Previous Article | Next Article 
Infection and Immunity, February 2000, p. 871-876, Vol. 68, No. 2
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
GAA Trinucleotide Repeat Region Regulates M9/pMGA
Gene Expression in Mycoplasma gallisepticum
Li
Liu,1
Kevin
Dybvig,2
Victor S.
Panangala,1,*
Vicky L.
van Santen,1 and
Christopher T.
French2
Department of Pathobiology, College of
Veterinary Medicine, Auburn University, Auburn, Alabama
36849,1 and Department of Comparative
Medicine and Microbiology, University of Alabama at Birmingham,
Birmingham, Alabama 352942
Received 18 August 1999/Returned for modification 14 October
1999/Accepted 28 October 1999
 |
ABSTRACT |
Mycoplasma gallisepticum, the cause of chronic
respiratory infections in the avian host, possesses a family of M9/pMGA
genes encoding an adhesin(s) associated with hemagglutination.
Nucleotide sequences of M9/pMGA gene family members indicate extensive
sequence similarity in the promoter regions of both the transcribed and silent genes. The mechanism that regulates M9/pMGA gene expression is
unknown, but studies have revealed an apparent correlation between gene
expression and the number of tandem GAA repeat motifs located upstream
of the putative promoter. In this study, transposon Tn4001
was used as a vector with the Escherichia coli lacZ gene as
the reporter system to examine the role of the GAA repeats in M9/pMGA
gene expression in M. gallisepticum. A 336-bp M9 gene fragment (containing the GAA repeat region, the promoter, and the
translation start codon) was amplified by PCR, ligated with a
lacZ gene from E. coli, and inserted into the
Tn4001-containing plasmid pISM2062. This construct was
transformed into M. gallisepticum PG31. Transformants were
filter cloned on agar supplemented with 5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
to monitor lacZ gene expression on the basis of blue/white
color selection. Several cycles of filter cloning resulted in cell
lineages in which lacZ gene expression alternated between
the On and Off states in successive generations of progeny clones. The
promoter regions of the M9-lacZ hybrid genes of individual
progeny clones were amplified by PCR and sequenced. The only
differences between the promoter regions of the blue and white colonies
were in the number of GAA repeats. Clones that expressed
lacZ had exactly 12 tandem copies of the GAA repeat. Clones
that did not express lacZ invariably had either more than
12 (14 to 16) or fewer than 12 (5 to 11) GAA repeats. Southern analysis
of M. gallisepticum chromosomal DNA confirmed that the
phase-variable expression of the lacZ reporter gene was not
caused by Tn4001 transposition. These data strongly indicate that changes in the length of the GAA repeat region are responsible for regulating M9/pMGA gene expression.
 |
INTRODUCTION |
A family of pMGA genes with a
potential to code for hemagglutinins has been identified in the avian
chronic respiratory disease agent Mycoplasma gallisepticum
(14). Recently, we demonstrated that the 62-kDa M9 protein
associated with monoclonal antibody-mediated agglutination of M. gallisepticum is encoded by a member of the pMGA family
(12). The tandemly arranged multiple pMGA genes in M. gallisepticum S6 account for as much as 8% of the 1,030-kb total
genome (2). Delineation of a significant amount of DNA for
the synthesis of pMGA gene products denotes an important dynamic function for this gene cluster in the morphogenesis and survival of the
organism. Among the 32 to 70 pMGA genes that are estimated to be
present in the genomes of different strains of M. gallisepticum, there is appreciable sequence similarity both
within and across strains. It is thought that only one of the pMGA
genes is predominately expressed in a given strain as a result of
transcriptional regulation (7). A notable similarity in the
intergenic regions of members of the M9/pMGA family is the occurrence
of tandem GAA trinucleotide repeats located upstream of the putative
promoter. While both the pMGA1.1 gene expressed in strain S6 and the M9
gene expressed in strain PG31 have exactly 12 copies of the GAA repeat,
none of the silent genes of the M9/pMGA family for which nucleotide sequence data are known have 12 repeats (8, 12). In vitro growth of M. gallisepticum S6 in the presence of specific
antibodies to pMGA1.1 (the expressed protein in strain S6) negates the
production of pMGA1.1 and leads to the production of a related pMGA
family member, pMGA1.9 (15). The change in pMGA protein
production resulting from the incubation of cells with pMGA-specific
antibody was accompanied by changes in the number of GAA repeats
upstream of pMGA genes, consistent with a mechanism by which
oscillation of pMGA gene expression between the On and Off states is
regulated by the length of the GAA repeat region (8).
