INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Group A Streptococcus (GAS) is a gram-positive bacterial pathogen that causes human disease globally. The organism is responsible for many diverse infection types, including pharyngitis, acute rheumatic fever, and invasive diseases such as bacteremia and necrotizing fasciitis. A resurgence of invasive disease episodes in recent years has been documented in many countries, including those in North America, Europe, and the Far East (reviewed in reference 23). Extensive epidemiological studies have found that in most localities, strains expressing serotype M1 protein predominate (23). The M protein is a highly polymorphic surface protein that is an important virulence factor of GAS, in part because it is antiphagocytic (8). More than 80 M protein types have been recognized on the basis of serologic studies conducted over decades and more recently DNA sequencing investigations (2). The molecular explanation for the abundant representation of serotype M1 strains among invasive isolates is unknown.

Molecular characterization of serotype M1 strains cultured from patients with invasive infections has shown that in general, there is relatively restricted genetic diversity among most strains (22, 23). For example, analysis of variation in 10 genes in large samples of M1 GAS from several countries failed to identify sequence diversity in virtually all genes studied (22, 23). Although most M1 strains are closely related in overall genomic character, recently it has been shown that a protein that inhibits the normal cytolytic effect of the C5b-C9 membrane attack complex of human complement is remarkably hypervariable (1, 10, 29). This protein, known as the streptococcal inhibitor of complement (Sic), is encoded by the sic gene that is located in the Mga virulence regulon of GAS (1, 14). Initial DNA sequence analysis of sic variation among 165 M1 strains identified 62 alleles, virtually all of which would encode distinct protein variants (29). The observation that most gene alleles would encode distinct protein variants, together with a lack of synonymous (silent, not resulting in amino acid replacements) nucleotide substitutions strongly suggested that the Sic protein is under strong natural selection pressure. This idea is supported by the preponderance of radical amino acid replacements (polar-nonpolar replacements or those resulting in charge changes) found among the Sic variants (10, 29).

Serotype M1 strains also have the ability to undergo rapid changes in disease frequency and severity (19, 21, 23). Epidemic waves of serotype M1 strains have been documented in several countries (23). Although the exact molecular explanation for the ability of M1 strains to cause epidemic waves is unknown, recent analysis of the molecular population genetics of epidemic waves of serotype M1 organisms in Finland; Ontario, Canada; and four regions in the United States found that in contrast to the prevailing idea that these epidemic waves are mono- or pauciclonal, they are composed of M1 strains with a highly diverse array of Sic variants that are rapidly selected in the course of the epidemic waves (10). Study of M1 strains from humans with pharyngitis and analysis of organisms recovered from the nasopharynx of persistently colonized mice discovered that new Sic variants are selected on the mucosal surface.

Taken together, the data suggest that Sic participates in host-pathogen interaction on the mucosal surface. To directly test this idea, we constructed an M1 isogenic mutant strain in which the sic gene was inactivated by a new nonpolar mutagenesis strategy. The nonpolar mutagenesis approach was necessary because the sic gene is located in the Mga regulon and hence is located close to genes encoding important GAS virulence factors, including emm and scpA, encoding M1 protein and a protease that cleaves and inactivates complement factor C5a, respectively. The isogenic mutant strain had significantly decreased ability to colonize the nasopharynx of mice. We hypothesize that the predominance of M1 strains in human infections is related, in part, to a Sic-mediated enhanced colonization ability.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains and plasmids. The bacterial strains and plasmids used in this study are described in Table 1. GAS strain MGAS 1600 was used for cloning the sic1.07 allele, which contains a naturally occurring TC mutation located in the 10 region of the presumed sic promoter. This mutation is associated with decreased Sic expression by the source strain. The strain (MGAS 5005) used to generate the isogenic Sic-deficient mutant contains the most frequently identified sic allele (sic1.01) and produces abundant levels of secreted Sic protein in vitro. This strain also has the emm1.0 gene allele and genes encoding SpeA and SpeC exotoxins.

