Previous Article | Next Article 
Infection and Immunity, February 2000, p. 558-563, Vol. 68, No. 2
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Early Induction of Interleukin-12 by Human
Monocytes Exposed to Cryptococcus neoformans
Mannoproteins
Lucia
Pitzurra,1
Robert
Cherniak,2
Monica
Giammarioli,1
Stefano
Perito,1
Francesco
Bistoni,1 and
Anna
Vecchiarelli1,*
Microbiology Section, Department of
Experimental Medicine and Biochemical Sciences, University of Perugia,
06122 Perugia, Italy,1 and Department of
Chemistry, Georgia State University, Atlanta, Georgia
303032
Received 26 May 1999/Returned for modification 16 July
1999/Accepted 6 October 1999
 |
ABSTRACT |
Interleukin-12 (IL-12) production by human monocytes stimulated
with mannoproteins (MPs) of Cryptococcus neoformans was
investigated. The results reported show that secreted or
cell-associated MPs induce an early and significant production of
IL-12. MPs show different capabilities to quantitatively affect IL-12
production; MP2, an 8.2-kDa MP purified from the culture supernatant of
C. neoformans, appears to be the most potent stimulator.
Cytochalasin B inhibits both internalization and IL-12 induction by MP.
In addition, a drastic reduction of IL-12 was observed when monocytes were cultured in the absence of normal human serum or treated with
soluble mannan. Early production of IL-12 promotes early secretion of
gamma interferon by T cells but does not influence the magnitude of the
MP-induced lymphoproliferative response. Overall our results identify
cryptococcal antigens responsible for rapid and potent induction of
IL-12 in monocytes. MPs appear to regulate IL-12 secretion by
internalization via the endocytic pathway and by interaction with
monocyte receptors or serum factors.
 |
INTRODUCTION |
Cryptococcus neoformans
is an opportunistic pathogenic yeast responsible for life-threatening
infection in patients with AIDS (12). The host immune
response to C. neoformans infection is the result of a
complex interplay between cellular and humoral immunity that often
guarantees the control of infection in the immunocompetent host
(36).
Interleukin-12 (IL-12), produced by a variety of cells including
antigen-presenting cells, dendritic cells, B cells, and phagocytic cells, favors Th1 cell generation (29) and orchestrates
Th1-dependent resistance to infections caused by bacteria, fungi,
virus, and intracellular parasites (6, 29, 32).
IL-12 has been shown to be important for the development of an
effective immune response against C. neoformans in mice
(14, 42). Studies of human T cells demonstrated that IL-12
facilitates the generation of a Th1 response with high gamma interferon
(IFN-
) production (21). In particular, in humans it has
been documented that (i) after C. neoformans infection,
IL-12 is produced by monocytes primarily in a T-cell-dependent pathway
(27); (ii) peripheral blood mononuclear cells from healthy
human immunodeficiency virus-seronegative donors express IL-12 p40 mRNA
but are unable to secrete appreciable levels of IL-12 bioactive p70
when primed with C. neoformans (13); (iii) and
IL-12 production by monocytes exposed to C. neoformans is
indirectly mediated by the interaction of the receptor-ligand pair
CD40-CD40 ligand expressed on monocytes and activated T cells (27).
The cell envelope of C. neoformans contains capsular
polysaccharides, glucuronoxylomannan (GXM), galactoxylomannan, and
mannoproteins (MPs) (3, 5, 16). These components can be
isolated from the culture supernatants of the yeast. GXM and MP have
separate effects on the immune system (5). The
immunosuppressive properties of GXM have been extensively documented
(18, 23, 28, 38, 39), and MP plays a role as an
immunopotentiating antigen involved in the cell-mediated immune
response (5, 23, 24, 26; L. Pitzurra, G. Teti, and
A. Vecchiarelli, Abstr. 97th Gen. Meet. Am. Soc. Microbiol. 1997, p.
279, 1997). In particular, several authors have reported the
involvement of purified secreted or cell-associated MP in human
lymphoproliferation and induction of tumor necrosis factor alpha
(TNF-
) secretion by monocytes (1, 2, 19).
In this study, we explored the potential involvement of C. neoformans MPs in IL-12 p40 and bioactive p70 secretion by human monocytes. The results demonstrate that MPs are responsible for rapid
IL-12 induction and that both ligand-specific receptor and nonspecific
endocytosis by monocytes may be dominant signals.
 |
MATERIALS AND METHODS |
C. neoformans.
In this study, C. neoformans acapsular strain NIH B-4131 was used. The morphological
characteristics and growth conditions of the C. neoformans
isolate have been described elsewhere (27). Cultures were
maintained by serial passage on Sabouraud agar (Bio Merieux, Lyon,
France) and harvested by suspending a single colony in RPMI 1640. The
cells were washed twice, counted on a hematocytometer, and adjusted to
the desired concentration. C. neoformans cells were killed
by autoclaving.
Reagents.
Mannan from Saccharomyces cerevisiae,
cytochalasin B from Helminthosporium dematioideum, and
polymyxin B and lipopolysaccharide (LPS) from Escherichia
coli O55:135 were obtained from Sigma (St. Louis, Mo.). Human
recombinant IL-12 was from Genetics Institute (Cambridge, Mass.).
Purification of cryptococcal MPs.
