Previous Article | Next Article 
Infection and Immunity, February 2000, p. 535-542, Vol. 68, No. 2
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Nonpolar Inactivation of the Hypervariable
Streptococcal Inhibitor of Complement Gene (sic) in Serotype
M1 Streptococcus pyogenes Significantly Decreases Mouse
Mucosal Colonization
Slawomir
Lukomski,1
Nancy P.
Hoe,1,2
Iman
Abdi,1
Jacqueline
Rurangirwa,1
Parichher
Kordari,1
Mengyao
Liu,1,2
Shu-Jun
Dou,1
Gerald G.
Adams,1 and
James M.
Musser1,2,*
Institute for the Study of Human Bacterial
Pathogenesis, Department of Pathology, Baylor College of Medicine,
Houston, Texas 77030,1 and Laboratory of
Human Bacterial Pathogenesis, Rocky Mountain Laboratories, National
Institute of Allergy and Infectious Diseases, National Institutes of
Health, Hamilton, Montana 598402
Received 3 September 1999/Returned for modification 6 October
1999/Accepted 29 October 1999
 |
ABSTRACT |
Group A Streptococcus (GAS) is a human pathogen that
commonly infects the upper respiratory tract. GAS serotype M1 strains are frequently isolated from human infections and contain the gene
encoding the hypervariable streptococcal inhibitor of complement protein (Sic). It was recently shown that Sic variants were rapidly selected on mucosal surfaces in epidemic waves caused by M1 strains, an
observation suggesting that Sic participates in host-pathogen interactions on the mucosal surface (N. P. Hoe, K. Nakashima, S. Lukomski, D. Grigsby, M. Liu, P. Kordari, S.-J. Dou, X. Pan, J. Vuopio-Varkila, S. Salmelinna, A. McGeer, D. E. Low, B. Schwartz, A. Schuchat, S. Naidich, D. De Lorenzo, Y.-X. Fu, and J. M. Musser, Nat. Med. 5:924-929, 1999). To test this idea, a new
nonpolar mutagenesis method employing a spectinomycin resistance
cassette was used to inactivate the sic gene in an M1 GAS
strain. The isogenic Sic-negative mutant strain was significantly
(P < 0.019) impaired in ability to colonize the mouse
mucosal surface after intranasal infection. These results support the
hypothesis that the predominance of M1 strains in human infections is
related, in part, to a Sic-mediated enhanced colonization ability.
 |
INTRODUCTION |
Group A Streptococcus
(GAS) is a gram-positive bacterial pathogen that causes human disease
globally. The organism is responsible for many diverse infection types,
including pharyngitis, acute rheumatic fever, and invasive diseases
such as bacteremia and necrotizing fasciitis. A resurgence of invasive
disease episodes in recent years has been documented in many countries,
including those in North America, Europe, and the Far East (reviewed in reference 23). Extensive epidemiological studies
have found that in most localities, strains expressing serotype M1
protein predominate (23). The M protein is a highly
polymorphic surface protein that is an important virulence factor of
GAS, in part because it is antiphagocytic (8). More than 80 M protein types have been recognized on the basis of serologic studies
conducted over decades and more recently DNA sequencing investigations
(2). The molecular explanation for the abundant
representation of serotype M1 strains among invasive isolates is unknown.
Molecular characterization of serotype M1 strains cultured from
patients with invasive infections has shown that in general, there is
relatively restricted genetic diversity among most strains (22,
23). For example, analysis of variation in 10 genes in large
samples of M1 GAS from several countries failed to identify sequence
diversity in virtually all genes studied (22, 23). Although
most M1 strains are closely related in overall genomic character,
recently it has been shown that a protein that inhibits the normal
cytolytic effect of the C5b-C9 membrane attack complex of human
complement is remarkably hypervariable (1, 10, 29). This
protein, known as the streptococcal inhibitor of complement (Sic), is
encoded by the sic gene that is located in the Mga virulence regulon of GAS (1, 14). Initial DNA sequence analysis of sic variation among 165 M1 strains identified 62 alleles,
virtually all of which would encode distinct protein variants
(29). The observation that most gene alleles would encode
distinct protein variants, together with a lack of synonymous (silent,
not resulting in amino acid replacements) nucleotide substitutions
strongly suggested that the Sic protein is under strong natural
selection pressure. This idea is supported by the preponderance of
radical amino acid replacements (polar-nonpolar replacements or those resulting in charge changes) found among the Sic variants (10, 29).
Serotype M1 strains also have the ability to undergo rapid changes in
disease frequency and severity (19, 21, 23). Epidemic waves
of serotype M1 strains have been documented in several countries (23). Although the exact molecular explanation for the
ability of M1 strains to cause epidemic waves is unknown, recent
analysis of the molecular population genetics of epidemic waves of
serotype M1 organisms in Finland; Ontario, Canada; and four regions in the United States found that in contrast to the prevailing idea that
these epidemic waves are mono- or pauciclonal, they are composed of M1
strains with a highly diverse array of Sic variants that are rapidly
selected in the course of the epidemic waves (10). Study of
M1 strains from humans with pharyngitis and analysis of organisms
recovered from the nasopharynx of persistently colonized mice
discovered that new Sic variants are selected on the mucosal surface.
Taken together, the data suggest that Sic participates in host-pathogen
interaction on the mucosal surface. To directly test this idea, we
constructed an M1 isogenic mutant strain in which the sic
gene was inactivated by a new nonpolar mutagenesis strategy. The
nonpolar mutagenesis approach was necessary because the sic gene is located in the Mga regulon and hence is located close to genes
encoding important GAS virulence factors, including emm and
scpA, encoding M1 protein and a protease that cleaves and inactivates complement factor C5a, respectively. The isogenic mutant
strain had significantly decreased ability to colonize the nasopharynx
of mice. We hypothesize that the predominance of M1 strains in human
infections is related, in part, to a Sic-mediated enhanced colonization ability.
 |
MATERIALS AND METHODS |
Bacterial strains and plasmids.
The bacterial strains and
plasmids used in this study are described in Table
1. GAS strain MGAS 1600 was used for
cloning the sic1.07 allele, which contains a naturally
occurring T
C mutation located in the
10 region of the presumed
sic promoter. This mutation is associated with decreased Sic
expression by the source strain. The strain (MGAS 5005) used to
generate the isogenic Sic-deficient mutant contains the most frequently
identified sic allele (sic1.01) and produces
abundant levels of secreted Sic protein in vitro. This strain also has
the emm1.0 gene allele and genes encoding SpeA and SpeC
exotoxins.
GAS strains were grown in Todd-Hewitt broth (Difco Laboratories,
Detroit, Mich.) supplemented with 0.2% yeast extract (THY medium).
Brain-heart infusion agar (Difco Laboratories) or tryptose agar with
5% sheep blood (Becton Dickinson, Cockeysville, Md.) was used as solid
medium. For mutant selection, brain heart infusion agar supplemented
with spectinomycin (150 µg/ml) was used. The GAS strains were
incubated at 37°C in 5% CO2-20% O2 atmosphere.
Cloning experiments were performed with Escherichia coli
XL-1 Blue (Stratagene, La Jolla, Calif.).