Construction of nonpolar spc cassettes. A nonpolar spectinomycin resistance (spc) cassette was developed to inactivate the sic gene (Fig. 1A). The cassette contains the promoterless spectinomycin resistance marker encoded by the aad gene (16). The 5' region of the cassette upstream of the aad gene has stop codons in all three reading frames. A consensus ribosome-binding site (GGAGG) followed by the ATG start codon is located at the 3' end. To avoid a polarity effect on downstream genes, the spc cassette is cloned so that the ATG start codon is in frame with the downstream mutated gene, in this case sic. Construction of the three cassettes allows one of them to be used at any restriction site available in the target gene. This strategy was based on similar aph-3 (20) and cat (chloramphenicol resistance) (17) cassettes used successfully for nonpolar gene inactivation in gram-negative bacteria.

View larger version (18K): [in this window] [in a new window]   FIG. 1.   Construction and testing of the spc cassettes. (A) Schematic representation of the promoterless spc cassettes. spc1- to 3 cassettes are flanked by SmaI sites and contain the aad gene conferring resistance to spectinomycin. The promoterless aad gene was amplified with its original ribosome-binding site (RBS). At the 5' synthetic end, upstream of the aad gene, there are stop codons in all three reading frames (underlined). At the 3' synthetic end, downstream of the aad gene, the spc1- to 3 cassettes contain the GGAGG consensus ribosome-binding sites and the ATG start codons in all three reading frames. (B) Construction of the suicide plasmid pSL114 containing sic1.07. pSL114 has a temperature-sensitive origin of replication (oriR1) which maintains low copy number at 30°C. It carries the cat gene. (C) Construction of the polar and nonpolar mutations within sic1.07. The first eight amino acids of the Sic signal peptide are shown. The SspI cleaves in frame after the sixth base pair of the wild-type sic sequence. The spc1 and spc2 cassettes were cloned at the SspI site of pSL114, resulting in plasmids pSL128-1 and 128-2, respectively. After passing the TAA stop codon (boxed) of the aad gene, translation is restored at the ATG start codon located at the 3' end of the cassettes. An insertion of the spc1 cassette is in frame and results in a single amino acid NP (underlined) substitution within the Sic signal peptide. An out-of-frame insertion of the spc2 cassette generates multiple translational stop codons (asterisks).

spc cassettes are nonpolar in GAS: proof of principle. To test the utility of the nonpolar mutagenesis strategy, two sic mutants were generated with the spc1 and spc2 cassettes by allelic replacement in the chromosome of GAS. Initial data indicated that sic cloned into E. coli was unstable, perhaps due to a toxic effect of the Sic protein. Hence, a strain (MGAS 1600) with a mutation in the 10 region of the presumed sic promoter that is associated with decreased Sic production by the parental GAS strain was used as the source organism for the cloned sic allele (sic1.07). The strategy for the cloning of the sic1.07 gene and insertion of the spc1 and spc2 cassettes is shown in Fig. 1B and C. The sic1.07 allele was amplified with sic-specific primers (sic1 [TAAGGAGAGGTCACAAACTA] and sic2 [TTACGTTGCTGATGGTGTAT]) and cloned in a promoterless low-copy-number plasmid vector pSL97 (Table 1). This vector was based on plasmid pLEX5B (6), in which the ColE1 origin of replication (ori) was replaced with a temperature-sensitive oriR1 which allows the plasmid to be maintained at low copy number (15). Next, the -lactamase gene was replaced with the cat gene from pFW14 (27), resulting in plasmid pSL114; plasmid pSL114 cannot replicate in GAS. This cloned sic1.07 allele was then interrupted by insertion of the spc1 and spc2 cassettes after the sixth base pair of the sic coding sequence (Fig. 1C). The spc1 cassette was inserted in frame with the downstream sic region (pSL128-1), whereas the spc2 cassette insertion (pSL128-2) was out of frame. These two constructs were used to generate the sic mutants of MGAS 1600 by allelic replacement (Fig. 2A).

View larger version (46K): [in this window] [in a new window]   FIG. 2.   Nonpolar mutagenesis of the sic gene by using the spc cassette. (A) Southern blot analysis of the genomic DNAs isolated from the MGAS 1600 (sic1.07) wild-type strain and from MGAS 1600 sic1 (sic::spc1, in-frame insertion) and MGAS 1600 sic2 (sic::spc2, out-of-frame insertion) mutants. DNAs were digested with BanII, which has a single recognition site within the aad gene of the spc cassettes but not in the sic sequence. Only one mutated sic copy can be detected in the mutant strains by using the sic-specific probe homologous to the 3' end of the sic gene. As expected, the spc probe hybridized only to the DNA of the mutants. (B) Immunoblot detection of the Sic protein in GAS culture supernatants. Sic1.07 was produced by the MGAS 1600 wild-type strain and by the in-frame sic::spc1 mutant. No Sic could be detected in the culture supernatant of the sic::spc2 out-of-frame mutant. The identically processed culture supernatant of a GAS serotype M3 strain lacking the sic gene is shown as a negative control.