C.
neoformans-secreted MP1 and MP2 were purified as described
previously (1, 2, 4, 15, 24, 34). Briefly, secreted MPs were
purified from culture supernatants of C. neoformans NIH B-4131. Purification was performed by a combination of ultrafiltration affinity chromatography (concanavalin A), anion-exchange chromatography (DEAE), and gel permeation chromatography. Anion-exchange
chromatography of the MPs yielded two fractions, MP1 (35.6 kDa) and MP2
(8.2 kDa) (2). MP1 and MP2 contained 7 and 13% protein and
79 and 43% neutral sugars, respectively. Cell-associated MP105 was
purified as described elsewhere (26). MPs did not contain
endotoxin, since no 2-keto-3-deoxyoctulosonic acid, determined by the
thiobarbituric acid method of Weissbach and Hurwitz (40) and
by the semicarbazide method of MacGee and Douoroff (20),
could be detected in the sample. Furthermore, no differences in IL-12
induction were observed in the absence or presence of polymyxin B on
titration of the fractions (data not shown). Contamination of MPs with
cryptococcal capsular polysaccharide (GXM) was excluded by
monosaccharide composition analysis and the latex agglutination test,
which is specific for GXM. MPs and other reagents, tested for endotoxin
contamination by the Limulus amebocyte lysate assay (Sigma),
were below the detection limit of the assay, which had a sensitivity of
approximately of 0.05 to 0.1 ng of E. coli LPS/ml.
MAbs.
Two anti-IL-12 monoclonal antibodies (MAbs), C11.79
(anti-IL-12 p40/p70) and C11.5.14 (anti-IL-12 p70), were used in this study. MAbs were purified from hybridomas (kindly provided by G. Trinchieri) as previously described (7). Mouse
immunoglobulin G1 kappa (unrelated MAb) was purchased from Sigma.
Isolation of PBM and T(E+) cells.
Heparinized
venous blood from healthy donors was diluted in RPMI 1640 (Gibco BRL,
Life Technologies, San Giuliano Milanese, Italy), and the mononuclear
cells were separated by density gradient centrifugation on
Ficoll-Hypaque (27). The mononuclear cells were washed twice
in RPMI 1640 plus 5% heat-inactivated fetal calf serum (cRPMI) and
incubated for 1 h at a concentration of 2 × 106
to 3 × 106/ml in 100-mm-diameter polystyrene tissue
culture plates (Corning Glass Works, Corning, N.Y.). After 1 h at
37°C in 5% CO2, nonadherent cells were removed by
washing four times and E rosetted as previously described
(28). The cells recovered [T(E+) cells] were
>98% CD3+, as evaluated by flow cytometry analysis. The
remaining adherent cells were refrigerated for 15 min in
Ca+-Mg2+-free phosphate-buffered saline and
collected by scraping with a rubber policeman (Costar, Cambridge,
Mass.). The adherent cells were washed twice with cRPMI and resuspended
in RPMI supplemented with 2 mM L-glutamine,
penicillin-streptomycin (100 IU/ml and 100 µg/ml, respectively), and
10% normal human serum (NHS; Sigma) (NHS-RPMI). The adherent cells
were >98% viable as evaluated by trypan blue dye exclusion, and at
least 95% were peripheral blood monocytes (PBM) as determined by
Wright-Giemsa staining (Diff-Quik stain; Baxter Scientific Products,
McGaw Park, Ill.). Each experiment was performed with monocytes or T
cells isolated from a single donor.
PBM stimulation.
Isolated PBM were distributed in 2-ml
volumes of NHS-RPMI into 24-well flat-bottom tissue culture plates
(Falcon, Becton Dickinson, Oxnard, Calif.) at 2.5 × 106 cells per ml and incubated for different times at
37°C under a 5% CO2 atmosphere in the absence or
presence of heat-inactivated C. neoformans (at an
effector-to-target [E:T] ratio of 1:1) or decreasing doses, from 25 to 0.25 µg of MP (MP1, MP2, or MP105) per ml. At different time
intervals, fluid supernatants were harvested for IL-12 determination.
In selected experiments, IL-12 p40 mRNA expression in unstimulated or
stimulated PBM was determined by reverse transcriptase (RT)-mediated
PCR (RT-PCR), and IL-12 p70 secretion was determined by capture assay
with purified MAb C11.5.14 as described below.
Coculture of PBM and T lymphocytes.
Monolayers of PBM
(2 × 104) adhered in 96-well flat-bottom plates were
incubated with or without heat-inactivated C. neoformans (2 × 104) or 25 µg of MP1, MP2, or MP105 per ml.
Incubation was performed in NHS-RPMI at 37°C in a 5% CO2
atmosphere. After 6 h of incubation, PBM monolayers were washed to
remove stimuli, and then autologous T(E+) cells
(105) in NHS-RPMI were added. At different times, IL-12 and
IFN-
content of fluid supernatants and T-cell lymphoproliferation
were determined as described below. In selected experiments, cells were
cultured in the absence or presence of various doses (from 1 to 0.1 µg/ml) of anti-IL-12 MAb C11.79 or unrelated MAb.
Cytokine determination.
Cytokine levels in culture
supernatants were measured by enzyme-linked immunosorbent assay (ELISA)
based on the antibody sandwich principle for human IFN-
and IL-12
(Biosource International). The IL-12 kit is a solid-phase ELISA based
on the antibody sandwich principle; its sensitivity is <0.8 pg/ml. The
substances tested were human IL-1
, IL-2, IL-3, IL-4, IL-5, IL-7,
IL-8, IFN-
, granulocyte-macrophage colony-stimulated factor, LIF
stem cell factor, TNF-
, IL-10, IL-13, and IL-15; cross-reactivity
was not present. The assay recognizes both natural and recombinant
human IL-12, as well as the free p40 subunit. Selected samples (Fig. 2)
were tested for human IL-12 p70 heterodimer by capture bioassay as
previously described (7). Briefly, supernatants (100 µl)
from unstimulated or 6-h-stimulated PBM were dispensed in 96-well
flat-bottom plates coated with sterile purified antibody C11.5.14 (20 µg/ml) diluted in 0.1 M sodium carbonate-bicarbonate buffer (pH 9.5).