Construction of nonpolar spc cassettes.
A nonpolar
spectinomycin resistance (spc) cassette was developed to inactivate the
sic gene (Fig. 1A). The
cassette contains the promoterless spectinomycin resistance marker
encoded by the aad gene (16). The 5' region of
the cassette upstream of the aad gene has stop codons in all
three reading frames. A consensus ribosome-binding site (GGAGG)
followed by the ATG start codon is located at the 3' end. To avoid a
polarity effect on downstream genes, the spc cassette is cloned so that
the ATG start codon is in frame with the downstream mutated gene, in
this case sic. Construction of the three cassettes allows
one of them to be used at any restriction site available in the target
gene. This strategy was based on similar aph-3
(20) and cat (chloramphenicol resistance) (17) cassettes used successfully for nonpolar gene
inactivation in gram-negative bacteria.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Construction and testing of the spc cassettes. (A)
Schematic representation of the promoterless spc cassettes. spc1- to 3 cassettes are flanked by SmaI sites and contain the
aad gene conferring resistance to spectinomycin. The
promoterless aad gene was amplified with its original
ribosome-binding site (RBS). At the 5' synthetic end, upstream of the
aad gene, there are stop codons in all three reading frames
(underlined). At the 3' synthetic end, downstream of the aad
gene, the spc1- to 3 cassettes contain the GGAGG consensus
ribosome-binding sites and the ATG start codons in all three reading
frames. (B) Construction of the suicide plasmid pSL114 containing
sic1.07. pSL114 has a temperature-sensitive origin of
replication (oriR1) which maintains low copy number at
30°C. It carries the cat gene. (C) Construction of the
polar and nonpolar mutations within sic1.07. The first eight
amino acids of the Sic signal peptide are shown. The SspI
cleaves in frame after the sixth base pair of the wild-type
sic sequence. The spc1 and spc2 cassettes were cloned at the
SspI site of pSL114, resulting in plasmids pSL128-1 and
128-2, respectively. After passing the TAA stop codon (boxed) of the
aad gene, translation is restored at the ATG start codon
located at the 3' end of the cassettes. An insertion of the spc1
cassette is in frame and results in a single amino acid N P
(underlined) substitution within the Sic signal peptide. An
out-of-frame insertion of the spc2 cassette generates multiple
translational stop codons (asterisks).
|
|
The aad gene contained on plasmid pEU904 (provided by
J. R. Scott, Emory University) and synthetic regulatory sequences
described above which flank the aad gene were amplified by
PCR with three sets of primers. One forward primer (spcF
[GGACCCGGGTGACTAAATAGTGAGGAGGATATATTTG]) complementary to
the 5' region of the aad gene and three different reverse
primers (spcR1
[CCTCCCGGGCATGTGATTTTCCTCCTTTTTATAATTTTTTTAATCTGTTA], spcR2 [CCTCCCGGGCCATGTGATTTTCCTCCTTTTTATAA],
and spcR3 [CCTCCCGGGTCCATGTGATTTTCCTCCTTTTTATAA]) were used. These three PCR products are flanked by
SmaI sites and were back cloned into the E. coli
vector pBC KS
(Stratagene) to obtain cassettes spc1 to 3, contained on plasmids pSL60-1 to -3, respectively (Table 1). The
sequences of the spc cassettes were confirmed to rule out spurious
mutations. All three cassettes conferred spectinomycin resistance to
E. coli in the presence of
isopropyl-
-D-thiogalactopyranoside (IPTG).
spc cassettes are nonpolar in GAS: proof of principle.
To
test the utility of the nonpolar mutagenesis strategy, two
sic mutants were generated with the spc1 and spc2 cassettes by allelic replacement in the chromosome of GAS. Initial data indicated
that sic cloned into E. coli was unstable,
perhaps due to a toxic effect of the Sic protein. Hence, a strain (MGAS
1600) with a mutation in the
10 region of the presumed sic
promoter that is associated with decreased Sic production by the
parental GAS strain was used as the source organism for the cloned
sic allele (sic1.07). The strategy for the
cloning of the sic1.07 gene and insertion of the spc1 and
spc2 cassettes is shown in Fig. 1B and C. The sic1.07 allele
was amplified with sic-specific primers (sic1
[TAAGGAGAGGTCACAAACTA] and sic2
[TTACGTTGCTGATGGTGTAT]) and cloned in a promoterless
low-copy-number plasmid vector pSL97 (Table 1). This vector was based
on plasmid pLEX5B (6), in which the ColE1 origin of
replication (ori) was replaced with a temperature-sensitive
oriR1 which allows the plasmid to be maintained at low copy
number (15). Next, the
-lactamase gene was replaced with
the cat gene from pFW14 (27), resulting in
plasmid pSL114; plasmid pSL114 cannot replicate in GAS. This cloned
sic1.07 allele was then interrupted by insertion of the spc1
and spc2 cassettes after the sixth base pair of the sic
coding sequence (Fig. 1C). The spc1 cassette was inserted in frame with
the downstream sic region (pSL128-1), whereas the spc2
cassette insertion (pSL128-2) was out of frame. These two constructs
were used to generate the sic mutants of MGAS 1600 by
allelic replacement (Fig. 2A).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 2.
Nonpolar mutagenesis of the sic gene by using
the spc cassette. (A) Southern blot analysis of the genomic DNAs
isolated from the MGAS 1600 (sic1.07) wild-type strain and
from MGAS 1600 sic1 (sic::spc1,
in-frame insertion) and MGAS 1600 sic2
(sic::spc2, out-of-frame insertion) mutants. DNAs
were digested with BanII, which has a single recognition
site within the aad gene of the spc cassettes but not in the
sic sequence. Only one mutated sic copy can be
detected in the mutant strains by using the sic-specific
probe homologous to the 3' end of the sic gene. As expected,
the spc probe hybridized only to the DNA of the mutants. (B) Immunoblot
detection of the Sic protein in GAS culture supernatants. Sic1.07 was
produced by the MGAS 1600 wild-type strain and by the in-frame
sic::spc1 mutant. No Sic could be detected in the
culture supernatant of the sic::spc2 out-of-frame
mutant. The identically processed culture supernatant of a GAS serotype
M3 strain lacking the sic gene is shown as a negative
control.
|
|
Since insertion in the sic::spc1 mutant resulted
in only one amino acid change in the signal peptide of the Sic protein,
production of secreted Sic by this mutant was expected. In contrast,
the out-of-frame sic::spc2 insertion should cause
early translation termination, thereby resulting in lack of Sic
secretion. As expected, the in-frame mutant (MGAS 1600 sic1
[sic::spc1]) produced extracellular Sic, whereas
the out-of-frame mutant (MGAS 1600 sic2
[sic::spc2]) did not (Fig. 2B). These results
indicated that the spc cassettes can be used successfully for nonpolar
mutagenesis in GAS.
Construction of the sic-inactivated isogenic mutant
strain.
An analogous strategy was used to generate a nonpolar
sic1.01 knockout isogenic strain of MGAS 5005. We selected
the sic1.01 allele for inactivation because this is the most
common sic allele found in clinical isolates of GAS serotype
M1. For example, the sic1.01 allele was found in 36% of M1
GAS isolates recovered in Finland from 1988 to 1998 (10).
