supplemented with 0.04%
sodium azide and stored in small aliquots at
20°C.
Recombinant IgA1 and IgA2.
The antibodies were prepared in
similar ways from previously described stable CHO-K1 transfectants
(25).
Rosette assays.
Human erythrocytes were derivatized by
incubation in isotonic borate buffer (pH 8.5) containing
NIP-caproate-O-succinimide (100 µg/ml; Genosys, Cambridge,
United Kingdom) for 1 h at room temperature. The cells were then
washed three times with phosphate-buffered saline (PBS) before and
after fixation for 30 min with 3% glutaraldehyde prior to
sensitization with essentially saturating amounts (>250 µg/ml) of
wild-type IgA1 or IgA2 or IgA2/A1 half hinge, making use of their
specificity for the hapten NIP, as described previously (39). Coating levels for each antibody were found to be
equivalent by reactivity with goat anti-human IgA-fluorescein
isothiocyanate conjugate (Caltag; Bradsure Biologicals, Loughborough,
United Kingdom) as assessed by flow cytometry. Neutrophils were
isolated as previously described (27) from heparinized blood
taken from healthy volunteers. Rosetting of sensitized erythrocytes to
neutrophils was performed in V-bottomed microtiter plates as described
previously (39). After addition of acridine orange solution
(6 µg/ml, final concentration) to stain nucleated cells, the cells
were resuspended and examined by UV microscopy for rosetting. A rosette
was defined as a fluorescent neutrophil with three or more erythrocytes attached.
Chemiluminescence assay of respiratory bursts.
Wells of a
chemiluminescence microtiter plate (Dynatech, Billinghurst, Sussex,
United Kingdom) were coated with 150 µl of 10 µg of NIP-BSA/ml in
coating buffer (0.1 M sodium carbonate buffer [pH 9.6]) and incubated
overnight at 4°C. After three washes with PBS, 150 µl of diluted
antibody (50 µg/ml) was added in triplicate to the wells and left
overnight at 4°C. After three washes in PBS, 100 µl of luminol (67 µg/ml in Hanks' balanced salt solution [HBSS] containing 20 mM
HEPES buffer and 0.1% [wt/vol] globulin-free BSA [HBSS-BSA]) was
added to each well. Following the addition of 50 µl of neutrophils
(106/ml in HBSS-BSA) to each well, the plate was
transferred to a Microlumat LB96P luminometer, and chemiluminescence
was measured at regular intervals for 1 h.
Microbial IgA1 proteases.
The IgA1 proteases used were from
S. pneumoniae type 23 strain 3626, S. oralis NCTC
11427, S. sanguis biovar 2 strain SK4, H. influenzae HK368, R11, R12, R14, R16, R20, R25, and R27 (all type
1 enzyme), H. influenzae 110023H and R4 (both type 2 enzyme), N. meningitidis group B serotype 14 strain 3564 (type 1 enzyme), N. meningitidis group Y serotype 2c strain
HF13 (type 2 enzyme), N. gonorrhoeae 3548 serogroup W1
serovar IA-6 (type 1 enzyme), N. gonorrhoeae 3547 serogroup
W11/111 serovar IB-1 (type 2 enzyme), and P. melaninogenica
ATCC 25845. The enzymes from S. sanguis SK4, H. influenzae HK368, N. meningitidis HF13, and P. melaninogenica ATCC 25845 were pure; the others were partially
purified and either concentrated from liquid culture supernatants or
prepared as previously described (34) from the bacteria
grown on dialysis tubing covering appropriate culture media, blood
agar, heated blood agar, or modified New York City agar for 3 days at
37°C in 5% CO2. The enzyme preparations were stored at
20°C.
Digestion of recombinant IgA preparations with microbial IgA1
proteases and immunoblotting.
Initial preliminary experiments
determined the appropriate volumes of protease and antibody to use to
permit assessment of cleavage by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (SDS-PAGE). Such volumes of recombinant IgA1 or
IgA2 or hybrid IgA2/A1 and the microbial IgA1 protease preparations
were added to PBS (pH 7.2) containing 0.1% sodium azide to give a
total volume of 20 µl. In the case of P. melaninogenica
protease, the buffer used was 0.1 M sodium phosphate (pH 5.5)
containing 0.1 mM EDTA and 0.1 mM dithiothreitol. The reaction mixtures
were incubated at 37°C for 72 h prior to analysis on SDS-10%
polyacrylamide gels under reducing and nonreducing conditions. The
proteins were then transferred to nitrocellulose membranes, which were
then blocked by agitation for 30 min in 5% nonfat dried milk powder in
PBS. After thorough washing in PBS, the membranes were immersed in horseradish peroxidase-labeled antibody, either sheep anti-human IgA Fc
antibody (Sigma) or goat anti-human IgA (Kirkegaard & Perry Laboratories, Gaithersburg, Md.) or sheep anti-mouse
L-chain antibody (Nordic Immunological Laboratories, Tilburg, The Netherlands) diluted 1:1,000 in PBS containing 0.1% Tween 20 (PBST) and agitated for 2 h at room temperature.
When examination was to be made for binding of biotinylated lectins,
the nitrocellulose membranes were blocked by immersion
in 1% BSA in
PBST and agitation for 30 min. After incubation with
the biotinylated
lectin (Vector Laboratories, Peterborough, United
Kingdom) for 1 to
2 h at room temperature and thorough washing
in PBS, the membranes
were incubated with 1 µg of streptavidin-labeled
horseradish
peroxidase per ml in PBS for 30 min at room
temperature.