After 5 h at room temperature, plates were washed four times with
phosphate-buffered saline. Then experimental wells were filled with 100 µl of phytohemagglutinin (PHA) blast cell suspension (5 × 106/ml) in cRPMI with 50 U of IL-2 per ml. PHA blast cells
were from 6-day peripheral blood cell cultures (106
cells/ml) containing 1% PHA (Sigma). These preparations were composed
of >98% T cells, as determined by immunofluorescence with MAb to CD3.
After 48 h of incubation, IFN-
production was evaluated as
secreted cytokine in cell-free supernatants. Each supernatant was
tested in triplicate in parallel with serial dilutions of recombinant
IL-12 (from 3 ng to 0.3 ng/ml), using medium as the background. Results
are the means for two donors calculated against a standard curve
obtained with serial dilutions of recombinant human IL-12 (kindly
provided by Genetics Institute).
Lymphocyte proliferation assays.
T(E+) cell
proliferation was measured by [3H]thymidine (0.5 µg/ml;
Amersham International, Aylesbury, United Kingdom) incorporation after
3 and 7 days of coculture. Cells were collected onto filter paper by
using a cell harvester (Flow Labs, McLean, Va.), and the dried filters
were counted directly in a
counter (Packard Instruments Inc.,
Downers Grove, Ill.). Proliferation was expressed as the mean of
indicated replicates ± standard error (SE).
RNA extraction and RT-PCR.
Total RNA was isolated from PBM
by established procedures (22). RNA integrity was assessed
by denaturing gel electrophoresis. Only samples with intact 28S and 18S
rRNA were used for the RT reaction. For each experiment, equivalent
amounts of intact RNA (5 µg) were reverse transcribed as described
elsewhere (22). Equivalent amounts of cDNA in 5-µl
aliquots were amplified by PCR (Perkin-Elmer Cetus DNA thermal cycler)
in a reaction mixture containing PCR buffer (Pharmacia),
MgCl2 (2 mM), deoxynucleoside triphosphates (1.25 mM),
specific primers (0.4 mM), and 1 U of Taq polymerase
(Pharmacia). All samples were denatured at 96°C for 2 min and cycled
with the following log-linear parameters for 32 cycles of denaturation
(94°C for 45 s), annealing (60°C for 45 s), and extension
(72°C for 90 s). Positive cDNA controls and negative controls
(RT-diethylpyrocarbonate-treated H2O) were included. Ten
microliters of the PCR amplification products was separated in ethidium
bromide-stained 1.5% agarose gel and visualized by UV
transillumination. Aliquots of 0.05 µg of
X174 DNA
HaeIII fragments (New England BioLabs, Beverley, Mass.)
were run in parallel as molecular size markers. The amplified bands
showed predicted sizes. Primers were DNA specific and nonreactive with
RNA. The primer sequences were as follows: for
glyceraldehyde-3-phosphate dehydrogenase (358 bp), 5'
TTCTTCAACCCCGAGGAGT 3' (sense) and 5'
GGGAAGGAGGGTGGCCGTG 3' (antisense) (17); for IL-12 p40
(373 bp), 5' GGACCAGAGCAGTGAGGTCTT 3' (sense) and 5'
CTCCTTGTTCCCCTCTGA 3' (antisense) (33).
Cell viability assay.
Cell viability was measured with a
colorimetric reaction based on the capacity of mitochondrial
dehydrogenase of living cells to reduce
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT;
Aldrich Chemical Co., Milan, Italy) to formazan. The quantity of
formazan produced and measured at an optical density of 540 nm in a
Sorin Bomedica microplate reader correlated with the number of living
cells (25).
Statistical analysis.
Statistical significance was
calculated by Student's paired t test.
 |
RESULTS |
To evaluate the involvement of secreted or cell-associated
C. neoformans MPs in IL-12 secretion by PBM, kinetic
experiments were performed with cells from healthy donors. In our
experimental conditions, PBM exposed to C. neoformans yeast
cells produced appreciable levels of IL-12 after 48 h (Fig.
1A). Differences in kinetics and the
amount of MP-induced IL-12 secretion relative to C. neoformans-induced secretion were observed. All MPs induced IL-12
after 6 h of stimulation, MP2 being the best stimulator. In
contrast, no IL-12 production was observed for C. neoformans whole cells. Early induction of IL-12 was consistent with the analysis
of IL-12 p40 mRNA showing that MP1, MP2, and MP105 induced IL-12 gene
expression after 6 h of stimulation (Fig. 1B). Time course
experiments to determine IL-12 p70 showed that MPs induced biologically
active IL-12 levels similar to those reported in Fig. 1.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 1.
(A) IL-12 production by PBM unstimulated or exposed to
C. neoformans whole cells or purified MPs. IL-12 levels in
culture supernatants of human PBM unstimulated (None) or exposed for 6, 24, and 48 h to C. neoformans (E:T = 1:1), MP1 (25 µg/ml), MP2 (25 µg/ml), or MP105 (25 µg/ml) were evaluated by
ELISA. The results are means ± SE of three separate experiments.