Suicide plasmid pSL127 was constructed (detailed cloning strategy is
shown in Fig. 3) such that an internal part of the sic gene (bp 6 to 811) was replaced with the
spc2 cassette (in-frame insertion). This construct was introduced by electroporation into the wild-type MGAS 5005 organism to obtain a
nonpolar isogenic sic-inactivated mutant derivative. After
initial screening, the MGAS 5005 sic strain was analyzed by
PCR, Southern and Western blotting, and sequencing.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
Construction of the suicide plasmid pSL127, used to
generate an sic1.01-inactivated MGAS 5005. All primers and
restriction sites used in the cloning strategy are shown. (A) Schematic
representation of the Mga regulon with the sic gene in MGAS
5005 (not to scale). The map was drawn based on PCR analyses using
different combinations of primers specific for the emm1.0,
sic1.01, IS1562, and scpA genes. (B)
DNA region containing the sic gene and part of the
IS1562 used in plasmid construction. Major parts of the
sic sequence are shown: Ss, signal sequence; SRR, short
repeat region; R1 to R3, repeat regions 1 to 3; PRR, proline-rich
region. Two chromosomal fragments from MGAS 5005 were amplified.
Fragment 1 (~150 bp), flanked by the PCR-generated XhoI
(sicXho [TCGACTCGAGGTTAAGGAGAGGTCAC]) and
HindIII (sicHind
[TTTTCAAGCTTATTTCTAATATTC]) sites, contained the
sic promoter region and first 26 bp of the coding region.
Fragment 2 (~830 bp), obtained by restriction digestion of the PCR
product (sicATG [GGAGAGAATACTAATGAATATTAG] and
scpA2 [CTGGTGTATCAGCAGTTTTAGC]) with
restriction enzymes BsaBI and SphI, contained a
3' end of the sic proline-rich region and adjusted part of
IS1562. (C) First, fragment 2 was cloned into multiple
cloning site (MCS) II of the E. coli vector pFW12,
generating plasmid pSL123. Next, fragment 1 was cloned into MCS I of
the pSL123, resulting in construct pSL124. (D) In the last step, the
nonpolar spc2 cassette was cloned in frame between the SspI
and PvuII sites of the sic coding sequence,
replacing the original spectinomycin resistance marker
(SpR) of the vector. In this plasmid, designated pSL127,
the spc2 insertion limits the amount of the sic coding
region to 6 bp (2 amino acids) at the 5' end and 129 bp (43 residues)
at the 3' end. Suicide plasmid pSL127 was used to generate an
sic-inactivated isogenic variant of MGAS 5005.
|
|
DNA methods.
Standard methods (28) were used to
manipulate DNA. Plasmid DNA was prepared with a QIAGEN-tip (Qiagen,
Valencia, Calif.). Chromosomal DNA was isolated from GAS as described
previously (22); 5 to 6 µg was used for Southern blotting.
Hybridization was performed with a nonradioactive labeling and
detection system (ECL [enhanced chemiluminescence]; Amersham
Pharmacia Biotech, Inc., Piscataway, N.J.). DNA amplification was
performed with Taq polymerase (Perkin-Elmer). When PCR was
performed directly from E. coli or GAS colonies, cells were
transferred to the reaction mixture on a disposable tip. The
Taq DyeDeoxy terminator cycle sequencing kit (Applied
Biosystems, Inc., Foster City, Calif.) and an ABI 377 instrument were
used to obtain DNA sequence data.
RNA methods.
Total RNA was prepared from GAS cultures (10 ml) grown in THY medium to mid-log phase (optical density at 600 nm
[OD600] of ~0.4). Cell pellets were suspended in 500 µl of TE buffer (10 mM Tris [pH 7.0], 1 mM EDTA) and treated at
37°C for 5 min with 6 µl of mutanolysin (1 mg/ml), 60 µl of
lysozyme (10 mg/ml), and 25 µl of the RNase inhibitor
aurintricarboxylic acid (100 mM stock solution; Sigma, St. Louis, Mo.).
GAS cells were lysed with 60 µl of 20% sodium dodecyl sulfate and
600 µl of acid-phenol-chloroform (5:1 mix, pH 4.5; Ambion, Austin,
Tex.) at 65°C for 5 min. Samples were extracted with equal volumes of
acid-phenol-chloroform until no debris was seen at the interface. The
RNA contained in 400 µl was mixed with 15 µl of 5 M NaCl and
precipitated with 2 volumes of ethanol. DNA was removed by DNase I
digestion followed by an acid-phenol-chloroform extraction. The RNA
was precipitated as described above. Usually, 250 to 300 µg of total
RNA was obtained from a 10-ml culture by this method. The RNA showed
good sample integrity when analyzed in an agarose gel.
Samples (15 µg) of total RNA were denatured and separated in a 0.8%
formaldehyde gel, blotted to a Nytran SuPerCharge membrane (Schleicher
& Schuell, Keene, N.H.), and cross-linked. RNA transfer, hybridization
(42°C), and posthybridization washes were performed with NorthernMax
reagents (Ambion). Biotinylated molecular weight markers (Millenium;
Ambion) were used to evaluate transcript sizes.
Genomic DNA purified from the homologous strain (MGAS 5005) was used to
amplify DNA probes with primers specific for the emm (9), sic (1), scpA
(4), and recA (30) genes (Table 2). DNA probes (500 to 600 bp)
corresponding to gene regions encoding the amino-terminal parts of the
mature proteins were biotinylated with BrightStar labeling reagents
(Ambion). Hybridizing bands were detected with streptavidin-POD
conjugate (Roche Molecular Biochemicals, Indianapolis, Ind.) and
visualized with an ECL reagent.
The transcripts were quantitated by densitometry with the BioImage
Whole Band Analysis computer program (BioImage, Ann Arbor, Mich.). The
amounts of the transcripts were normalized by comparison with the
amount of the recA transcript in the same sample.
Protein methods.
Sic expression was assayed in the culture
supernatants of GAS grown to exponential phase (OD600 of
~0.5) in THY medium. Proteins were precipitated with 30% ammonium
sulfate and analyzed by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis followed by staining with Coomassie brilliant blue or
by Western blotting with rabbit polyclonal serum raised against
purified Sic1.01 (10). An ECL visualization protocol was used.
Measurement of anti-Sic immunoglobulin G (IgG) in mouse and human
sera.
Mouse sera were obtained on day 24 from the blood of 34 animals that survived 21 days after intranasal inoculation with the MGAS 5005 wild-type strain. Eleven mice were persistently colonized in
the throat with GAS, and 23 were not. Serum samples from 15 of the mice
that were not colonized on day 24 and all 11 samples from persistently
colonized mice were assayed. Human sera from 198 healthy individuals
with no history of invasive GAS disease were used for the analysis.