In all instances, after thorough washing in PBS, the membranes were
developed in 10 ml of 50 mM Tris-HCl (pH 7.6) buffer containing
0.3 mg
of nickel chloride per ml, 10 mg of diaminobenzidine, and
60 µl of
30% hydrogen
peroxide.
 |
RESULTS |
Expression of IgA2/A1 half hinge in CHO-K1 cells.
DNA sequence
analysis of the IgA2/A1 half hinge expression vector confirmed that
nucleotides 667 to 687 of
1 had been correctly incorporated between nucleotides 688 and 689 of
2 and
that no misincorporations had occurred during PCR amplification.
Analysis of the IgA2/A1 half hinge antibody expressed in CHO-K1 cells
showed that in the reduced form, the hybrid
2/
1 chain
appeared as two glycoprotein
bands of 68 and 63 kDa (Fig.
2).
These
differed only in the extent of N-glycosylation, for after
incubation
with recombinant peptide-
N-glycosidase F (Glyko, Upper
Heyford, Nr. Bicester, United Kingdom), which removes N-linked
oligosaccharides, the hybrid
2/
1 chain no
longer bound biotinylated
concanavalin A and appeared as a single band
of ca. 58 kDa (Fig.
2). This size was similar to or possibly a little
smaller than
that of the deglycosylated wild-type
1
chain and a little bigger
than that of the deglycosylated wild-type
2 chain as expected.
Analysis of the hybrid IgA2/A1 in
its nonreduced form by SDS-PAGE
and immunoblotting revealed a major
band of about 50 kDa reactive
with anti-L-chain antibody and another of
about 120 kDa reactive
with anti-IgA

-chain antibody (Fig.
3). Equivalent bands were
observed with
the wild-type IgA2m(1) and have been identified
earlier as L-chain
dimers and heavy (H)-chain dimers, respectively
(
25). These
dimers arise under nonreducing conditions because
in the majority of
IgA2m(1) molecules, in contrast to most other
antibody molecules,
disulfide bonds do not form between H and
L chains. Instead, the L
chains are disulfide bonded to each other
(
24). The
recombinant hybrid IgA2/A1 antibody appeared to share
this bonding
pattern, as was expected, given that it retained
the elements of
IgA2m(1) involved in interchain disulfide bridge
formation. In
wild-type IgA1 the H chains are disulfide bonded
to each other and to
the L chains, resulting, under nonreducing
conditions, in a band of
about 170 kDa which was reactive with
both anti-H-chain and
anti-L-chain reagents (Fig.
3). A 170-kDa
band containing both H and L
chains was also evident in wild-type
IgA2m(1) and to a lesser extent in
IgA2/A1 half hinge (Fig.
3).
It is now appreciated that disulfide bonds
can be formed between
H and L chains in IgA2m(1) but with low frequency
(
8), and
this obviously also applies to the IgA2/A1 half
hinge molecule.

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 2.
Western blot analysis of proteins separated under
reducing conditions of recombinant wild-type IgA1 (lanes 1 and 4),
recombinant hybrid IgA2/A1 half hinge (lanes 2 and 5), and recombinant
wild-type IgA2 (lanes 3 and 6) after being either untreated (lanes 1 to
3) or incubated with N-glycosidase F (lanes 4 to 6) and
probed with anti-human IgA-peroxidase conjugate. Positions of molecular
mass markers in kilodaltons are shown on the left. Treatment of the
two-banded hybrid IgA2/A1 half hinge glycoprotein with
N-glycosidase F removed N-linked oligosaccharides to give a
smaller single protein band similar in size to deglycosylated IgA1 and
larger than deglycosylated IgA2.
|
|

View larger version (84K):
[in this window]
[in a new window]
|
FIG. 3.
Western blot analysis of proteins separated under
nonreducing conditions of recombinant IgA1 (lanes 1 and 5), recombinant
hybrid IgA2/A1 half hinge (lanes 2 and 6), and recombinant IgA2 (lanes
3 and 7) after blotting with anti-mouse L-chain-peroxidase
conjugate (lanes 1 to 3) or anti-human IgA Fc-peroxidase conjugate
(lanes 5 to 7). Positions of molecular mass markers (lane 4) in
kilodaltons are indicated on the left.
|
|
The hybrid IgA2/A1 half hinge molecule was examined for the presence of
O-glycosylated amino acids in the half-hinge region
by determining its
ability to bind the biotinylated lectin jacalin
(from
Artocarpus
integrifolia). The results showed that like the
wild-type IgA1,
the hybrid IgA2/A1 half hinge molecule bound jacalin
and thus contained
O-glycosylated amino acids, whereas, as expected,
the wild-type IgA2
molecule did not (Fig.
4).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 4.
Western blot analysis of proteins separated under
reducing conditions of recombinant IgA1 (lanes 1 and 5), recombinant
hybrid IgA2/A1 half hinge (lanes 2 and 6), and recombinant IgA2 (lanes
3 and 7) after probing either with anti-human IgA-peroxidase conjugate
(lanes 1 to 3) or, after reaction with biotinylated jacalin, probing
with streptavidin-peroxidase conjugate (lanes 5 to 7). Positions of
molecular mass markers (lanes 4 and 8) in kilodaltons are shown at the
right. The amounts of IgA in lanes 1 to 3 were the same as their
equivalents in lanes 5 to 7. The lectin jacalin bound to recombinant
wild-type IgA1 and recombinant hybrid IgA2/A1 half hinge but not to
recombinant IgA2, indicating the presence in IgA2/A1 half hinge of
O-glycosylated jacalin binding amino acids in the half hinge. The
highly sensitive jacalin binding analysis revealed the presence in lane
6 of trace amounts of some non-IgA glycoproteins.
|
|
Ability of IgA2/A1 half hinge to bind and trigger Fc
R.