*, P < 0.001 (treated versus untreated cells). (B)
RT-PCR detection of IL-12 p40 mRNA from PBM unstimulated or exposed to
purified MPs was evaluated after 6 h of exposure to indicated
stimuli as described in Materials and Methods. MW, molecular weight
markers; H2O, negative control; C, positive control. The
results are from one representative experiment of three performed with
similar results.
|
|
To evaluate whether MPs stimulate bioactive IL-12 p70 secretion by PBM,
a capture bioassay using purified anti-IL-12 MAb was performed. The
results showed that supernatants from 6-h MP-stimulated PBM induced
IL-12 p70 secretion, whereas unstimulated or C. neoformans stimulated cells did not (Fig. 2). The
effect was dose dependent and was maximum in supernatant fluids of
MP2-treated PBM (Fig. 2).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 2.
IL-12 p70 secretion by PBM stimulated with various doses
of MP. IL-12 p70 production was evaluated by capture bioassay with MAb
to IL-12 (C11.5.14) as described in Materials and Methods. IL-12 p70
was evaluated in supernatants from PBM unstimulated or stimulated for
6 h with C. neoformans (E:T = 1:1) or decreasing
doses (from 25 to 0.25 µg/ml) of MP1, MP2, and MP105. Values are
means ± SE of three separate experiments. *, P < 0.001 (treated versus untreated cells).
|
|
Previous studies indicated the involvement of monocyte mannose
receptors or serum mannose binding proteins (MBP) in MP-mediated immunopotentiation, such as cytokine (i.e., TNF-
) secretion or lymphoproliferation (2). Furthermore, internalization of
particulate antigen has been proposed as a potent stimulus for monocyte
IL-12 expression and secretion (11). To evaluate the
potential involvement of MBP, specific receptors, and the endocytic
pathway in MP-induced IL-12 secretion, experiments were performed (i)
in the absence of NHS to exclude MBP involvement, (ii) in the presence
of mannose to block or reduce the potential ligation of MPs to specific
receptors, or (iii) in the presence of cytochalasin B, which inhibits
microtubule polymerization and blocks MP internalization. The results
showed that the omission of NHS from cell culture as well as
pretreatment of PBM with mannan or cytochalasin B significantly reduced
MP-induced IL-12 secretion (Table 1). In
particular, mannan and cytochalasin B reduced the IL-12 response by 35 and 39%, respectively. To exclude possible nonspecific cytotoxicity,
preliminary experiments were performed to determine the dose of
cytochalasin B that did not affect cell viability by the MTT reduction
test, and subsequently a dose of 5.0 µg/ml was used.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Effects of NHS mannan, and cytochalasin B treatment on
early (6 h) induction of MP2-mediated IL-12 secretion by PBM
|
|
It is well known that IL-12 directly regulates IFN-
production
(14, 31, 33), raising the possibility that early secretion of IL-12 could promote early induction of IFN-
. For this purpose, IL-12 and IFN-
production were determined at days 1, 3, and 7 in
cocultures of monocytes treated with MP plus autologous T cells. The
results reported in Fig. 3A show that MPs
induce high levels of IL-12, reaching a maximum after 7 days of
incubation. It should be noted that MPs, in contrast to C. neoformans whole cells, were able to induce early production of
IFN-
(Fig. 3B). MP2 was a better stimulator of IFN-
than MP1 or
MP105. The kinetics and amount of MP2-induced IFN-
secretion were
similar to those observed in assays using recombinant IL-12 (0.3 ng/ml)
as the stimulus (Fig. 3B), raising the possibility that in our
experimental system early IL-12 induction involves IFN-
production.
Further evidence that IFN-
was produced in an IL-12-dependent manner
was provided by assessment of IL-12 and IFN-
production by the same
supernatant fluids from MP-stimulated PBM after 6 h of incubation.
The results showed that a significant amount of IL-12 was produced
while only negligible levels of IFN-
were observed (data not shown).
In addition, blocking experiments were performed with a MAb to IL-12, C11.79, that specifically recognizes both IL-12 p40 and p70
(7), thus showing that neutralization of MP-induced
endogenous IL-12 drastically reduced early secretion of IFN-
(Fig.
4A). This inhibitory effect was most
pronounced (50% reduction) in the presence of 0.1 µg of MAb to IL-12
per ml (Fig. 4B). The specificity of MAb to IL-12 inhibitory activity
was confirmed by the inability of an unrelated MAb to affect IFN-
secretion. In addition, the MAb to IL-12 inhibited IFN-
secretion in
C. neoformans-stimulated cells at 7 days of incubation (Fig.
4).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3.
IL-12 and IFN- levels in supernatant fluids of PBM
plus autologous T lymphocytes stimulated with MPs. PBM plus T
lymphocytes were unstimulated or stimulated with C. neoformans (E:T = 1:1) or with MPs (25 µg/ml). After 1, 3, and 7 days of coculture, IL-12 (A) and IFN- (B) levels were
evaluated in cell-free supernatants by ELISA. Human recombinant IL-12
(0.3 ng/ml) was used as positive control to induce IFN- secretion.