For detection of anti-Sic1.01 IgG in mouse and human sera, plate wells
were coated with purified Sic1.01 (10 µg/ml in carbonate buffer, pH
9.6) at room temperature overnight. The wells were washed three times
with phosphate-buffered saline (PBS) containing 0.1% Tween 20 (TPBS)
and blocked with 5% gelatin in TPBS. For detection of anti-Sic IgG in
mouse sera, twofold dilutions of each serum sample were prepared in PBS
from a starting dilution of 1:20. One hundred microliters of each
dilution was added to test wells. Mouse serum that did not react with
Sic1.01 was used as a negative control. The plate blank consisted of
100 µl of PBS. For detection of anti-Sic IgG in human sera,
microtiter plates were coated with Sic1.01 and washed as described
above. Human sera were used at a single dilution of 1:200. Human sera
that did not react with Sic1.01 were used as negative controls. The plate blank consisted of 100 µl of PBS. For both mouse and human sera, the plates were incubated at 37°C for 2 h. The plates were washed three times with TPBS, and 100 µl of horseradish
peroxidase-conjugated goat antibody directed against mouse or human IgG
(whole molecule, 1:2,000; Bio-Rad, Hercules, Calif.) was added to all
wells. The plates were then incubated for 2 h at 37°C, washed
three times as described above, and incubated with
2,2'-azino-bis-[3-ethylbenzthiazoline-6-sulfonic acid] (ABTS; Roche
Molecular Biochemicals) as the development agent for 20 min at room
temperature in the dark. Absorbance was measured at 405 nm with a
Spectramax PLUS instrument (Molecular Dynamics, Sunnyvale, Calif.).
Titers of anti-Sic IgG in mouse sera were calculated with SOFTmax PRO
software version 2.6.1. Human serum samples were considered to have
specific Sic antibody if absorbance readings were greater than the
average of the negative controls (i.e., human sera that did not react
with Sic1.01) plus 3 standard deviation values.
Mouse colonization experiments.
Isogenic GAS wild-type and
sic mutant strains were grown in THY medium and harvested in
the logarithmic phase (OD600 of ~0.5 to 0.6), when
abundant Sic production occurs. The cells were washed once and
resuspended in sterile ice-cold, pyrogen-free PBS to give the required
inoculum. Colony counts were performed to determine the actual number
of CFU used in each experiment. Control animals inoculated with PBS
were always culture negative for GAS. The animals were anesthetized by
inhalation of Metofane (Mallinckrodt Veterinary, Mundelein, Ill.) prior
to experimental procedures.
Mouse throat colonization studies were conducted with adult (18- to
20-g) male outbred CD-1 Swiss mice (Harlan Sprague-Dawley Inc.,
Houston, Tex.) as described previously (18). The mice were
inoculated in the nares with 50 µl of GAS cell suspensions. The mouse
throats were swabbed periodically for 3 weeks. GAS cells present on
swabs were suspended in 1 ml of PBS, and 0.1 ml from these samples was
cultured on blood agar. Blood was collected from dead animals by
cardiac puncture and cultured on blood agar. All blood samples from
dead animals grew GAS. In addition, sic mutant colonies
recovered from both dead and colonized mice were tested for reversion
by streaking on medium with spectinomycin. All 400 colonies tested
(one-half isolated from the blood and one-half from the throat)
maintained the spectinomycin-resistant phenotype, indicating that the
mutant was stable in the host without antibiotic selection.
Statistical analysis.
Fisher's exact two-tailed test was
used to assess statistical differences in mouse mortality and throat
colonization between the animal groups infected with the wild-type GAS
or the isogenic sic mutant strain. A logistic regression
model was used to compare mouse throat colonization by the wild-type
and mutant strains. Statistical calculations were performed with SAS
software (SAS Institute Inc., Cary, N.C.).
 |
RESULTS |
Anti-Sic immune response in mice and humans.
Recent
investigation discovered that in contrast to other genes analyzed
(including emm1, encoding M1 protein), the sic
gene and Sic protein are highly variable among serotype M1 GAS
recovered in epidemic waves in all geographic localities studied
(10). In addition, Sic structural variants were selected
after intranasal inoculation of mice but not during in vitro
cultivation (10, 29). These observations imply that Sic is
made in vivo, but this aspect of GAS pathogenesis has not been studied.
If Sic is made in vivo, we expected that infected mammalian hosts would make antibody against this protein. To test this issue, we first analyzed the anti-Sic serum antibody response in mice inoculated intranasally with wild-type MGAS 5005. Nine of 11 animals (82%) persistently colonized in the throat on day 24 after intranasal inoculation had specific anti-Sic1.01 IgG antibodies as assessed by
enzyme-linked immunosorbent assay (ELISA) (Fig.
4). In contrast, animals that were not
persistently colonized after intranasal inoculation lacked anti-Sic
serum antibodies.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 4.
Graph of anti-Sic1.01 IgG titers in serum from mice
persistently colonized in the throat with MGAS 5005. Serum samples were
obtained on day 24 postinfection and tested in an ELISA against
purified Sic1.01 at a starting dilution of 1:20. Titers were calculated
with SOFTmax PRO software version 2.6.1.
|
|
These data suggested that Sic was expressed in the course of GAS
infection of the human mucosal surface. To address this possibility, we
tested serum obtained from 198 randomly selected children between 6 months and 18 years of age for anti-Sic serum IgG by ELISA. These
children had no known history of invasive GAS disease. Approximately one-fourth (46 of 198 [23%]) has serum antibody against Sic, a result indicating that this protein is also made during human mucosal
infection. Detailed analysis of the human serologic response to Sic
will be presented elsewhere.
Construction and characterization of the Sic1.01-negative nonpolar
isogenic mutant.
The presence of anti-Sic antibody in experimental
mice and humans indicated that Sic was expressed during mucosal
infection. In addition, interaction with the host mucosal surface has
been shown to result in a high frequency of selection of new Sic
variants (10). Inasmuch as both seroconversion to Sic and
selection of Sic variants have been observed in mice and humans, we
investigated if Sic participates in mouse throat colonization. A
nonpolar sic- inactivated isogenic mutant strain was
constructed to test this idea.
Strain MGAS 5005 contains the most frequently occurring
sic1.01 gene allele (10, 29) and was used to
generate an isogenic sic-inactivated mutant derivative. This
strain also has the emm1.0 allele and genes encoding SpeA
and SpeC exotoxins. To generate the Sic-negative nonpolar isogenic
strain of MGAS 5005, an internal part of the cloned sic gene
located between bp 6 to 811 was replaced with the spc2 cassette
(in-frame insertional replacement). After allelic replacement, the MGAS
5005 sic mutant was confirmed by PCR, Southern blotting, and
sequencing. Since insertion of the spc2 cassette removed most of the
sic coding sequence (270 of the 313 amino acid residues),
the mutant strain did not produce extracellular Sic protein (data not shown).
To confirm that sic inactivation did not have a polar effect
on flanking genes, expression of the emm and scpA
genes was studied (Fig. 5). This analysis
was particularly important since both genes encode documented GAS
virulence factors. Single transcripts of the predicted molecular size
were identified for emm, sic, and scpA
genes in the wild-type MGAS 5005 organism. No sic-specific transcript was detected in the MGAS 5005 sic mutant. In
addition, there was no difference in the amount of the
emm-specific transcripts made by the wild-type and
sic mutant strains. Moreover, there was no significant
difference in the amount of the scpA-specific transcript
quantified in RNA samples isolated from both strains in three
independent experiments. Hence, the genetic strategy ablated Sic
production without altering expression of the genes flanking
sic. sic inactivation did not alter the growth
rate or colony morphology of the mutant (data not shown).