Analysis of the functional activity of the hybrid IgA2/A1 molecule
showed it to be comparable to wild-type IgA1 and IgA2 in the ability to
mediate rosette formation between NIP-coated erythrocytes and
neutrophils through interaction with Fc
receptors (Fc
R) (Table
1). Moreover, chemiluminescence assays
revealed that the hybrid IgA2/A1 half hinge molecule bound efficiently
to Fc
R on neutrophils and promoted a respiratory burst (Fig.
5). The respiratory bursts stimulated by
the recombinant IgA1 and IgA2 mirror closely those reported earlier for
serum-derived IgA1 and IgA2 (37). The IgA2/A1 hybrid
produced a respiratory burst comparable to that produced by the
wild-type antibodies. Thus, the functional activity of the recombinant
IgA2/A1 hybrid in these respects was very similar to that of wild-type
IgA1 and IgA2. This finding is in keeping with the localization of the
Fc
R binding site on IgA to the region between the CH2 and CH3
domains of the Fc, some distance from the hinge (6, 28).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 5.
Stimulation of neutrophil chemiluminescence by IgA
attached to NIP-BSA-coated microtiter plates. Respiratory bursts were
induced by IgA1 ( ), IgA2 ( ), or IgA1/A2 half hinge ( ), all at
100 µg/ml. Negative controls lacking IgA, with ( ) and without
( ) the addition of cells, are also shown. Each point shown is the
mean of triplicate determinations. The experiment was performed three
times each with neutrophils from a different donor. Relative light
units (RLU) per second were plotted against time. The results presented
are those from a typical experiment.
|
|
Activities of different microbial IgA1 proteases on IgA2/A1 half
hinge.
The susceptibility of IgA2/A1 half hinge to a number of
bacterial IgA1 proteases was examined. All of the enzyme preparations were shown to have IgA1 protease activity, for they all cleaved wild-type IgA1 in the hinge region to generate Fab and Fc fragments but
were unable to cleave wild-type IgA2 (data not shown).
Examination of the sensitivity of wild-type IgA1 and IgA2/A1 half hinge
to the different streptococcal IgA1 proteases showed
that although all
of the enzymes were active and cleaved IgA1
to Fab and Fc fragments,
the IgA2/A1 half hinge hybrid was sensitive
only to those of
S. pneumoniae and
S. sanguis and resistant to
that of
S. oralis (Fig.
6).
Interpretation of the relative sizes
of the cleavage products requires
careful consideration of both
the N-linked sugar moieties in the Fc of
IgA1 (two per Fc H chain)
and of IgA2/A1 (three per Fc H chain) and
also the differing presence
of contaminating glycosidase activity in
the protease preparations.
Although the proteases from
S. pneumoniae and
S. oralis cleaved
the wild-type IgA1 to
produce IgA1 fragments of the same sizes
of ca. 28 and 27 kDa (Fig.
6,
lanes 2 and 4), the fragments generated
by cleavage with
S. sanguis protease (Fig.
6, lane 3) were marginally
larger.
Moreover, the size of the fragments generated by cleavage
of the
IgA2/A1 half hinge by the protease from
S. pneumoniae (Fig.
6, lane 6) differed in size from those resulting from cleavage
with
S. sanguis protease (Fig.
6, lane 7). The reason for this
is
thought to be a consequence of the
S. pneumoniae (and
S. oralis)
protease preparations, but not that of
S. sanguis, also having
glycosidase activity as has been observed
previously (
33). Thus,
when the
S. pneumoniae
cleavage of IgA2/A1 half hinge was repeated
in the presence of 25 mM
EDTA to inhibit the
S. pneumoniae IgA1
metalloproteinase
activity, although there was no proteolytic
cleavage of IgA2/A1, the
hybrid antibody was nevertheless deglycosylated
to a protein of ca. 56 kDa (Fig.
7). The difference in the sizes
of the IgA fragments produced by the different enzymes is more
marked
for the IgA2/A1 half hinge than for the wild-type IgA1,
presumably
because of the loss of three sugar moieties in the
former, compared
with just two in the latter.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 6.
Action of different streptococcal IgA1 proteases on
IgA2/A1 half hinge, determined by Western blot analysis of proteins
separated under reducing conditions of wild-type IgA1 (lanes 1 [control] to 4) and IgA2/A1 half hinge (lanes 5 [control] to 8)
digested with IgA1 protease from S. pneumoniae (lanes 2 and
6), S. sanguis (lanes 3 and 7), and S. oralis
(lanes 4 and 8) and probed with anti-human IgA-peroxidase conjugate.
Positions of molecular mass markers are shown in kilodaltons on the
right. The hybrid IgA2/A1 was cleaved by the proteases of S. pneumoniae and S. sanguis but was resistant to that of
S. oralis.
|
|

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 7.
Action of S. pneumoniae IgA1 protease
preparation on IgA2/A1 half hinge in the presence and absence of EDTA.