In this study we demonstrate for the first time the use of a
lacZ reporter to investigate Mycoplasma gene
regulation. A lacZ-M9 fusion gene was constructed and
inserted into the M. gallisepticum PG31 chromosome by using
the Staphylococcus aureus transposon Tn4001 as
the delivery vehicle. The fusion gene consisted of a 336-bp PCR product
containing the M9 GAA repeat region, M9 transcription and translation
start sites, and a promoterless lacZ gene from Escherichia coli. Expression of the fusion gene in M. gallisepticum was monitored by observing the blue/white color of
colonies on agar supplemented with X-Gal
(5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside). Pedigree analysis of several generations of subclones demonstrated that
colonies that were predominately blue had 12 copies of the GAA repeat
sequence upstream of the lacZ gene while white colonies had
either more or fewer than 12 repeats but never exactly 12. The change
in the length of the GAA repeat region was the only difference in the
nucleotide sequence of the M9 portion of the fusion genes from blue and
white colonies. These data indicate that the 336-bp region contains all
the sequences necessary to drive GAA-dependent M9 gene expression.
 |
MATERIALS AND METHODS |
Bacteria, plasmids, and culture conditions.
M.
gallisepticum PG31 (ATCC 19610) was cultured in modified Frey
(6) broth or agar supplemented with 10% swine serum as described previously (10). Broth cultures were grown at
37°C to mid-log phase as observed by a change in the phenol red pH indicator to orange (ca. 2 to 4 days). After transformation,
mycoplasmas were grown in modified Frey medium supplemented with 80 µg of gentamicin per ml. Plasmids pISM2062 containing
Tn4001 and pISM2062.2lac (11)
containing the promoterless lacZ gene were provided by F. C. Minion, University of Iowa, Ames, Iowa. E. coli
INV
F' and the TA cloning vector pCR2.1 were obtained from
Invitrogen, Carlsbad, Calif., and E. coli XL1-Blue MRF' was
obtained from Stratagene, La Jolla, Calif. The E. coli
strains were cultured in Luria-Bertani medium.
Construction of the lacZ reporter.
A 336-bp M9
gene fragment of M. gallisepticum (containing the GAA
region, the putative promoter, and the translation start codon) was
amplified by PCR with the 5' M9 primer
CGAAGCTTAGTCCAGAACCCATAAAACCG and the 3' M9 primer
CCAGGATCCGCTAACATTACAAACGAACC (Fig.
1), designed on the basis of previously
published M9 gene sequences (GenBank accession no. AF032890
[12]). Plasmid VSP #3 DNA containing the whole M9 gene
of M. gallisepticum PG31 (12) was used as the
template. PCR was performed in a 50-µl reaction mixture containing 1.25 U of Taq DNA polymerase (Perkin-Elmer Cetus, Norwalk,
Conn.), deoxynucleoside triphosphates (0.2 mM each), and 1.5 mM
MgCl2. The PCR amplification was done with a GeneAmp 9600 thermal cycler under the following conditions: denaturation at 95°C
for 1 min, three cycles of annealing (90 s) at 49°C, extension (30 s)
at 72°C, and denaturation (20 s) at 95°C, and then 25 cycles with the same extension and denaturation conditions but with annealing at
58°C.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 1.
Nucleotide sequence of the 5'-end region of the
M9-lacZ fusion gene. Sequences derived from the
oligonucleotide primers used for PCR amplification of the M9 promoter
region and the trinucleotide GAA repeat region are underlined, as is
the sequence complementary to the lacZ primer used to
amplify the promoter region of the reporter gene in transformants. The
putative transcription start site (arrow) of the M9 gene was identified
based on sequence similarity to the start site previously determined
for pMGA (7).
|
|
The amplified M9 gene fragment was ligated into the pCR2.1 cloning
vector and transformed into
E. coli INV

F', selecting for
ampicillin resistance. The resulting plasmid was linearized by
digestion with
BamHI and ligated with the 3-kb
BamHI fragment
containing the promoterless
lacZ
gene from plasmid pISM2062.2
lac (Fig.