Values are means ± SE of three separate experiments. *,
P < 0.01 (treated versus untreated cells).
|
|

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of MAb to IL-12 (C11.79) on IFN- secretion by
cocultures of PBM plus autologous T lymphocytes were cocultured with
C. neoformans or MPs in the absence or presence of MAb to
IL-12 (0.1 µg/ml) or unrelated MAb (0.1 µg/ml). IFN- levels were
determined by ELISA in supernatant fluids collected after 3 (A) and 7 (B) days of incubation. Values are means ± SE of three separate
experiments. *, P < 0.01 (MAb to IL-12-treated
versus untreated cells).
|
|
Having established that MP-induced IL-12 promotes early secretion of
IFN-
, we examined the possibility that endogenous IL-12 could affect
C. neoformans or MP-induced lymphoproliferation. To this
end, MAb to IL-12 was incorporated in the mixture of MPs or C. neoformans-treated PBM and T cells. The results reported in Table
2 show that the MAb to IL-12 did not
modify the T-cell proliferative response. Furthermore, the use of
increasing concentrations of MAb to IL-12 (from 0.01 to 1 µg/ml) did
not modify the results (data not shown).
 |
DISCUSSION |
The data from this study show that C. neoformans MPs
are involved in early induction of both IL-12 p40 subunit and p70
heterodimer secretion by human monocytes. While IL-12 was produced by
monocytes in response to C. neoformans whole cells and MP
stimulation, profound differences were observed in both the magnitude
and timing of the IL-12 response. MPs are early and strong inducers of
IL-12 compared to C. neoformans whole cells. MP-induced
IL-12 is mediated by signals involving MP ligation, possibly through
mannan MP recognition by monocyte receptors or by serum factors, and
the nonspecific endocytic pathway. Early secretion of MP-induced IL-12
strongly influences the early production of IFN-
by T cells but is
unable to affect MP-induced T-cell proliferation.
Monocytes and macrophages play a critical role in the protective
cellular immune response to C. neoformans (37,
39). Furthermore, they are possible major physiological producers
of IL-12, as suggested by in vivo and in vitro studies in various
infectious disease models (32). Studies of experimental
murine models emphasize the pivotal role of IL-12 in the induction of
protective responses against C. neoformans (8,
42). Recently we reported that IL-12 produced by human monocytes
responding to C. neoformans whole cells is secreted late,
predominantly in a T-cell-dependent mechanism (27). In
addition, an immunosuppressive role for C. neoformans in
IL-12 production has been reported (17). Here we identify MP
antigens of the cryptococcal envelope responsible for early and massive
induction bioactive IL-12 by human monocytes.
MPs from C. neoformans are responsible for T-cell
proliferation and are strong inducers of proinflammatory cytokines such as IL-1
(Pitzurra et al., Abstr. 97th Gen. Meet. Am. Soc. Microbiol. 1997) and TNF-
(1, 2). A relationship between TNF-
production and IL-12 has been observed in murine macrophages stimulated
with bacillus Calmette-Guérin (10). Consequently, the
early and massive induction of IL-12 observed by us could be related to the ability of MPs to favor TNF-
secretion by human monocytes.
Monocytes alone are poor producers of IL-12 when stimulated with
encapsulated C. neoformans, but an appreciable increase of IL-12 secretion was observed when an acapsular mutant was used (27). Our present observation that MPs induce an early and
high release of IL-12 suggests that MPs of the acapsular cryptococcal envelope could be responsible, at least in part, for the significant production of IL-12 by monocytes. This is consistent with the increase
of MP fractions recovered from acapsular C. neoformans with
respect to encapsulated strains (26, 35). It is likely that
MP antigen can be masked by capsular material in the encapsulated strains, or MP may compete with GXM to bind to the same receptors on
monocytes since GXM binding to phagocytic cells has been observed (9).
Importantly, the early presence of endogenous IL-12 appears to be a
promoter of early and consistent production of IFN-
by T cells. In
contrast to C. neoformans whole cells, which primarily induce IL-12 in a T-cell-dependent mechanism, MPs induce IL-12 by
monocytes through direct interaction in a T-cell-independent mechanism.
While endogenous IL-12 is a strong promoter of IFN-
, it is unable to
affect the magnitude of MP-induced lymphoproliferation. This is
consistent with previous observations showing the inability of
recombinant IL-12 to influence the proliferative response to C. neoformans (13).
As described for MP2-induced TNF-
, MP2-induced IL-12 is moderately
reduced by pretreatment of monocytes with mannan. A possible explanation is that the same signal transduction promotes the synthesis
of TNF-
and IL-12. Alternatively, the synthesis and secretion of the
two cytokines could be mutually regulated in an autocrine manner. In
addition, we demonstrate that, other than MP ligation on monocyte
receptors, the endocytic pathway that allows MP internalization plays
an important role in MP2-induced IL-12 induction. However, we cannot
exclude the possibility that cytochalasin B influences the adherence of
MP to monocytes. In addition, mannan and cytochalasin B never
completely blocked IL-12 production; thus, the stimulation of IL-12
through alternative mechanisms or the use of an insufficient amount of
these substances can be considered.
Previous results by Harrison and Levitz (13) showed that in
spite of the undetectable levels of IL-12, IL-12 p40 mRNA message was
detected in monocytes responding to C. neoformans after
6 h of stimulation. The ability of MP to induce IL-12 p40 mRNA
within 6 h of stimulation correlated with IL-12 secretion.
Overall our results show that MPs are cryptococcal envelope antigens
responsible for early production of IL-12 by phagocytic cells.
Secretion requires two steps, the first likely involving the mannan
part of MPs, which can be recognized by monocyte receptors or serum
factors, and the second requiring MP2 internalization via the endocytic pathway.
Early and significant IL-12 production in response to MPs suggests that
purified MP antigen favors the development of a prompt and strong
protective Th1 cellular response. Consequently, MPs that positively
influence the cellular immune response to C. neoformans could be useful for developing a rational strategy to prevent cryptococcosis.
 |
ACKNOWLEDGMENTS |
We are grateful to Eileen Zannetti for excellent editorial and
secretarial assistance and Genetics Institute for human recombinant IL-12.