Shown is Western blot analysis of proteins separated under reducing
conditions of IgA2/A1 half hinge (lanes 1 [control] to 3) digested
with S. pneumoniae enzyme preparation (lanes 2 and 3) in the
absence (lane 2) and presence (lane 3) of 25 mM EDTA and probed with
anti-human IgA-peroxidase conjugate. Positions of molecular mass
markers in kilodaltons are shown on the right. The EDTA inhibited
S. pneumoniae proteolytic cleavage of the chain but not
glycosidase activity and reduction in mass of the immunoglobulin.
|
|
The action on wild-type IgA1 and the IgA2/A1 half hinge of the IgA1
proteases of
S. pneumoniae,
N. meningitidis type
2, and
N. gonorrhoeae type 1, which cleave at different
sites in the
full hinge of IgA1 (Fig.
1), is shown in Fig.
8. All of these
enzymes which cleaved
IgA1 were also found to be able to cleave
the hybrid IgA2/A1. The lower
molecular weight of the fragments
produced by the
S. pneumoniae protease than of the fragments produced
by the
different
Neisseria proteases is presumably due to the
additional activity of glycosidases in the
S. pneumoniae
preparation
(see above). The hybrid IgA2/A1 was also found to be
sensitive
to the type 1 protease of
N. meningitidis and the
type 2 protease
of
N. gonorrhoeae (results not shown), which
cleave the same peptide
bonds in IgA1 as
N. gonorrhoeae type
1 protease and
N. meningitidis type 2 protease,
respectively. Moreover, the hybrid IgA2/A1 was
also sensitive to
P. melaninogenica protease, which cleaves IgA1
at the
opposite end of the full hinge in IgA1 (Fig.
1) to that
cleaved by the
type 1 protease of
N. meningitidis (Fig.
9).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 8.
Western blot analysis of proteins separated under
reducing conditions of wild-type IgA1 (lanes 1 [control] to 4) and
IgA2/A1 half hinge (lanes 5 [control] to 8) digested with IgA1
proteases from S. pneumoniae (lanes 2 and 6), N. meningitidis type 2 (lanes 3 and 7), and N. gonorrhoeae
type 1 (lanes 4 and 8) and immunoblotted with anti-human IgA-peroxidase
conjugate. Positions of molecular mass markers in kilodaltons are
indicated on the right. Both IgA1 and the hybrid IgA2/A1 were cleaved
by all of these proteases.
|
|

View larger version (81K):
[in this window]
[in a new window]
|
FIG. 9.
Western blot analysis of proteins separated under
reducing conditions of wild-type IgA1 (lanes 1 [control] and 2) and
IgA2/A1 half hinge (lanes 3 [control] and 4) digested with P. melaninogenica IgA1 protease and probed with anti-human
IgA-peroxidase conjugate. Positions of molecular mass markers in
kilodaltons are indicated on the right. The IgA1 protease of P. melaninogenica cleaved both IgA1 and the hybrid IgA2/A1.
|
|
Investigations into the sensitivity of IgA2/A1 half hinge to type 1 and
type 2 IgA1 proteases of
H. influenzae showed that
although
the hybrid immunoglobulin was cleaved by the type 2 enzyme,
it was much
more resistant to the type 1 enzyme of strain HK368.
Further
investigation with type 1 enzymes from seven different
H. influenzae strains of biotypes I (R27), II (R12, R14, and R16),
III (R20), IV (R11), and VII (R25) showed that the IgA2/A1 hybrid
was
sensitive to four of these type 1 proteases but resistant
to three of
them (Fig.
10).

View larger version (91K):
[in this window]
[in a new window]
|
FIG. 10.
Western blot analysis of proteins separated under
reducing conditions of wild-type IgA1 (A) and IgA2/A1 half hinge (B)
(lane 1, controls) digested with type 2 protease of H. influenzae 110023H and R4 (lanes 2 and 7, respectively) and type 1 protease of H. influenzae R11, R12, R14, R16, R20, R25, and
R27 (lanes 3 to 6 and 8 to 10, respectively) and probed with anti-human
IgA-peroxidase conjugate. The proteases of all strains were active on
wild-type IgA1, but although the type 2 enzyme of H. influenzae cleaved the hybrid IgA2/A1 immunoglobulin, it was
resistant to the type 1 protease of some H. influenzae
strains (R12, R25, and R27).
|
|
 |
DISCUSSION |
Microbial IgA1 proteases are extremely specific. Excepting peptide
bonds present in precursors of the enzymes which are cleaved in their
processing, LAMP1 (the major integral membrane protein of lysosomes)
(19), and some outer membrane proteins of N. gonorrhoeae (36), the only known substrate of IgA1
protease is IgA1 of humans, gorillas, chimpanzees, and orangutans
(32). Little is known about what determines the specificity
of IgA1 proteases. The fact that they cleave human IgA1 at specific
sites in only one of the two available duplicated sites in the hinge
suggests that the two duplicated half hinges have different
conformations or that the enzymes recognize additional elements distant
from the cleavage site.
In an attempt to gain further information about the requirements of IgA
for sensitivity to IgA1 proteases and the determinants of specificity
of IgA1 proteases, seven amino acids representing a half hinge region
of human IgA1 were introduced into protease-resistant human IgA2 to
create an artificial half hinge. The hybrid IgA2/A1 molecule was found
to have an arrangement similar to that of IgA2m(1) with regard to the
bonding of its H and L chains and was deemed to be functionally active
in that it could form rosettes and bind efficiently to Fc
R on
neutrophils and trigger a respiratory burst. However, it now possessed
the O-glycosylated amino acids of half the hinge of IgA1 and showed
sensitivity to several diverse IgA1 proteases.