View larger version (93K):
[in this window]
[in a new window]
|
FIG. 5.
Northern blot analysis of emm,
sic, and scpA gene expression by wild-type strain
MGAS 5005 (5005 wt) and by the isogenic 5005 sic mutant. No
sic transcript could be detected in the mutant strain. In
addition, transcription of the emm and scpA genes
was unaffected. Biotinylated DNA probes were used for hybridization.
The biotinylated molecular weight RNA marker was used to evaluate
transcript sizes.
|
|
sic inactivation decreases mouse throat
colonization.
To test the hypothesis that inactivation of
sic altered mouse throat colonization, we used a logistic
regression analysis to compare colonization by the wild-type GAS
serotype M1 and the isogenic sic-inactivated mutant (Fig.
6). Five dilutions (twofold dilutions
ranging from ~8 × 107 to 0.5 × 107 CFU) of the wild-type and mutant strains were used to
inoculate groups of 10 mice intranasally. Mouse throats were swabbed
periodically, and the bacteria were cultured on a blood agar. In
addition, blood samples from dead animals were cultured. There was no
significant difference in the number of dead mice or Kaplan-Meier
survival curves on day 21 after infection with the wild-type (16 of 50 mice on day 21) or mutant (14 of 50 mice) strain. In contrast, we
observed a significant difference in colonization of the mouse mucosa.
Significantly more mice inoculated with the wild-type GAS strain were
culture positive than mice infected with the sic mutant
strain (P < 0.019) (Fig. 5). The results of a logistic regression model using GAS colonization data obtained from only the
mice which survived were also significantly different (P = 0.023), as observed with the data obtained from the model which included dead mice (analysis described above). The odds ratio for the
wild-type strain was 2.81, which indicated that the MGAS 5005 parental
organism had a much higher incidence of throat colonization. However,
the level of inoculum was not significant, indicating that the
incidence of throat colonization was not related to the amount of
inoculum given to the mice. Therefore, experiments with animals
infected with all five inocula of the wild-type strain or the
sic mutant were combined. A significant group difference was
found (P < 0.035; Fisher's exact two-tailed test). We
note that the difference in colonization by the wild-type and mutant strains was statistically significant during the first 4 days postinoculation. These results suggested that Sic plays a
significant role at the early stages of infection. Because the large
number of the mice died during the study period, the number of
surviving animals in each experimental group was not adequate for
statistical comparison. Taken together, our results indicate that Sic
participated in GAS-host interactions by enhancing early colonization
of the mucosal surfaces.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 6.
Logistic regression analysis of death and throat
colonization at 72 h after intranasal inoculation with the 5005 wild-type strain (open circles) or with the 5005 sic mutant
(solid circles). Each data point represents 10 mice. The y
axis represents estimated percent culture-positive animals. The data
fit the model (P = 0.021); the group difference was
significant (P < 0.019); the dose-dependent parameter
was not significant.
|
|
 |
DISCUSSION |
GAS causes epidemic waves of pharyngitis and severe invasive
infections worldwide (23). GAS strains of serotype M1 have been predominantly responsible for countrywide epidemics for reasons that are not known. The observations that the Sic protein was hypervariable in serotype M1 strains recovered from epidemic waves and
that new structural Sic variants were selected on mucosal surfaces in
the course of epidemic waves suggested that Sic could contribute to
host colonization (10).
We constructed a sic-inactivated nonpolar isogenic mutant
strain to directly assess the contribution of Sic to mucosal
colonization of a mammalian host. Construction of gene-inactivated GAS
isogenic strains has mainly used the conjugative transposon
Tn916 (3, 24, 32) or plasmid-directed insertional
mutagenesis (25, 26, 31). Despite many successful
applications, both methods have several disadvantages, including
uncontrolled chromosomal insertions resulting in the need for laborious
screening, presence of foreign vector sequences in the GAS genome, or
existence of two copies of the mutated gene, thereby creating potential
substrates for recombination. Both conjugative transposition and
plasmid-directed insertional mutagenesis have the drawback of insertion
instability and potential polar effects of the integron on neighboring
genes. This is an especially problematic issue in assessing the
contribution of Sic to host-pathogen interactions because the gene is
located in the Mga regulon containing proven virulence genes.
Therefore, we developed a new strategy that used a nonpolar spc
cassette to inactivate the sic gene. Analogous
aph-3 and cat cassettes have been used
successfully to generate nonpolar mutants in Shigella flexneri (20) and in E. coli (17)
and Pasteurella haemolytica (7), respectively.
Two important features of our nonpolar spc cassette are shown in this
study: (i) it restores the expression of a downstream gene, and (ii)
since it is promoterless, it does not alter the level of transcription
of a downstream gene. In our study, we showed that insertion of the spc
cassette within sic did not alter the transcriptional
pattern of genes in the Mga regulon. Specifically, the isogenic mutant
did not express a sic transcript, and transcription of the
flanking emm and scpA genes was not affected.
Hence, the data indicate that this spc cassette can be used to conduct
nonpolar GAS mutagenesis.
Our study showed that inactivation of sic decreased
colonization of the host mucosal surface. Although the molecular
mechanism by which Sic contributes to throat colonization is not yet
known, several possibilities can be envisioned. Akesson et al.
(1) reported that in vitro, Sic binds to the human plasma
components clusterin and histidine-rich glycoprotein and interferes
with formation of the membrane attack complex of complement. It is possible that Sic-mediated impairment of complement function enhances survival of M1 GAS strains in the host. In this regard, we note that Ji
et al. (11-13) reported that inactivation of the gene
(scpA) encoding the peptidase that cleaves complement
protein C5a reduced the capacity of GAS to colonize the throats of
mice following intranasal inoculation. Immunization of mice with
purified streptococcal C5a peptidase also reduced colonization
capacity. It is also possible that Sic exerts other mucosal effects
that create local conditions that enhance colonization. Clearly,
additional studies are required to delineate the exact mechanism of Sic
action at the mucosal surfaces.
The humoral immune response induced in the host to microbial infection
commonly results in clearance of the organism. Many microbes escape
antibody-mediated clearance by positive selection of allelic variants
with altered affinity to host antibodies. Recent results have shown
that GAS strains expressing new Sic variants were selected in mice
following long-term throat colonization (10), but only after
a colonization time sufficient to generate an anti-Sic antibody
response. In the present study we showed that 82% of the persistently
colonized mice raised specific serum IgGs directed against the Sic
protein. Anti-Sic antibodies were also identified in the serum of human
subjects. These two observations suggest that host antibody may select
new Sic variants, an idea postulated in earlier studies (10,
29).