This study was supported by the National Research Program on
AIDS "Opportunistic Infections and Tuberculosis" contract
50A.0.35.Italy.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Microbiology
Section, Department of Experimental Medicine and Biochemical Sciences, University of Perugia, Via del Giochetto, 06122 Perugia, Italy. Phone
and fax: 39-075-585-3407. E-mail: vecchiar{at}unipg.it.
Editor:
T. R. Kozel
 |
REFERENCES |
| 1.
|
Chaka, W.,
A. F. Verheul,
V. V. Vaishnav,
R. Cherniak,
J. Scharringa,
J. Verhoef,
H. Snippe, and I. M. Hoepelman.
1997.
Cryptococcus neoformans and cryptococcal glucuronoxylomannan, galactoxylomannan, and mannoprotein induce different levels of tumor necrosis factor alpha in human peripheral blood mononuclear cells.
Infect. Immun.
65:272-278[Abstract].
|
| 2.
|
Chaka, W.,
A. F. Verheul,
V. V. Vaishnav,
R. Cherniak,
J. Scharringa,
J. Verhoef,
H. Snippe, and I. M. Hoepelman.
1997.
Induction of TNF-alpha in human peripheral blood mononuclear cells by the mannoprotein of Cryptococcus neoformans involves human mannose binding protein.
J. Immunol.
159:2979-2985[Abstract].
|
| 3.
|
Cherniak, R.,
E. Reiss,
M. E. Slodki,
R. D. Plattner, and S. O. Blumer.
1980.
Structure and antigenic activity of the capsular polysaccharide from Cryptococcus neoformans serotype A.
Mol. Immunol.
17:1025-1032[CrossRef][Medline].
|
| 4.
|
Cherniak, R.,
E. Reiss, and S. H. Turner.
1982.
A galactoxylomannan antigen of Cryptococcus neoformans serotype A.
Carbohydr. Res.
103:239-250[CrossRef].
|
| 5.
|
Cherniak, R., and J. B. Sundstrom.
1994.
Polysaccharide antigens of the capsule of Cryptococcus neoformans.
Infect. Immun.
62:1507-1512[Abstract/Free Full Text].
|
| 6.
|
Coutelier, J. P.,
J. Van Broeck, and S. F. Wolf.
1995.
Interleukin-12 gene expression after viral infection in the mouse.
J. Virol.
69:1955-1958[Abstract].
|
| 7.
|
D'Andrea, A.,
M. Regaraju,
N. M. Valiante,
J. Chehimi,
M. Kubin,
M. Aste,
S. H. Chan,
M. Kobayashi,
D. Young,
E. Nickbarg,
R. Chizzonte,
S. F. Wolf, and G. Trinchieri.
1992.
Production of natural killer cell stimulatory factor (interleukin 12) by peripheral blood mononuclear cells.
J. Exp. Med.
176:1387-1398[Abstract/Free Full Text].
|
| 8.
|
Decken, K.,
G. Kohler,
K. Palmer-Lehmann,
A. Wunderlin,
F. Mattner,
J. Magram,
M. K. Gately, and G. Alber.
1998.
Interleukin 12 is essential for a protective Th1 response in mice infected with Cryptococcus neoformans.
Infect. Immun.
66:4994-5000[Abstract/Free Full Text].
|
| 9.
|
Dong, Z. M., and J. W. Murphy.
1997.
Cryptococcal polysaccharides bind to CD18 on human neutrophils.
Infect. Immun.
65:557-563[Abstract].
|
| 10.
|
Flesch, I. E.,
J. H. Hess,
S. Huang,
M. Auget,
J. Rothe,
H. Bluethmann, and S. H. E. Kaufmann.
1995.
Early interleukin 12 production by macrophages in response to mycobacterial infection depends on interferon- and tumor necrosis factor .
J. Exp. Med.
181:1615-1621[Abstract/Free Full Text].
|
| 11.
|
Fulton, S. A.,
J. M. Johnson,
S. F. Wolf,
D. S. Sieburth, and W. H. Boom.
1996.
Interleukin-12 production by human monocytes infected with Mycobacterium tuberculosis: role of phagocytosis.
Infect. Immun.
64:2523-2531[Abstract].
|
| 12.
|
Good, C. B., and W. A. Coax.
1990.
Cryptococcal infection in patients with AIDS.
N. Engl. J. Med.
322:701-702[Medline].
|
| 13.
|
Harrison, T. S., and S. M. Levitz.
1996.
Role of IL-12 in peripheral blood mononuclear cell responses to fungi in persons with and without HIV infection.
J. Immunol.
156:4492-4497[Abstract].
|
| 14.
|
Hoag, K. A.,
M. F. Lipscomb,
A. A. Izzo, and N. E. Street.
1997.
IL-12 and IFN- are required for initiating the protective Th1 response to pulmonary cryptococcosis in resistant C.B-17 mice.
Am. J. Respir. Cell Mol. Biol.
17:733-739[Abstract/Free Full Text].
|
| 15.
|
James, P. G., and R. Cherniak.
1992.
Galactoxylomannan of Cryptococcus neoformans.
Infect. Immun.
60:1084-1088[Abstract/Free Full Text].
|
| 16.
|
James, P. G.,
R. Cherniak,
R. G. Jones,
C. A. Stortz, and E. Reiss.
1990.
Cell wall glucans of Cryptococcus neoformans Cap67.
Carbohydr. Res.
188:23-38.
|
| 17.
|
Kawakami, K.,
M. H. Qureshi,
Y. Koguchi,
K. Nakajima, and A. Saito.
1999.
Differential effect of Cryptococcus neoformans on the production of IL-12p40 and IL-10 by murine macrophages stimulated with lipopolysaccharide and gamma interferon.