Determination of the exact site of cleavage by the enzymes in the
IgA2/A1 hybrid was felt beyond the scope of this study because of the
work involved in analyzing the cleavage products generated by so many
different enzymes. However, because of the known extreme specificity of
bacterial IgA1 proteases, it is not unreasonable to assume that the
cleavage site for each enzyme in the IgA2/A1 half hinge hybrid is
identical to its natural cleavage site in one of the duplicated half
hinge regions of the wild-type IgA1 molecule, although conclusive proof
requires amino acid sequence analysis of the cleavage products.
The IgA1 proteases active on the IgA2/A1 half hinge hybrid included
representatives of those which cleave at specific sites in both of the
duplicated half hinges of IgA1, namely, the IgA1 proteases of S. pneumoniae, S. sanguis, H. influenzae 2, N. gonorrhoeae 1 and 2, N. meningitidis 1 and 2, and P. melaninogenica (Fig. 1). Thus, for these enzymes it
would appear that although they cleave IgA1 naturally at a specific
peptide bond in only one of the duplicated half hinge areas (the
preferred cleavage site), if the specific peptide is represented only
once as in the IgA2/A1 half hinge hybrid, these enzymes will still
cleave IgA, thereby overriding the determinants of site selectivity.
The results also indicate that for these enzymes the recognition site
for IgA cleavage is contained in a half hinge region or that if
additional more distal elements are required, the framework of IgA2
substitutes reasonably adequately for that of IgA1. These results
support the work of Pohlner et al. (29) and that of others
(1) who have suggested that the consensus target sequence
for serine-type IgA1 proteases of Neisseria and
Haemophilus is either P-P
S/T-P or P-X-P
S/T/ST-P, where
X is any amino acid, S/T is serine or threonine, and S/T/ST is serine
or threonine or both. These sequences are provided in the IgA2/A1 half
hinge molecule. A proline as the amino acid N-terminal to the cleaved
peptide bond is a requirement for Haemophilus and
Neisseria IgA1 proteases (1). Proline residues introduce bends into polypeptide chains, and these may expose sites for
essential protein-protein interactions.
It was not very surprising, therefore, to find that the IgA2/A1 hybrid
was sensitive to most of the IgA1 proteases of Haemophilus and Neiserria spp., for these are serine-type proteases that
can be inhibited by short peptides. Bachovchin et al. (1)
showed that tri- and tetrapeptide prolyl boronic acid analogues could block the active site of the serine-type IgA1 proteases of
Haemophilus and Neisseria (but not that of the
metalloproteinase IgA1 protease of S. sanguis) and that
synthetic short peptides were cleaved more slowly than the IgA1 hinge.
This suggests that maximum efficiency in cleavage occurs only when the
substrate has the correct length and conformation. In support of this
conclusion, it was repeatedly found that the cleavage of the IgA2/A1
hybrid by IgA1 proteases from some organisms was less complete than
that of wild-type IgA1 after incubation for similar periods. This
suggests not only that cleavage of IgA requires the presence of a
cleavable peptide bond at the correct location but also that other
parts of the molecule influence its sensitivity to IgA protease
cleavage. Although in this study substrate-enzyme reactions were
usually incubated for 72 h, this was done in order not to miss
substrate cleavage by any slow-acting IgA1 protease on the IgA2/A1
hybrid. In fact, all IgA1 proteases that hydrolyzed the hybrid
demonstrated cleavage within 16 h. A more detailed comparison of
the kinetics of IgA1 protease cleavage of the IgA2/A1 half hinge with
that of wild-type IgA1 is to be the subject of a separate investigation.
The reason for the resistance of the IgA2/A1 hybrid to some H. influenzae type 1 proteases is not clear. It is known for
organisms like H. influenzae (and N. meningitidis), which produce type 1 and type 2 proteases which
cleave at different sites within one of the duplicated half hinge
sites, that the site of cleavage is determined by a region near the
amino-terminal end of each protease known as the cleavage site
determinant (CSD) (12). Comparisons between the CSDs of
different organisms have shown that the CSD length varies with the
enzyme and is proportional to the distance between the interchain
disulfide bridge at the top of the CH2 domains prior to the hinge,
i.e., Cys 241, and the specific peptide bond cleaved by the enzyme
(21). It has been suggested that the CSD acts as a spacer
between the catalytic site and the substrate recognition site.
Consistent with this is the finding that cleavage appears to be
dependent on hinge structural features C-terminal to the susceptible
peptide bond because sequential incubation with different IgA1
proteases resulted in cleavage of Fc but not Fab fragments
(21). As the CSD of H. influenzae type 1 protease
is bigger than that of all of the other enzymes (21) and
there is known to be much variation in the CSDs of type 1 proteases of
H. influenzae, it is possible that for some H. influenzae type 1 proteases a single half hinge site is too small
to accommodate such a large CSD spacer and the enzyme is directed to
act at a site outside the half hinge where a Pro-Ser bond is not
present for cleavage. Alternatively, because the IgA1 proteases of
H. influenzae are the most antigenically diverse, more than
30 antigenic types having been described on the basis of antibody
neutralization tests (17, 22), it may be that some are
unable to cleave the IgA2/A1 hybrid because of steric hindrance due to
their increased bulk and the closer approach of the Fc and Fab arms.
The inability of the protease of S. oralis alone among the
streptococcal IgA1 proteases to cleave the IgA2/A1 hybrid is difficult to understand and explain, for all are metalloproteinases, the cleavage
site on IgA1 is the same for all, and their amino acid sequences are
highly homogeneous (31). Moreover, unlike the situation with
H. influenzae type 1 proteases, the proteases of S. oralis are all of one antigenic type (33). However, the
iga protease gene in S. oralis contains elements
displaying subtle differences from those of S. sanguis and
S. pneumoniae which may contribute to a particular cleavage
site specificity. It is also possible that the S. oralis
protease requires structures outside the half hinge in the hybrid
antibody for which IgA2 elements are not an acceptable alternative to
IgA1 elements for substrate recognition.