Construction of the sic-inactivated isogenic mutant strain. An analogous strategy was used to generate a nonpolar sic1.01 knockout isogenic strain of MGAS 5005. We selected the sic1.01 allele for inactivation because this is the most common sic allele found in clinical isolates of GAS serotype M1. For example, the sic1.01 allele was found in 36% of M1 GAS isolates recovered in Finland from 1988 to 1998 (10). Suicide plasmid pSL127 was constructed (detailed cloning strategy is shown in Fig. 3) such that an internal part of the sic gene (bp 6 to 811) was replaced with the spc2 cassette (in-frame insertion). This construct was introduced by electroporation into the wild-type MGAS 5005 organism to obtain a nonpolar isogenic sic-inactivated mutant derivative. After initial screening, the MGAS 5005 sic strain was analyzed by PCR, Southern and Western blotting, and sequencing.

View larger version (22K): [in this window] [in a new window]   FIG. 3.   Construction of the suicide plasmid pSL127, used to generate an sic1.01-inactivated MGAS 5005. All primers and restriction sites used in the cloning strategy are shown. (A) Schematic representation of the Mga regulon with the sic gene in MGAS 5005 (not to scale). The map was drawn based on PCR analyses using different combinations of primers specific for the emm1.0, sic1.01, IS1562, and scpA genes. (B) DNA region containing the sic gene and part of the IS1562 used in plasmid construction. Major parts of the sic sequence are shown: Ss, signal sequence; SRR, short repeat region; R1 to R3, repeat regions 1 to 3; PRR, proline-rich region. Two chromosomal fragments from MGAS 5005 were amplified. Fragment 1 (~150 bp), flanked by the PCR-generated XhoI (sicXho [TCGACTCGAGGTTAAGGAGAGGTCAC]) and HindIII (sicHind [TTTTCAAGCTTATTTCTAATATTC]) sites, contained the sic promoter region and first 26 bp of the coding region. Fragment 2 (~830 bp), obtained by restriction digestion of the PCR product (sicATG [GGAGAGAATACTAATGAATATTAG] and scpA2 [CTGGTGTATCAGCAGTTTTAGC]) with restriction enzymes BsaBI and SphI, contained a 3' end of the sic proline-rich region and adjusted part of IS1562. (C) First, fragment 2 was cloned into multiple cloning site (MCS) II of the E. coli vector pFW12, generating plasmid pSL123. Next, fragment 1 was cloned into MCS I of the pSL123, resulting in construct pSL124. (D) In the last step, the nonpolar spc2 cassette was cloned in frame between the SspI and PvuII sites of the sic coding sequence, replacing the original spectinomycin resistance marker (SpR) of the vector. In this plasmid, designated pSL127, the spc2 insertion limits the amount of the sic coding region to 6 bp (2 amino acids) at the 5' end and 129 bp (43 residues) at the 3' end. Suicide plasmid pSL127 was used to generate an sic-inactivated isogenic variant of MGAS 5005.

DNA methods. Standard methods (28) were used to manipulate DNA. Plasmid DNA was prepared with a QIAGEN-tip (Qiagen, Valencia, Calif.). Chromosomal DNA was isolated from GAS as described previously (22); 5 to 6 µg was used for Southern blotting. Hybridization was performed with a nonradioactive labeling and detection system (ECL [enhanced chemiluminescence]; Amersham Pharmacia Biotech, Inc., Piscataway, N.J.). DNA amplification was performed with Taq polymerase (Perkin-Elmer). When PCR was performed directly from E. coli or GAS colonies, cells were transferred to the reaction mixture on a disposable tip. The Taq DyeDeoxy terminator cycle sequencing kit (Applied Biosystems, Inc., Foster City, Calif.) and an ABI 377 instrument were used to obtain DNA sequence data.