FEMS Microbiol. Lett.
175:87-94[CrossRef][Medline].
|
| 18.
|
Kozel, T. R., and E. C. Gotschlich.
1982.
The capsule of Cryptococcus neoformans passively inhibits phagocytosis of the yeast macrophages.
J. Immunol.
129:1675-1680[Abstract].
|
| 19.
|
Levitz, S. M., and E. A. North.
1997.
Lymphoproliferation and cytokine profiles in human peripheral blood mononuclear cells stimulated by Cryptococcus neoformans.
J. Med. Vet. Mycol.
35:229-236[Medline].
|
| 20.
|
MacGee, J., and M. Doudoroff.
1954.
A new phosphorylated intermediate in glucose oxidation.
J. Biol. Chem.
210:617-629[Free Full Text].
|
| 21.
|
Manetti, R.,
F. Gerosa,
M. G. Giudizi,
R. Biagiotti,
P. Parronchi,
M. P. Piccinini,
S. Sampognaro,
S. Maggi,
S. Romagnani, and G. Trinchieri.
1994.
Interleukin-12 induces stable priming for interferon (IFN- ) production during differentiation of human T helper (Th) cells and transient IFN- production in established Th2 cell clones.
J. Exp. Med.
179:1273-1283[Abstract/Free Full Text].
|
| 22.
|
Monari, C.,
C. Retini,
B. Palazzetti,
F. Bistoni, and A. Vecchiarelli.
1997.
Regulatory role of exogenous IL-10 in the development of immune response versus Cryptococcus neoformans.
Clin. Exp. Immunol.
109:242-247[CrossRef][Medline].
|
| 23.
|
Murphy, J. W.
1988.
Influence of Cryptococcus antigens on cell-mediated immunity.
Rev. Infect. Dis.
10:S432-S435.
|
| 24.
|
Orendi, J. M.,
A. F. M. Verheul,
N. M. De Vos,
M. R. Visser,
H. Snippe,
R. Cherniak,
V. V. Vaishnav,
G. T. Rijkers, and J. Verhoef.
1997.
Mannoproteins of Cryptococcus neoformans induce proliferative response in human peripheral blood mononuclear cells (PBM) and enhance HIV-1 replication.
Clin. Exp. Immunol.
107:293-299[CrossRef][Medline].
|
| 25.
|
Pauwels, R.,
J. Balzarini,
M. Baba,
R. Snoeck,
D. Schols,
P. Herdewijn,
J. Desmyter, and E. De Clercq.
1988.
Rapid and automated tetrazolium-based colorimetric assay for the detection of anti-HIV compounds.
J. Virol. Method
20:309-321[CrossRef][Medline].
|
| 26.
|
Pitzurra, L.,
A. Vecchiarelli,
R. Peducci,
A. Cardinali, and F. Bistoni.
1997.
Identification of a 105 kilodalton Cryptococcus neoformans mannoprotein involved in human cell-mediated immune response.
J. Med. Vet. Mycol.
35:299-303[Medline].
|
| 27.
|
Retini, C.,
A. Casadevall,
D. Pietrella,
C. Monari,
B. Palazzetti, and A. Vecchiarelli.
1999.
Specific activated T cells regulate interleukin-12 production by human monocytes stimulated with Cryptococcus neoformans.
J. Immunol.
162:1618-1623[Abstract/Free Full Text].
|
| 28.
|
Retini, C.,
A. Vecchiarelli,
C. Monari,
F. Bistoni, and T. R. Kozel.
1998.
Encapsulation of Cryptococcus neoformans with glucuronoxylomannan inhibits the antigen-presenting capacity of monocytes.
Infect. Immun.
66:664-669[Abstract/Free Full Text].
|
| 29.
|
Romani, L.,
P. Puccetti, and F. Bistoni.
1997.
Interleukin 12 in infectious diseases.
Clin. Microbiol. Rev.
10:611-636[Abstract].
|
| 30.
|
Trinchieri, G.
1993.
Interleukin-12 and its role in the generation of Th1 cells.
Immunol. Today
14:335-338[CrossRef][Medline].
|
| 31.
|
Trinchieri, G.
1994.
Interleukin-12: a cytokine produced by antigen-presenting cells with immunoregulatory functions in the generation of T-helper cells type 1 and cytotoxic lymphocytes.
Blood
84:4008-4027[Free Full Text].
|
| 32.
|
Trinchieri, G.
1997.
Cytokines acting on or secreted by macrophages during intracellular infection (IL-10, IL-12, IFN- ).
Curr. Opin. Immunol.
9:17-23[CrossRef][Medline].
|
| 33.
|
Trinchieri, G.
1997.
Function and clinical use of interleukin-12.
Curr. Opin. Hematol.
4:59-66[Medline].
|
| 34.
|
Turner, S. H.,
R. Cherniak, and E. Reiss.
1984.
Fractionation and characterization of galactoxylomannan from Cryptococcus neoformans.
Carbohydr. Res.
125:343-349[CrossRef][Medline].
|
| 35.
|
Vartivarian, S. E.,
G. H. Reyes,
E. S. Jacobson,
P. G. James,
R. Cherniak,
V. R. Mumaw, and M. J. Tingler.
1989.
Localization of mannoprotein in Cryptococcus neoformans.
J. Bacteriol.
17:6850-6852.
|
| 36.
|
Vecchiarelli, A., and A. Casadevall.
1998.
Antibody-mediated effects against Cryptococcus neoformans: evidence for interdependency and collaboration between humoral and cellular immunity.