The susceptibility of IgA1 to IgA1 proteases can be influenced by its
state of glycosylation (33), and it is possible that the
carbohydrates in the hinge region contribute to the specificity of IgA1
proteases. The IgA1 hinge region contains several potential sites for
O-linked glycosylation (2, 33). Classically, in studies of
IgA1 myelomas, these have been considered to be the five serine
residues, four of which have
galactosyl-
1-3-N-acetylgalactosamine groups (and possibly
sialic acid ;[33;]) whereas Ser 224 has N-acetylgalactosamine (10). More recently,
however, analysis of IgA1 from serum indicates that the sugars are
O-linked via both serine and threonine residues asymmetrically
distributed between the two duplicated halves of the hinge
(22). Thus, it could be argued that the two duplicated half
hinges in wild-type IgA1 are distinguishable on the basis of
differences in glycosylation.
The half hinge region of the IgA2/A1 hybrid is believed to be
O-glycosylated, for it was found to bind the biotinylated lectin jacalin, which is specific for the O-linked sugars restricted to the
hinge of IgA1. Although the exact state of glycosylation of the half
hinge region is not known, it can at best presumably resemble only one
of the half hinges of IgA. Thus, it is unlikely that the O-linked
sugars act as determinants of specificity and direct the protease
specifically to one of the duplicated half hinge regions in IgA1
because representatives of proteases acting in each of these different
regions in IgA1 were all able to cleave IgA2/A1 half hinge. If the half
hinge in the IgA2/A1 hybrid is underglycosylated or glycosylated
incorrectly in other ways, it is unlikely that this is the reason for
the resistance of the molecule to the S. oralis and some
H. influenzae type 1 proteases because we have observed
(M. R. Batten, B. W. Senior, M. Kilian, and J. M. Woof,
unpublished data) that when O-linked glycosylation of the IgA1 hinge
region was perturbed through substitution of its serine residues with
alanine and that of threonine 225 with valine, the modified IgA1
molecules nevertheless remained sensitive to virtually all types of
IgA1 proteases, including those of S. oralis and H. influenzae type 1.
A molecular model for human IgA1 based on small-angle X-ray and
neutron-scattering analysis has recently been generated (4). The average conformation of the antibody is predicted to be T shaped,
with the Fab arms widely separated. The hinge peptides are suggested to
adopt extended, exposed structures, presumably readily accessible to
IgA1 proteases. In the IgA2/A1 hybrid, a similar structural arrangement
may be present but with the Fab arms held much closer to the Fc
portion. A maintained exposure of the shortened hinge might then
explain the continued access, recognition, and thus sensitivity of the
molecule to most of the IgA1 proteases, whereas the closer proximity of
the Fab and Fc regions may for some IgA1 proteases present an
unfavorable arrangement for access or substrate recognition or both.
In summary, this study has shown that through the insertion into
protease-resistant IgA2 of seven amino acids representing half the
hinge region of IgA1, a hybrid IgA2/A1 molecule that was functionally
active and sensitive to many different bacterial IgA1 proteases was formed.
 |
ACKNOWLEDGMENTS |
We thank R. Pleass for helpful discussions.
This work was supported by the Wellcome Trust.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular and Cellular Pathology, University of Dundee Medical School, Ninewells Hospital, Dundee DD1 9SY, United Kingdom. Phone: 44 1382 660111, ext. 33540. Fax: 44 1382 641907. E-mail:
j.m.woof{at}dundee.ac.uk.
Editor:
E. I. Tuomanen
 |
REFERENCES |
| 1.
|
Bachovchin, W. W.,
A. G. Plaut,
G. R. Flentke,
M. Lynch, and C. A. Kettner.
1990.
Inhibition of IgA1 proteinases from Neisseria gonorrhoeae and Haemophilus influenzae by peptide prolyl boronic acids.
J. Biol. Chem.
265:3737-3743.
|
| 2.
|
Baenziger, J., and S. Kornfeld.
1974.
Structure of the carbohydrate units of IgA immunoglobulin. II. Structure of the O-glycosidically linked oligosaccharide units.
J. Biol. Chem.
249:7270-7281[Abstract/Free Full Text].
|
| 3.
|
Blake, M.,
K. K. Holmes, and J. Swanson.
1979.
Studies on gonococcus infection. XVII. IgA1-cleaving protease in vaginal washings from women with gonorrhea.
J. Infect. Dis.
139:89-92[Medline].
|
| 4.
|
Boehm, M. K.,
J. M. Woof,
M. A. Kerr, and S. J. Perkins.
1999.
The Fab and Fc fragments of IgA1 exhibit a different arrangement from that in IgG: a study by X-ray and neutron scattering and homology modelling.
J. Mol. Biol.
286:1421-1447[CrossRef][Medline].
|
| 5.
|
Brooks, G. F.,
C. J. Lammel,
M. S. Blake,
B. Kusecek, and M. Achtman.
1992.
Antibodies against IgA protease are stimulated both by clinical disease and asymptomatic carriage of serogroup A Neisseria meningitidis.
J. Infect. Dis.
166:1316-1321[Medline].
|
| 6.
|
Carayannopoulos, L.,
J. M. Hexham, and J. D. Capra.
1996.
Localization of the binding site for the monocyte immunoglobulin (Ig)A-Fc receptor (CD89) to the domain boundary between C 2 and C 3 in human IgA1.