Our results demonstrate that in a mouse model Sic contributes to
colonization of the mucosal surface by serotype M1 GAS. We have also
shown that colonized mice, and humans with no known history of invasive
GAS disease, have anti-Sic antibody, which means that Sic is expressed
in the context of mucosal interaction. The results of epidemiologic
studies in the United States and Finland indicate that colonization of
the human mucosal surface is a critical step in determining the
frequency of occurrence of invasive episodes. For example, Cockerill et
al. (5) studied an outbreak of invasive disease episodes
caused by a clone of serotype M3 GAS and found that the
outbreak-associated strain was the most common organism recovered from
nasopharyngeal carriers in the same locality. Similarly, Muotiala et
al. (21) reported that in Finland between 1988 and 1992, the
proportions of serotype M1 isolates among invasive and pharyngitis
isolates were identical. Taken together, the results of these studies
suggest that expression of a protein capable of enhancing the rate or
efficiency of GAS colonization of the host mucosal surface is likely to
increase the frequency of invasive disease. In this regard, it is
noteworthy that expression of the Sic protein may be restricted to
relatively few clonal lineages of GAS, most notably M1 organisms
(1). We believe it reasonable to hypothesize that the
predominance of M1 strains in human infections and the capability of M1
strains to cause epidemic waves are related in part to Sic-mediated
enhanced colonization. Additional studies are under way to test this idea.
 |
ACKNOWLEDGMENTS |
This work was supported by Public Health Service grant AI-33119
to J.M.M.
We thank J. Scott for supplying plasmid pEU904.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Human Bacterial Pathogenesis, Rocky Mountain Laboratories, National
Institute of Allergy and Infectious Diseases, National Institutes of
Health, 903 South 4th St., Hamilton, MT 59840. Phone: (406) 363-9315. Fax: (406) 363-9427. E-mail: jmusser{at}bcm.tmc.edu.
Editor:
E. I. Tuomanen
 |
REFERENCES |
| 1.
|
Akesson, P.,
A. G. Sjoholm, and L. Bjorck.
1996.
Protein SIC, a novel extracellular protein of Streptococcus pyogenes interfering with complement function.
J. Biol. Chem.
271:1081-1088[Abstract/Free Full Text].
|
| 2.
|
Beall, B.,
R. Facklam,
T. Hoenes, and B. Schwartz.
1997.
Survey of emm-gene sequences and T-antigen types from systemic Streptococcus pyogenes infection isolates collected in San Francisco, California; Atlanta, Georgia; and Connecticut in 1994 and 1995.
J. Clin. Microbiol.
35:1231-1235[Abstract].
|
| 3.
|
Betschel, S. D.,
S. M. Borgia,
N. L. Barg,
D. E. Low, and J. C. S. de Azavedo.
1998.
Reduced virulence of group A streptococcal Tn916 mutants that do not produce streptolysin S.
Infect. Immun.
66:1671-1679[Abstract/Free Full Text].
|
| 4.
|
Chen, C. C., and P. P. Cleary.
1990.
Complete nucleotide sequence of the streptococcal C5a peptidase gene of Streptococcus pyogenes.
J. Biol. Chem.
265:3161-3167[Abstract/Free Full Text].
|
| 5.
|
Cockerill, F. R., III,
K. L. MacDonald,
R. L. Thompson,
F. Roberson,
P. C. Kohner,
J. Besser-Wiek,
J. M. Manahan,
J. M. Musser,
P. M. Schlievert,
J. Talbot,
B. Frankfort,
J. M. Steckelberg,
W. R. Wilson,
M. T. Osterholm, and the Investigation Team.
1997.
An outbreak of invasive group A streptococcal disease associated with high carriage rates of the invasive clone among school-aged children.
JAMA
277:38-43[Abstract].
|
| 6.
|
Diederich, L.,
A. Roth, and W. Messer.
1994.
A versatile plasmid vector system for the regulated expression of genes in Escherichia coli.
BioTechniques
16:916-923[Medline].
|
| 7.
|
Fedorova, N. D., and S. K. Highlander.
1997.
Generation of targeted nonpolar gene insertions and operon fusions in Pasteurella haemolytica and creation of a strain that produces and secretes inactive leukotoxin.
Infect. Immun.
65:2593-2598[Abstract].
|
| 8.
|
Fischetti, V. A.
1989.
Streptococcal M protein: molecular design and biological behavior.
Clin. Microbiol. Rev.
2:285-314[Abstract/Free Full Text].
|
| 9.
|
Harbaugh, M. P.,
A. Podbielski,
S. Hugl, and P. P. Cleary.
1993.
Nucleotide substitutions and small-scale insertion produce size and antigenic variation in group A streptococcal M1 protein.
Mol. Microbiol.
8:981-991[Medline].
|
| 10.
|
Hoe, N. P.,
K. Nakashima,
S. Lukomski,
D. Grigsby,
M. Liu,
P. Kordari,
S.-J. Dou,
X. Pan,
J. Vuopio-Varkila,
S. Salmenlinna,
A. McGeer,
D. E. Low,
B. Schwartz,
A. Schuchat,
S. Naidich,
D. De Lorenzo,
Y.-X. Fu, and J. M. Musser.
1999.
Rapid selection of structural variants of group A Streptococcus complement-inhibiting protein in serotype M1 epidemic waves.
Nat. Med.
5:924-929[CrossRef][Medline].
|
| 11.
|
Ji, Y.,
B. Carlson,
A. Kondagunta, and P. P. Cleary.
1997.
Intranasal immunization with C5a peptidase prevents nasopharyngeal colonization of mice by the group A Streptococcus.
Infect. Immun.
65:2080-2087[Abstract].
|
| 12.
|
Ji, Y.,
L. McLandsborough,
A. Kondagunta, and P. P. Cleary.
1996.
C5a peptidase alters clearance and trafficking of group A streptococci by infected mice.
Infect. Immun.
64:503-510[Abstract].
|
| 13.
|
Ji, Y.,
N. Schnitzler,
E. DeMaster, and P. Cleary.
1998.
Impact of M49, Mrp, Enn, and C5a peptidase proteins on colonization of the mouse oral mucosa by Streptococcus pyogenes.
Infect. Immun.
66:5399-5405[Abstract/Free Full Text].
|
| 14.
|
Kihlberg, B. M.,
J. Cooney,
M. G. Caparon,
A. Olsen, and L. Bjorck.
1995.
Biological properties of a Streptococcus pyogenes mutant generated by Tn916 insertion in mga.
Microb. Pathog.
19:299-315[Medline].
|
| 15.
|
Larsen, J. E. L.,
K. Gerdes,
J. Light, and S. Molin.
1984.
Low-copy-number plasmid-cloning vectors amplifiable by derepression of an inserted foreign promoter.
Gene
28:45-54[CrossRef][Medline].
|
| 16.
|
LeBlanc, D. J.,
L. N. Lee, and J. M. Inamine.
1991.
Cloning and nucleotide base sequence analysis of a spectinomycin adenyltransferase Aad(9) determinant from Enterococcus faecalis.
Antimicrob. Agents Chemother.
35:1804-1810[Abstract/Free Full Text].
|
| 17.
|
Lukomski, S.,
R. A. Hull, and S. I. Hull.
1996.