Res. Immunol.
149:321-333[CrossRef][Medline].
|
| 37.
|
Vecchiarelli, A.,
M. Dottorini,
D. Pietrella,
C. Monari,
C. Retini,
T. Todisco, and F. Bistoni.
1994.
Role of human alveolar macrophages as antigen presenting cells in Cryptococcus neoformans infection.
Am. J. Respir. Cell Mol. Biol.
11:130-137[Abstract].
|
| 38.
|
Vecchiarelli, A.,
D. Pietrella,
M. Dottorini,
C. Monari,
C. Retini,
T. Todisco, and F. Bistoni.
1994.
Encapsulation of Cryptococcus neoformans regulates fungicidal activity and antigen presentation process in human alveolar macrophages.
Clin. Exp. Immunol.
98:217-223[Medline].
|
| 39.
|
Vecchiarelli, A.,
C. Retini,
D. Pietrella,
C. Monari,
C. Tascini,
T. Beccari, and T. R. Kozel.
1995.
Downregulation of cryptococcal polysaccharide of tumor necrosis factor alpha and interleukin-1 secretion from human monocytes.
Infect. Immun.
63:2919-2923[Abstract].
|
| 40.
|
Weissbach, A., and J. Hurwitz.
1959.
The formation of 2-keto-3-deoxyheptonic acid in extracts of Escherichia coli B.
J. Biol. Chem.
234:705-709[Free Full Text].
|
| 41.
|
Wolf, S. F.,
P. A. Temple,
M. Kobayashi,
D. Young,
M. Dicig,
L. Lowe,
R. Dzialo,
L. Fitz,
C. Ferenz,
R. M. Hewick,
K. Kelleher,
S. H. Hermann,
S. C. Clark,
L. Azzoni,
S. H. Chan,
G. Trinchieri, and B. Perussia.
1991.
Cloning of cDNA for natural killer cell stimulatory factor, a heterodimeric cytokine with multiple biologic effects on T and natural killer cells.
J. Immunol.
146:3074-3081[Abstract].
|
| 42.
|
Zhang, T.,
K. Kawakami,
M. H. Qureshi,
H. Okamura,
M. Kurimoto, and A. Saito.
1997.
Interleukin-12 (IL-12) and IL-18 synergistically induce the fungicidal activity of murine peritoneal exudate cells against Cryptococcus neoformans through production of gamma interferon by natural killer cells.
Infect. Immun.
65:3594-3599[Abstract].
|
Infection and Immunity, February 2000, p. 558-563, Vol. 68, No. 2
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pietrella, D., Corbucci, C., Perito, S., Bistoni, G., Vecchiarelli, A.
(2005). Mannoproteins from Cryptococcus neoformans Promote Dendritic Cell Maturation and Activation. Infect. Immun.
73: 820-827
[Abstract]
[Full Text]
-
Mansour, M. K., Yauch, L. E., Rottman, J. B., Levitz, S. M.
(2004). Protective Efficacy of Antigenic Fractions in Mouse Models of Cryptococcosis. Infect. Immun.
72: 1746-1754
[Abstract]
[Full Text]
-
Foster, A. J., Bird, R. A., Kelly, S. L., Nishimura, K., Poyner, D., Taylor, S., Smith, S. N.
(2004). FITC-lectin avidity of Cryptococcus neoformans cell wall and capsular components. Mycologia
96: 1-8
[Abstract]
[Full Text]
-
Pietrella, D., Mazzolla, R., Lupo, P., Pitzurra, L., Gomez, M. J., Cherniak, R., Vecchiarelli, A.
(2002). Mannoprotein from Cryptococcus neoformans Promotes T-Helper Type 1 Anticandidal Responses in Mice. Infect. Immun.
70: 6621-6627
[Abstract]
[Full Text]
-
Koguchi, Y., Kawakami, K., Kon, S., Segawa, T., Maeda, M., Uede, T., Saito, A.
(2002). Penicillium marneffei Causes Osteopontin-Mediated Production of Interleukin-12 by Peripheral Blood Mononuclear Cells. Infect. Immun.
70: 1042-1048
[Abstract]
[Full Text]
-
Kawakami, K., Kinjo, Y., Yara, S., Uezu, K., Koguchi, Y., Tohyama, M., Azuma, M., Takeda, K., Akira, S., Saito, A.
(2001). Enhanced Gamma Interferon Production through Activation of Valpha 14+ Natural Killer T Cells by alpha -Galactosylceramide in Interleukin-18-Deficient Mice with Systemic Cryptococcosis. Infect. Immun.
69: 6643-6650
[Abstract]
[Full Text]
-
Retini, C., Kozel, T. R., Pietrella, D., Monari, C., Bistoni, F., Vecchiarelli, A.
(2001). Interdependency of Interleukin-10 and Interleukin-12 in Regulation of T-Cell Differentiation and Effector Function of Monocytes in Response to Stimulation with Cryptococcus neoformans. Infect. Immun.
69: 6064-6073
[Abstract]
[Full Text]
-
Pietrella, D., Cherniak, R., Strappini, C., Perito, S., Mosci, P., Bistoni, F., Vecchiarelli, A.
(2001). Role of Mannoprotein in Induction and Regulation of Immunity to Cryptococcus neoformans. Infect. Immun.
69: 2808-2814
[Abstract]
[Full Text]
-
Chiani, P., Bromuro, C., Torosantucci, A.
(2000). Defective Induction of Interleukin-12 in Human Monocytes by Germ-Tube Forms of Candida albicans. Infect. Immun.
68: 5628-5634
[Abstract]
[Full Text]