RNA methods. Total RNA was prepared from GAS cultures (10 ml) grown in THY medium to mid-log phase (optical density at 600 nm [OD₆₀₀] of ~0.4). Cell pellets were suspended in 500 µl of TE buffer (10 mM Tris [pH 7.0], 1 mM EDTA) and treated at 37°C for 5 min with 6 µl of mutanolysin (1 mg/ml), 60 µl of lysozyme (10 mg/ml), and 25 µl of the RNase inhibitor aurintricarboxylic acid (100 mM stock solution; Sigma, St. Louis, Mo.). GAS cells were lysed with 60 µl of 20% sodium dodecyl sulfate and 600 µl of acid-phenol-chloroform (5:1 mix, pH 4.5; Ambion, Austin, Tex.) at 65°C for 5 min. Samples were extracted with equal volumes of acid-phenol-chloroform until no debris was seen at the interface. The RNA contained in 400 µl was mixed with 15 µl of 5 M NaCl and precipitated with 2 volumes of ethanol. DNA was removed by DNase I digestion followed by an acid-phenol-chloroform extraction. The RNA was precipitated as described above. Usually, 250 to 300 µg of total RNA was obtained from a 10-ml culture by this method. The RNA showed good sample integrity when analyzed in an agarose gel.

Protein methods. Sic expression was assayed in the culture supernatants of GAS grown to exponential phase (OD₆₀₀ of ~0.5) in THY medium. Proteins were precipitated with 30% ammonium sulfate and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by staining with Coomassie brilliant blue or by Western blotting with rabbit polyclonal serum raised against purified Sic1.01 (10). An ECL visualization protocol was used.

Measurement of anti-Sic immunoglobulin G (IgG) in mouse and human sera. Mouse sera were obtained on day 24 from the blood of 34 animals that survived 21 days after intranasal inoculation with the MGAS 5005 wild-type strain. Eleven mice were persistently colonized in the throat with GAS, and 23 were not. Serum samples from 15 of the mice that were not colonized on day 24 and all 11 samples from persistently colonized mice were assayed. Human sera from 198 healthy individuals with no history of invasive GAS disease were used for the analysis.

Mouse colonization experiments. Isogenic GAS wild-type and sic mutant strains were grown in THY medium and harvested in the logarithmic phase (OD₆₀₀ of ~0.5 to 0.6), when abundant Sic production occurs. The cells were washed once and resuspended in sterile ice-cold, pyrogen-free PBS to give the required inoculum. Colony counts were performed to determine the actual number of CFU used in each experiment. Control animals inoculated with PBS were always culture negative for GAS. The animals were anesthetized by inhalation of Metofane (Mallinckrodt Veterinary, Mundelein, Ill.) prior to experimental procedures.

Statistical analysis. Fisher's exact two-tailed test was used to assess statistical differences in mouse mortality and throat colonization between the animal groups infected with the wild-type GAS or the isogenic sic mutant strain. A logistic regression model was used to compare mouse throat colonization by the wild-type and mutant strains. Statistical calculations were performed with SAS software (SAS Institute Inc., Cary, N.C.).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Anti-Sic immune response in mice and humans. Recent investigation discovered that in contrast to other genes analyzed (including emm1, encoding M1 protein), the sic gene and Sic protein are highly variable among serotype M1 GAS recovered in epidemic waves in all geographic localities studied (10). In addition, Sic structural variants were selected after intranasal inoculation of mice but not during in vitro cultivation (10, 29). These observations imply that Sic is made in vivo, but this aspect of GAS pathogenesis has not been studied. If Sic is made in vivo, we expected that infected mammalian hosts would make antibody against this protein. To test this issue, we first analyzed the anti-Sic serum antibody response in mice inoculated intranasally with wild-type MGAS 5005. Nine of 11 animals (82%) persistently colonized in the throat on day 24 after intranasal inoculation had specific anti-Sic1.01 IgG antibodies as assessed by enzyme-linked immunosorbent assay (ELISA) (Fig. 4). In contrast, animals that were not persistently colonized after intranasal inoculation lacked anti-Sic serum antibodies.