Identification of the O antigen polymerase (rfc) gene in Escherichia coli O4 by insertional mutagenesis using a nonpolar chloramphenicol resistance cassette.
J. Bacteriol.
178:240-247[Abstract/Free Full Text].
|
| 18.
|
Lukomski, S.,
C. A. Montgomery,
J. Rurangirwa,
R. S. Geske,
J. P. Barrish,
G. J. Adams, and J. M. Musser.
1999.
Extracellular cysteine protease produced by Streptococcus pyogenes participates in the pathogenesis of invasive skin infection and dissemination in mice.
Infect. Immun.
67:1779-1788[Abstract/Free Full Text].
|
| 19.
|
Martin, D. R., and L. A. Single.
1993.
Molecular epidemiology of group A streptococcus M type 1 infections.
J. Infect. Dis.
167:1112-1117[Medline].
|
| 20.
|
Menard, R.,
P. J. Sansonetti, and C. Parsot.
1993.
Nonpolar mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri entry into epithelial cells.
J. Bacteriol.
174:5899-5906.
|
| 21.
|
Muotiala, A.,
H. Seppala,
P. Huovinen, and J. Vuopio-Varkila.
1997.
Molecular comparison of group A streptococci of T1M1 serotype from invasive and noninvasive infections in Finland.
J. Infect. Dis.
175:392-399[Medline].
|
| 22.
|
Musser, J. M.,
V. Kapur,
J. Szeto,
X. Pan,
D. S. Swanson, and D. R. Martin.
1995.
Genetic diversity and relationships among Streptococcus pyogenes strains expressing serotype M1 protein: recent intercontinental spread of a subclone causing episodes of invasive disease.
Infect. Immun.
63:994-1003[Abstract].
|
| 23.
|
Musser, J. M., and R. M. Krause.
1998.
The revival of group A streptococcal diseases with a commentary on staphylococcal toxic shock syndrome, p. 185-218.
In
R. M. Krause, and A. Fauci (ed.), Emerging infections. Academic Press, San Diego, Calif.
|
| 24.
|
Norgren, M.,
M. G. Caparon, and J. R. Scott.
1989.
A method for allelic replacement that uses the conjugative transposon Tn916: deletion of the emm6.1 allele in Streptococcus pyogenes JRS4.
Infect. Immun.
57:3846-3850[Abstract/Free Full Text].
|
| 25.
|
Perez-Casal, J. F.,
H. F. Dillon,
L. K. Husmann,
B. Graham, and J. R. Scott.
1993.
Virulence of two Streptococcus pyogenes strains (types M1 and M3) associated with toxic-shock-like syndrome depends on an intact mry-like gene.
Infect. Immun.
61:5426-5430[Abstract/Free Full Text].
|
| 26.
|
Podbielski, A.,
B. Pohl,
M. Woischnik,
C. Korner,
K. H. Schmidt,
E. Rozdzinski, and B. A. B. Leonard.
1996.
Molecular characterization of the group A streptococcal (GAS) oligopeptide permease (Opp) and its effect on cysteine protease production.
Mol. Microbiol.
21:1087-1099[CrossRef][Medline].
|
| 27.
|
Podbielski, A.,
B. Spellerberg,
M. Woischnik,
B. Pohl, and R. Lutticken.
1996.
Novel series of plasmid vectors for gene inactivation and expression analysis in group A streptococci (GAS).
Gene
177:137-147[CrossRef][Medline].
|
| 28.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 29.
|
Stockbauer, K. E.,
D. Grigsby,
X. Pan,
Y.-X. Fu,
L. M. Perea Mejia,
A. Cravioto, and J. M. Musser.
1998.
Hypervariability generated by natural selection in an extracellular complement-inhibiting protein of serotype M1 strains of group A Streptococcus.
Proc. Natl. Acad. Sci. USA
95:3128-3133[Abstract/Free Full Text].
|
| 30.
|
Tao, L.,
S. K. Hollingshead,
A. N. Suvorov,
J. J. Ferretti, and W. M. McShan.
1995.
Construction of a Streptococcus pyogenes recA mutant via insertional inactivation, and cloning and sequencing of the complete recA gene.
Gene
162:59-62[CrossRef][Medline].
|
| 31.
|
Tao, L.,
D. J. LeBlanc, and J. J. Ferretti.
1992.
Novel streptococcal-integration shuttle vectors for gene cloning and inactivation.
Gene
120:105-110[CrossRef][Medline].
|
| 32.
|
Wessels, M. R.,
A. E. Moses,
J. B. Goldberg, and T. J. DiCesare.
1991.
Hyaluronic acid capsule is a virulence factor for mucoid group A streptococci.
Proc. Natl. Acad. Sci. USA
88:8317-8321[Abstract/Free Full Text].
|
Infection and Immunity, February 2000, p. 535-542, Vol. 68, No. 2
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kinkel, T. L., McIver, K. S.
(2008). CcpA-Mediated Repression of Streptolysin S Expression and Virulence in the Group A Streptococcus. Infect. Immun.
76: 3451-3463
[Abstract]
[Full Text]
-
Pearson, M. M., Hansen, E. J.
(2007). Identification of Gene Products Involved in Biofilm Production by Moraxella catarrhalis ETSU-9 In Vitro. Infect. Immun.
75: 4316-4325
[Abstract]
[Full Text]
-
Shelburne, S. A. III, Okorafor, N., Sitkiewicz, I., Sumby, P., Keith, D., Patel, P., Austin, C., Graviss, E. A., Musser, J. M.
(2007). Regulation of Polysaccharide Utilization Contributes to the Persistence of Group A Streptococcus in the Oropharynx. Infect. Immun.
75: 2981-2990
[Abstract]
[Full Text]
-
Gusa, A. A., Froehlich, B. J., Desai, D., Stringer, V., Scott, J. R.
(2007). CovR Activation of the Dipeptide Permease Promoter (PdppA) in Group A Streptococcus. J. Bacteriol.
189: 1407-1416
[Abstract]
[Full Text]
-
Sawai, J., Hasegawa, T., Kamimura, T., Okamoto, A., Ohmori, D., Nosaka, N., Yamada, K., Torii, K., Ohta, M.
(2007). Growth Phase-Dependent Effect of Clindamycin on Production of Exoproteins by Streptococcus pyogenes. Antimicrob. Agents Chemother.
51: 461-467
[Abstract]
[Full Text]
-
Graham, M. R., Virtaneva, K., Porcella, S. F., Gardner, D. J., Long, R. D., Welty, D. M., Barry, W. T., Johnson, C. A., Parkins, L. D., Wright, F. A., Musser, J. M.
(2006). Analysis of the Transcriptome of Group A Streptococcus in Mouse Soft Tissue Infection. Am. J. Pathol.
169: 927-942
[Abstract]
[Full Text]
-
Shelburne, S. A. III, Sumby, P., Sitkiewicz, I., Okorafor, N., Granville, C., Patel, P., Voyich, J., Hull, R., DeLeo, F. R., Musser, J. M.
(2006). Maltodextrin utilization plays a key role in the ability of group a streptococcus to colonize the oropharynx.. Infect. Immun.
74: 4605-4614
[Abstract]
[Full Text]
-
Sitkiewicz, I., Musser, J. M.