J. Exp. Med.
183:1579-1586[Abstract/Free Full Text].
|
| 7.
|
Chen, E. Y., and P. H. Seeburg.
1985.
Supercoil sequencing: a fast and simple method for sequencing plasmid DNA.
DNA
4:165-170[Medline].
|
| 8.
|
Chintalacharuvu, K. R., and S. L. Morrison.
1996.
Residues critical for H-L disulfide bond formation in human IgA1 and IgA2.
J. Immunol.
157:3443-3449[Abstract].
|
| 9.
|
Devenyi, A. G.,
A. G. Plaut,
F. J. Grundy, and A. Wright.
1993.
Post-infectious human serum antibodies inhibit IgA1 proteinases by interaction with the cleavage site specificity determinant.
Mol. Immunol.
30:1243-1248[CrossRef][Medline].
|
| 10.
|
Frangione, B., and C. Wolfenstein-Todel.
1972.
Partial duplication of the hinge region of IgA1 myeloma proteins.
Proc. Natl. Acad. Sci. USA
69:3673-3676[Abstract/Free Full Text].
|
| 11.
|
Gilbert, J. V.,
A. G. Plaut,
B. Longmaid, and M. E. Lamm.
1983.
Inhibition of microbial IgA proteases by human secretory IgA and serum.
Mol. Immunol.
20:1039-1049[CrossRef][Medline].
|
| 12.
|
Grundy, F. J.,
A. G. Plaut, and A. Wright.
1990.
Localization of the cleavage site specificity determinant of Haemophilus influenzae immunoglobulin A1 protease genes.
Infect. Immun.
58:320-331[Abstract/Free Full Text].
|
| 13.
|
Horton, R. M.,
H. D. Hunt,
S. N. Ho,
J. K. Pullen, and L. R. Pease.
1989.
Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension.
Gene
77:61-68[CrossRef][Medline].
|
| 14.
|
Insel, R. A.,
P. Z. Allen, and I. D. Berkowitz.
1982.
Types and frequency of Haemophilus influenzae IgA1 proteases.
Semin. Infect. Dis.
4:225-231.
|
| 15.
|
Kilian, M.,
J. Reinholdt,
H. Lomholt,
K. Poulsen, and E. V. G. Frandsen.
1996.
Biological significance of IgA1 proteases in bacterial colonization and pathogenesis: critical evaluation of experimental evidence.
APMIS
104:321-338[Medline].
|
| 16.
|
Kilian, M., and M. W. Russell.
1994.
Function of mucosal immunoglobulins, p. 127-137.
In
P. L. Ogra, et al. (ed.), Handbook of mucosal immunology. Academic Press, London, England.
|
| 17.
|
Kilian, M.,
B. Thomsen,
T. E. Petersen, and H. Bleeg.
1983.
Molecular biology of Haemophilus influenzae IgA1 proteases.
Mol. Immunol.
20:1051-1058[CrossRef][Medline].
|
| 18.
|
Liljemark, W. F.,
C. G. Bloomquist, and J. Ofstehage.
1979.
Aggregation and adherence of Streptococcus sanguis: role of human salivary immunoglobulin A.
Infect. Immun.
26:1104-1110[Abstract/Free Full Text].
|
| 19.
|
Lin, L.,
P. Ayala,
J. Larson,
M. Mulks,
M. Fukuda,
S. R. Carlsson,
C. Enns, and M. So.
1997.
The Neisseria type 2 IgA1 protease cleaves LAMP1 and promotes survival of bacteria within epithelial cells.
Mol. Microbiol.
24:1083-1094[CrossRef][Medline].
|
| 20.
|
Lindh, E.
1975.
Increased resistance of immunoglobulin A dimers to proteolytic degradation after binding of secretory component.
J. Immunol.
114:284-286[Abstract/Free Full Text].
|
| 21.
|
Lomholt, H.,
K. Poulsen, and M. Kilian.
1995.
Comparative characterization of the iga encoding IgA1 protease in Neiserria meningitidis, Neisseria gonorrhoeae, and Haemophilus influenzae.
Mol. Microbiol.
15:495-506[Medline].
|
| 22.
|
Lomholt, H.,
L. van Alphen, and M. Kilian.
1993.
Antigenic variation of immunoglobulin A1 proteases among sequential isolates of Haemophilus influenzae from healthy children and patients with chronic obstructive pulmonary disease.
Infect. Immun.
61:4575-4581[Abstract/Free Full Text].
|
| 23.
|
Mattu, T. S.,
R. J. Pleass,
A. C. Willis,
M. Kilian,
M. R. Wormald,
A. C. Lellouch,
P. M. Rudd,
J. M. Woof, and R. A. Dwek.
1997.
The glycosylation and structure of human serum IgA1, Fab and Fc regions and the role of N-glycosylation on Fc receptor interactions.
J. Biol. Chem.
273:2260-2272[Abstract/Free Full Text].
|
| 24.
|
Mestecky, J., and M. Kilian.
1985.
Immunoglobulin A (IgA).
Methods Enzymol.
116:37-75[Medline].
|
| 25.
|
Morton, H. C.,
J. D. Atkin,
R. J. Owens, and J. M. Woof.
1993.
Purification and characterization of chimeric human IgA1 and IgA2 expressed in COS and Chinese hamster ovary cells.
J. Immunol.
151:4743-4752[Abstract].
|
| 26.
|
Plaut, A. G.
1983.
The IgA1 proteases of pathogenic bacteria.
Annu. Rev. Microbiol.