View larger version (14K): [in this window] [in a new window]   FIG. 4.   Graph of anti-Sic1.01 IgG titers in serum from mice persistently colonized in the throat with MGAS 5005. Serum samples were obtained on day 24 postinfection and tested in an ELISA against purified Sic1.01 at a starting dilution of 1:20. Titers were calculated with SOFTmax PRO software version 2.6.1.

Construction and characterization of the Sic1.01-negative nonpolar isogenic mutant. The presence of anti-Sic antibody in experimental mice and humans indicated that Sic was expressed during mucosal infection. In addition, interaction with the host mucosal surface has been shown to result in a high frequency of selection of new Sic variants (10). Inasmuch as both seroconversion to Sic and selection of Sic variants have been observed in mice and humans, we investigated if Sic participates in mouse throat colonization. A nonpolar sic- inactivated isogenic mutant strain was constructed to test this idea.

View larger version (93K): [in this window] [in a new window]   FIG. 5.   Northern blot analysis of emm, sic, and scpA gene expression by wild-type strain MGAS 5005 (5005 wt) and by the isogenic 5005 sic mutant. No sic transcript could be detected in the mutant strain. In addition, transcription of the emm and scpA genes was unaffected. Biotinylated DNA probes were used for hybridization. The biotinylated molecular weight RNA marker was used to evaluate transcript sizes.

sic inactivation decreases mouse throat colonization. To test the hypothesis that inactivation of sic altered mouse throat colonization, we used a logistic regression analysis to compare colonization by the wild-type GAS serotype M1 and the isogenic sic-inactivated mutant (Fig. 6). Five dilutions (twofold dilutions ranging from ~8 × 10⁷ to 0.5 × 10⁷ CFU) of the wild-type and mutant strains were used to inoculate groups of 10 mice intranasally. Mouse throats were swabbed periodically, and the bacteria were cultured on a blood agar. In addition, blood samples from dead animals were cultured. There was no significant difference in the number of dead mice or Kaplan-Meier survival curves on day 21 after infection with the wild-type (16 of 50 mice on day 21) or mutant (14 of 50 mice) strain. In contrast, we observed a significant difference in colonization of the mouse mucosa. Significantly more mice inoculated with the wild-type GAS strain were culture positive than mice infected with the sic mutant strain (P < 0.019) (Fig. 5). The results of a logistic regression model using GAS colonization data obtained from only the mice which survived were also significantly different (P = 0.023), as observed with the data obtained from the model which included dead mice (analysis described above). The odds ratio for the wild-type strain was 2.81, which indicated that the MGAS 5005 parental organism had a much higher incidence of throat colonization. However, the level of inoculum was not significant, indicating that the incidence of throat colonization was not related to the amount of inoculum given to the mice. Therefore, experiments with animals infected with all five inocula of the wild-type strain or the sic mutant were combined. A significant group difference was found (P < 0.035; Fisher's exact two-tailed test). We note that the difference in colonization by the wild-type and mutant strains was statistically significant during the first 4 days postinoculation. These results suggested that Sic plays a significant role at the early stages of infection. Because the large number of the mice died during the study period, the number of surviving animals in each experimental group was not adequate for statistical comparison. Taken together, our results indicate that Sic participated in GAS-host interactions by enhancing early colonization of the mucosal surfaces.

View larger version (14K): [in this window] [in a new window]   FIG. 6.   Logistic regression analysis of death and throat colonization at 72 h after intranasal inoculation with the 5005 wild-type strain (open circles) or with the 5005 sic mutant (solid circles). Each data point represents 10 mice. The y axis represents estimated percent culture-positive animals. The data fit the model (P = 0.021); the group difference was significant (P < 0.019); the dose-dependent parameter was not significant.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

GAS causes epidemic waves of pharyngitis and severe invasive infections worldwide (23). GAS strains of serotype M1 have been predominantly responsible for countrywide epidemics for reasons that are not known. The observations that the Sic protein was hypervariable in serotype M1 strains recovered from epidemic waves and that new structural Sic variants were selected on mucosal surfaces in the course of epidemic waves suggested that Sic could contribute to host colonization (10).