2A). The ligation mixture was used to
transform
E. coli XL1-Blue MRF', which was assayed on
Luria-Bertani plates containing
100 µg of ampicillin per ml, 80 µg
of isopropyl-
D-thiogalactopyranoside
(IPTG) per ml, and 150 µg of X-Gal per ml. Restriction enzyme
analysis confirmed that the
plasmid (pCR2.1-M9.lacZ), obtained
from blue colonies, contained the
336-bp M9 gene fragment and
the
lacZ gene in the correct
orientation.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 2.
Schematic diagram of the construction of the
M9-lacZ reporter and its insertion into the chromosome of
M. gallisepticum. (A) A 336-bp PCR product containing the 5'
end of the M9 gene was inserted in frame with a promoterless
lacZ gene and inserted into Tn4001 as
illustrated. White regions denote sequences derived from E. coli plasmid vectors. Regions shaded in black, dark gray, and
light gray denote the M9 gene fragment, sequences originating from
Tn4001mod, and lacZ, respectively. In pISM2062
and pISM-M9.lacZ, the transposon portion of the plasmid is denoted by a
thick line. Arrows marking plasmid regions illustrate the direction of
transcription. (B) A representation of Tn4001 containing
M9-lacZ inserted into the chromosome of M. gallisepticum. Thin lines denote mycoplasmal chromosomal DNA
flanking the transposon insert. Shaded regions are as indicated in
panel A. The HindIII site shown in chromosomal DNA
sequences on the left represents the mycoplasmal HindIII
site most proximal to the left end of the transposon.
|
|
The strategy for transferring the M9-
lacZ gene from
pCR2.1-M9.lacZ to pISM2062, containing Tn
4001, is
illustrated in Fig.
2A. The M9-
lacZ gene was excised as a
3.5-kb fragment from pCR2.1-M9.lacZ
by digestion with
Asp718
and
SphI. The ends of the fragment were
made flush by
digestion with T4 DNA polymerase (New England BioLabs,
Beverly, Mass.),
and
SphI linkers were attached. To prepare the
pISM2062
vector, the
SmaI cloning site (located within
Tn
4001)
was converted to a
SphI site by digestion
of the plasmid with
SmaI followed by attachment of
SphI linkers. The 3.5-kb fragment
containing the
M9-
lacZ fusion gene was ligated into the
SphI
site
of the modified pISM2062 plasmid to generate plasmid pISM-M9.lacZ.
Restriction analysis of pISM-M9.lacZ demonstrated that the
M9-
lacZ gene is oriented within Tn
4001, as shown
in Fig.
2A.
Transformation of M. gallisepticum by
electroporation.
Cells from log-phase cultures of M. gallisepticum PG31 were harvested by centrifugation at
8,000 × g, washed, and suspended in HEPES-sucrose
buffer (HSB) (8 mM HEPES, 272 mM sucrose [pH 7.4]) at 108
to 109 cells/100 µl of buffer. The mycoplasma cells and
plasmid pISM-M9.lacZ DNA (20 µg in 10 µl of HSB) were mixed in a
prechilled 1.5-ml microtube and incubated on ice for 10 min. The
mixture was transferred to a prechilled cuvette with an electrode gap
of 0.2 cm and electroporated with a Gene Pulser II (Bio-Rad, Hercules,
Calif.) at 2.5 kV, 100
, and 25 µF (9). The cells were
immediately transferred to 1 ml of Frey medium in a prechilled 15-ml
polypropylene tube, placed on ice for 7 min, incubated at 37°C for
2 h, and assayed on agar supplemented with gentamicin (80 µg/ml)
and X-Gal (150 µg/ml) (X-Gal plates). Representative blue and white
colonies (transformants) were picked, initially cultured in 2 ml of
Frey broth containing gentamicin, and stored frozen at
80°C for
future use.