37:603-622[CrossRef][Medline].
|
| 27.
|
Pleass, R. J.,
P. D. Andrews,
M. A. Kerr, and J. M. Woof.
1996.
Alternative splicing of the human IgA Fc receptor CD89 in neutrophils and eosinophils.
Biochem. J.
318:771-777.
|
| 28.
|
Pleass, R. J.,
J. I. Dunlop,
C. M. Anderson, and J. M. Woof.
1999.
Identification of residues in the CH2/CH3 domain interface of IgA essential for interaction with the human Fc receptor (Fc R) CD89.
J. Biol. Chem.
274:23508-23514[Abstract/Free Full Text].
|
| 29.
|
Pohlner, J.,
R. Halter, and T. F. Meyer.
1988.
Neisseria gonorrhoeae IgA protease. Secretion and implications for pathogenesis, p. 427-432.
In
J. T. Poolman, et al. (ed.), Gonococci and meningococci. Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
| 30.
|
Polissi, A.,
A. Pontiggia,
G. Feger,
M. Altieri,
H. Mottl,
L. Ferrai, and D. Simon.
1998.
Large-scale identification of virulence genes from Streptococcus pneumoniae.
Infect. Immun.
66:5620-5629[Abstract/Free Full Text].
|
| 31.
|
Poulsen, K.,
J. Reinholdt,
C. Jespersgaard,
K. Boye,
T. A. Brown,
M. Hauge, and M. Kilian.
1998.
A comprehensive genetic study of streptococcal immunoglobulin A1 proteases: evidence for recombination within and between species.
Infect. Immun.
66:181-190[Abstract/Free Full Text].
|
| 32.
|
Qiu, J.,
G. P. Brackee, and A. G. Plaut.
1996.
Analysis of the specificity of bacterial immunoglobulin A (IgA) proteases by a comparative study of ape serum IgAs as substrates.
Infect. Immun.
64:933-937[Abstract/Free Full Text].
|
| 33.
|
Reinholdt, J.,
M. Tomana,
S. B. Mortensen, and M. Kilian.
1990.
Molecular aspects of immunoglobulin A1 degradation by oral streptococci.
Infect. Immun.
58:1186-1194[Abstract/Free Full Text].
|
| 34.
|
Senior, B. W.,
M. Albrechtsen, and M. A. Kerr.
1987.
Proteus mirabilis strains of diverse type have IgA protease activity.
J. Med. Microbiol.
24:175-180[Abstract/Free Full Text].
|
| 35.
|
Senior, B. W.,
L. M. Loomes, and M. A. Kerr.
1991.
Microbial IgA proteases and virulence.
Rev. Med. Microbiol.
2:200-207.
|
| 36.
|
Shoberg, R. J., and M. Mulks.
1991.
Proteolysis of bacterial membrane proteins by Neisseria gonorrhoeae type 2 immunoglobulin A1 protease.
Infect. Immun.
59:2535-2541[Abstract/Free Full Text].
|
| 37.
|
Stewart, W. W., and M. A. Kerr.
1990.
The specificity of the human neutrophil IgA receptor (Fc R) determined by measurement of chemiluminescence induced by serum or secretory IgA1 or IgA2.
Immunology
71:328-334[Medline].
|
| 38.
|
Svanborg-Eden, C., and A. M. Svennerholm.
1978.
Secretory immunoglobulin A and G antibodies prevent adhesion of Escherichia coli to human urinary tract epithelial cells.
Infect. Immun.
22:790-797[Abstract/Free Full Text].
|
| 39.
|
Walker, M. R.,
B. M. Kumpel,
K. Thompson,
J. M. Woof,
D. R. Burton, and R. Jefferis.
1988.
Immunogenic and antigenic epitopes of immunoglobulins: binding of human monoclonal anti-D antibodies to FcRI on the monocyte-like U937 cell line.
Vox Sang.
55:222-228[Medline].
|
| 40.
|
Williams, R. C., and R. J. Gibbons.
1972.
Inhibition of bacterial adherence by secretory immunoglobulin A: a mechanism of antigen disposal.
Science
177:697-699[Abstract/Free Full Text].
|
Infection and Immunity, February 2000, p. 463-469, Vol. 68, No. 2
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Senior, B. W., Woof, J. M.
(2005). The Influences of Hinge Length and Composition on the Susceptibility of Human IgA to Cleavage by Diverse Bacterial IgA1 Proteases. J. Immunol.
174: 7792-7799
[Abstract]
[Full Text]
-
Senior, B. W., Woof, J. M.
(2005). Effect of Mutations in the Human Immunoglobulin A1 (IgA1) Hinge on Its Susceptibility to Cleavage by Diverse Bacterial IgA1 Proteases. Infect. Immun.
73: 1515-1522
[Abstract]
[Full Text]
-
Chintalacharuvu, K. R., Chuang, P. D., Dragoman, A., Fernandez, C. Z., Qiu, J., Plaut, A. G., Trinh, K. R., Gala, F. A., Morrison, S. L.
(2003). Cleavage of the Human Immunoglobulin A1 (IgA1) Hinge Region by IgA1 Proteases Requires Structures in the Fc region of IgA. Infect. Immun.
71: 2563-2570
[Abstract]
[Full Text]
-
Batten, M. R., Senior, B. W., Kilian, M., Woof, J. M.
(2003). Amino Acid Sequence Requirements in the Hinge of Human Immunoglobulin A1 (IgA1) for Cleavage by Streptococcal IgA1 Proteases. Infect. Immun.
71: 1462-1469
[Abstract]
[Full Text]