We constructed a sic-inactivated nonpolar isogenic mutant strain to directly assess the contribution of Sic to mucosal colonization of a mammalian host. Construction of gene-inactivated GAS isogenic strains has mainly used the conjugative transposon Tn916 (3, 24, 32) or plasmid-directed insertional mutagenesis (25, 26, 31). Despite many successful applications, both methods have several disadvantages, including uncontrolled chromosomal insertions resulting in the need for laborious screening, presence of foreign vector sequences in the GAS genome, or existence of two copies of the mutated gene, thereby creating potential substrates for recombination. Both conjugative transposition and plasmid-directed insertional mutagenesis have the drawback of insertion instability and potential polar effects of the integron on neighboring genes. This is an especially problematic issue in assessing the contribution of Sic to host-pathogen interactions because the gene is located in the Mga regulon containing proven virulence genes. Therefore, we developed a new strategy that used a nonpolar spc cassette to inactivate the sic gene. Analogous aph-3 and cat cassettes have been used successfully to generate nonpolar mutants in Shigella flexneri (20) and in E. coli (17) and Pasteurella haemolytica (7), respectively. Two important features of our nonpolar spc cassette are shown in this study: (i) it restores the expression of a downstream gene, and (ii) since it is promoterless, it does not alter the level of transcription of a downstream gene. In our study, we showed that insertion of the spc cassette within sic did not alter the transcriptional pattern of genes in the Mga regulon. Specifically, the isogenic mutant did not express a sic transcript, and transcription of the flanking emm and scpA genes was not affected. Hence, the data indicate that this spc cassette can be used to conduct nonpolar GAS mutagenesis.

Our study showed that inactivation of sic decreased colonization of the host mucosal surface. Although the molecular mechanism by which Sic contributes to throat colonization is not yet known, several possibilities can be envisioned. Akesson et al. (1) reported that in vitro, Sic binds to the human plasma components clusterin and histidine-rich glycoprotein and interferes with formation of the membrane attack complex of complement. It is possible that Sic-mediated impairment of complement function enhances survival of M1 GAS strains in the host. In this regard, we note that Ji et al. (11-13) reported that inactivation of the gene (scpA) encoding the peptidase that cleaves complement protein C5a reduced the capacity of GAS to colonize the throats of mice following intranasal inoculation. Immunization of mice with purified streptococcal C5a peptidase also reduced colonization capacity. It is also possible that Sic exerts other mucosal effects that create local conditions that enhance colonization. Clearly, additional studies are required to delineate the exact mechanism of Sic action at the mucosal surfaces.

The humoral immune response induced in the host to microbial infection commonly results in clearance of the organism. Many microbes escape antibody-mediated clearance by positive selection of allelic variants with altered affinity to host antibodies. Recent results have shown that GAS strains expressing new Sic variants were selected in mice following long-term throat colonization (10), but only after a colonization time sufficient to generate an anti-Sic antibody response. In the present study we showed that 82% of the persistently colonized mice raised specific serum IgGs directed against the Sic protein. Anti-Sic antibodies were also identified in the serum of human subjects. These two observations suggest that host antibody may select new Sic variants, an idea postulated in earlier studies (10, 29).

Our results demonstrate that in a mouse model Sic contributes to colonization of the mucosal surface by serotype M1 GAS. We have also shown that colonized mice, and humans with no known history of invasive GAS disease, have anti-Sic antibody, which means that Sic is expressed in the context of mucosal interaction. The results of epidemiologic studies in the United States and Finland indicate that colonization of the human mucosal surface is a critical step in determining the frequency of occurrence of invasive episodes. For example, Cockerill et al. (5) studied an outbreak of invasive disease episodes caused by a clone of serotype M3 GAS and found that the outbreak-associated strain was the most common organism recovered from nasopharyngeal carriers in the same locality. Similarly, Muotiala et al. (21) reported that in Finland between 1988 and 1992, the proportions of serotype M1 isolates among invasive and pharyngitis isolates were identical. Taken together, the results of these studies suggest that expression of a protein capable of enhancing the rate or efficiency of GAS colonization of the host mucosal surface is likely to increase the frequency of invasive disease. In this regard, it is noteworthy that expression of the Sic protein may be restricted to relatively few clonal lineages of GAS, most notably M1 organisms (1). We believe it reasonable to hypothesize that the predominance of M1 strains in human infections and the capability of M1 strains to cause epidemic waves are related in part to Sic-mediated enhanced colonization. Additional studies are under way to test this idea.