Pedigree analysis and monitoring of blue/white color
selection.
To perform pedigree analysis, mycoplasmas were passed
through a 0.2-µm-pore-size filter before being assayed for CFU on
X-Gal plates. This filter-cloning procedure was used to eliminate cell aggregates. Thus, the resulting colonies arose from individual cells
and are as homogeneous as possible. Individual blue and white colonies
were picked and initially cultured in 2 ml of Frey broth containing
gentamicin, and aliquots were stored frozen at
80°C for future use.
To assess the activity of the lacZ reporter in the cell
population of each subclone that was stored at
80°C, cells from the
aliquot were passed through a 0.2-µm-pore-size filter and assayed on
X-Gal plates. The numbers of blue colonies and white colonies were
determined, and the percentage of colonies that were blue was
calculated. For this enumeration, colonies that were intensely blue
were recorded as blue and colonies that were either completely white or
only moderately blue were recorded as white. This approach was taken
because we reasoned that colonies arising from cells that failed to
produce LacZ would develop some blue color as lacZ was
switched from Off to On in some cells within the developing population
in the colony.
DNA analysis of subclones.
Genomic DNA was isolated from
50-ml cultures of representative subclones that had been stored at
80°C (16). The promoter region of the lacZ
reporter was amplified by PCR with the 5' M9 primer (see above) and the
lacZ primer, TTCCCAGTCACGACGTTGTAAAAC (Fig. 1).
PCR products were directly sequenced (without cloning) with the 3' M9
primer at the Iowa State University DNA Sequencing and Synthesis
Facility, Ames, Iowa. The sequences were aligned and analyzed by using
the MacVector nucleotide and protein sequence analysis software package
(version 6.01; Oxford Molecular Group Inc., Beaverton, Oreg.). For
Southern analysis, HindIII- digested genomic DNA
was electrophoresed on a 0.7% agarose gel, transferred to a nylon
membrane, and hybridized with the lacZ gene probe under normal (high-stringency) hybridization conditions. The lacZ
probe consisted of the 3-kb BamHI fragment described above,
radiolabeled with 32P by the random primer method as
described previously (5).
 |
RESULTS |
Phase-variable expression of the M9-lacZ reporter in
M. gallisepticum.
The M9-lacZ gene was
constructed such that the DNA fragment containing the promoter region
and coding for the first 22 amino acids of the M9 protein would be
fused in frame with the lacZ gene. When transformed into
E. coli, plasmid pCR2.1-M9.lacZ containing the
M9-lacZ reporter resulted in transformants that were blue when assayed on agar supplemented with X-Gal. Nucleotide sequence analysis of the M9-lacZ gene confirmed that no mutations had
been introduced during construction. From the nucleotide sequence, the
reporter was predicted to encode an M9-LacZ fusion protein of 1,039 amino acids.
The initial transformation of strain PG31 with pISM-M9.lacZ resulted in
gentamicin-resistant transformants at a frequency
of 10
5
transformants per CFU. pISM-M9.lacZ does not replicate in mycoplasmas,
and transformants could be obtained only if the Tn
4001 had
inserted
into the mycoplasma chromosome, as described previously
(
4).
The M9-
lacZ fusion gene that had been
incorporated into the Tn
4001 portion of pISM-M9.lacZ
consisted of a
lacZ gene combined in frame
with a 336-bp M9
gene fragment containing the GAA repeat region,
the transcription start
site, and the translation start codon.
Because the
lacZ gene
expression is controlled by the transcriptional
regulatory regions of
the M9 gene fragment to which it was fused,

-galactosidase activity
in the transformants reflected regulation
of
lacZ gene
expression by the M9 promoter. Representative examples
of blue
(
lacZ gene expressed) and white (
lacZ gene not
expressed)
colonies of
M. gallisepticum containing the
M9-
lacZ fusion gene
assayed on X-Gal plates are shown in
Fig.