(2006). Expression Microarray and Mouse Virulence Analysis of Four Conserved Two-Component Gene Regulatory Systems in Group A Streptococcus. Infect. Immun.
74: 1339-1351
[Abstract]
[Full Text]
-
Shelburne, S. A. III, Sumby, P., Sitkiewicz, I., Granville, C., DeLeo, F. R., Musser, J. M.
(2005). Central role of a bacterial two-component gene regulatory system of previously unknown function in pathogen persistence in human saliva. Proc. Natl. Acad. Sci. USA
102: 16037-16042
[Abstract]
[Full Text]
-
Shelburne, S. A. III, Granville, C., Tokuyama, M., Sitkiewicz, I., Patel, P., Musser, J. M.
(2005). Growth Characteristics of and Virulence Factor Production by Group A Streptococcus during Cultivation in Human Saliva. Infect. Immun.
73: 4723-4731
[Abstract]
[Full Text]
-
Binks, M. J., Fernie-King, B. A., Seilly, D. J., Lachmann, P. J., Sriprakash, K. S.
(2005). Attribution of the Various Inhibitory Actions of the Streptococcal Inhibitor of Complement (SIC) to Regions within the Molecule. J. Biol. Chem.
280: 20120-20125
[Abstract]
[Full Text]
-
Aziz, R. K., Edwards, R. A., Taylor, W. W., Low, D. E., McGeer, A., Kotb, M.
(2005). Mosaic Prophages with Horizontally Acquired Genes Account for the Emergence and Diversification of the Globally Disseminated M1T1 Clone of Streptococcus pyogenes. J. Bacteriol.
187: 3311-3318
[Abstract]
[Full Text]
-
Nagiec, M. J., Lei, B., Parker, S. K., Vasil, M. L., Matsumoto, M., Ireland, R. M., Beres, S. B., Hoe, N. P., Musser, J. M.
(2004). Analysis of a Novel Prophage-encoded Group A Streptococcus Extracellular Phospholipase A2. J. Biol. Chem.
279: 45909-45918
[Abstract]
[Full Text]
-
Reid, S. D., Montgomery, A. G., Musser, J. M.
(2004). Identification of srv, a PrfA-Like Regulator of Group A Streptococcus That Influences Virulence. Infect. Immun.
72: 1799-1803
[Abstract]
[Full Text]
-
Reid, S. D., Montgomery, A. G., Voyich, J. M., DeLeo, F. R., Lei, B., Ireland, R. M., Green, N. M., Liu, M., Lukomski, S., Musser, J. M.
(2003). Characterization of an Extracellular Virulence Factor Made by Group A Streptococcus with Homology to the Listeria monocytogenes Internalin Family of Proteins. Infect. Immun.
71: 7043-7052
[Abstract]
[Full Text]
-
Biswas, I., Scott, J. R.
(2003). Identification of rocA, a Positive Regulator of covR Expression in the Group A Streptococcus. J. Bacteriol.
185: 3081-3090
[Abstract]
[Full Text]
-
Frick, I.-M., Akesson, P., Rasmussen, M., Schmidtchen, A., Bjorck, L.
(2003). SIC, a Secreted Protein of Streptococcus pyogenes That Inactivates Antibacterial Peptides. J. Biol. Chem.
278: 16561-16566
[Abstract]
[Full Text]
-
Brandt, C. M., Haase, G., Spellerberg, B., Holland, R., Lutticken, R.
(2003). drs (Distantly Related sic) Gene Polymorphisms among emm12-Type Streptococcus pyogenes Isolates. J. Clin. Microbiol.
41: 1794-1797
[Abstract]
[Full Text]
-
Lei, B., DeLeo, F. R., Reid, S. D., Voyich, J. M., Magoun, L., Liu, M., Braughton, K. R., Ricklefs, S., Hoe, N. P., Cole, R. L., Leong, J. M., Musser, J. M.
(2002). Opsonophagocytosis-Inhibiting Mac Protein of Group A Streptococcus: Identification and Characteristics of Two Genetic Complexes. Infect. Immun.
70: 6880-6890
[Abstract]
[Full Text]
-
Fernie-King, B, Seilly, D J, Davies, A, Lachmann, P J
(2002). Subversion of the innate immune response by micro-organisms. Ann Rheum Dis
61: ii8-12
[Full Text]
-
Fernie-King, B. A., Seilly, D. J., Davies, A., Lachmann, P. J.
(2002). Streptococcal Inhibitor of Complement Inhibits Two Additional Components of the Mucosal Innate Immune System: Secretory Leukocyte Proteinase Inhibitor and Lysozyme. Infect. Immun.
70: 4908-4916
[Abstract]
[Full Text]
-
Lei, B., Smoot, L. M., Menning, H. M., Voyich, J. M., Kala, S. V., Deleo, F. R., Reid, S. D., Musser, J. M.
(2002). Identification and Characterization of a Novel Heme-Associated Cell Surface Protein Made by Streptococcus pyogenes. Infect. Immun.
70: 4494-4500
[Abstract]
[Full Text]
-
Hoe, N. P., Ireland, R. M., DeLeo, F. R., Gowen, B. B., Dorward, D. W., Voyich, J. M., Liu, M., Burns, E. H. Jr., Culnan, D. M., Bretscher, A., Musser, J. M.
(2002). Insight into the molecular basis of pathogen abundance: Group A Streptococcus inhibitor of complement inhibits bacterial adherence and internalization into human cells. Proc. Natl. Acad. Sci. USA
99: 7646-7651
[Abstract]
[Full Text]
-
Kreikemeyer, B., Beckert, S., Braun-Kiewnick, A., Podbielski, A.
(2002). Group A streptococcal RofA-type global regulators exhibit a strain-specific genomic presence and regulation pattern. Microbiology
148: 1501-1511
[Abstract]
[Full Text]
-
Lukomski, S., Nakashima, K., Abdi, I., Cipriano, V. J., Shelvin, B. J., Graviss, E. A., Musser, J. M.
(2001). Identification and Characterization of a Second Extracellular Collagen-Like Protein Made by Group A Streptococcus: Control of Production at the Level of Translation. Infect. Immun.
69: 1729-1738
[Abstract]
[Full Text]
-
Chaussee, M. S., Watson, R. O., Smoot, J. C., Musser, J. M.
(2001). Identification of Rgg-Regulated Exoproteins of Streptococcus pyogenes. Infect. Immun.
69: 822-831
[Abstract]
[Full Text]
-
Lukomski, S., Nakashima, K., Abdi, I., Cipriano, V. J., Ireland, R. M., Reid, S. D., Adams, G. G., Musser, J. M.
(2000). Identification and Characterization of the scl Gene Encoding a Group A Streptococcus Extracellular Protein Virulence Factor with Similarity to Human Collagen. Infect. Immun.
68: 6542-6553
[Abstract]
[Full Text]
-
Lei, B., Mackie, S., Lukomski, S., Musser, J. M.
(2000). Identification and Immunogenicity of Group A Streptococcus Culture Supernatant Proteins. Infect. Immun.
68: 6807-6818
[Abstract]
[Full Text]