3. From the initial
transformation
of PG31 with pISM-M9.lacZ, 20 transformants were
selected for further
study. The CFU counts from each of these
20 parent transformants were
determined on X-Gal plates to find
whether the M9-
lacZ gene
underwent phase variation resulting in
cell populations that gave rise
to both blue colonies expressing
lacZ and white colonies not
expressing
lacZ. CFU derived from
each of the initial
transformants exhibited a mixture of blue
and white colonies on X-Gal
plates. Transformant MGT-6 yielded
a nearly equal mixture of blue
(60%) and white (40%) colonies
and was chosen for further study by
pedigree analysis.

View larger version (111K):
[in this window]
[in a new window]
|
FIG. 3.
Representative photograph illustrating blue and white
colonies of M. gallisepticum assayed on X-Gal agar.
|
|
Subclones of MGT-6 were analyzed for up to five generations (Fig.
4). A first-generation blue
(LacZ
+) colony (6B3) was subcloned and found to give rise
to 77% blue-colony
progeny. A first-generation white
(LacZ

) colony (6W2) was subcloned and gave rise to only
14% blue colonies.
Thus, the blue/white phenotype was somewhat
unstable but for the
most part bred true, indicative of phase
variation. Subclones
of 6B3 and 6W2 were isolated, and these
second-generation subclones
also gave rise to a mixture of blue and
white colonies, as diagrammed
in Fig.
4. One lineage that was studied
switched from LacZ
+ (MGT-6) to LacZ

(6W2 and
6W2W2) and back to LacZ
+ (6W2W2B8 and 6W2W2B8B5) and back
to LacZ

again (6W2W2B8B5W1). Similarly, several
LacZ

subclones (6B3W1, 6B3W2, 6B3B16B1W1, and 6B3B16B1W2)
were independently
isolated from the LacZ
+ subclones MGT-6
and 6B3. The M9-
lacZ gene from subclones derived
from these
lineages was studied to investigate the mechanism of
variation in LacZ
activity.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Pedigree analysis of M. gallisepticum
containing the M9-lacZ reporter. For each of the analyzed
subclones, the percentage of progeny colonies that were scored as blue
are indicated. For subclones in which the nucleotide sequence of the M9
promoter region was determined, the number of trinucleotide GAA repeats
is indicated by (GAA)n.
|
|
Phase variation in M9-lacZ gene expression correlates
with variation in the GAA repeat region.
The promoter region of
the M9-lacZ reporter gene was PCR amplified as described in
Materials and Methods to generate a 376-bp product containing the GAA
tandem repeat region and the beginning of the lacZ coding
region. The primers used for PCR amplification would not amplify the
native M9 gene of PG31, because one of the primers was specific for
lacZ. The nucleotide sequence of each PCR product was
determined, and no sequence variation was observed except for the
length of the trinucleotide GAA repeat region. Subclones that gave rise
to predominantly blue colonies (e.g., the LacZ+ subclones
MGT-6, 6B3, 6B3B16B1, 6W2W2B8B5, and 6W2W2B8B7) invariably contained 12 copies of the GAA repeat. The LacZ
subclones never had 12 GAA repeats, sometimes having more than 12 repeats (16 repeats in 6B3W1
and 14 repeats in 6B3B16B1W2) and sometimes fewer (11 repeats in
6B3B16B1W1, 10 repeats in 6W2W2 and in 6W2W2B8B5W1, and only 5 repeats
in 6B3W2). Therefore, it appears that exactly 12 GAA repeats are
required for expression.
Because the M9-
lacZ gene is located on a transposable
element, it is possible that PG31 DNA sequences flanking the transposon
influence the expression of the reporter. Therefore, we determined
whether change in the expression status of the reporter gene was
associated with transposition to a new site in the genome. Genomic
DNAs
from transformant MGT-6 and representative subclones thereof
were
analyzed on Southern blots probed with
lacZ. A single
HindIII
fragment of 4 kb hybridized with the probe (Fig.
5). The
HindIII
fragment
that hybridized with
lacZ contains one of the
Tn
4001-mycoplasmal
DNA junction regions (Fig.
2B), and the
size of this fragment
would vary if Tn
4001 were to transpose
to a different site in
the chromosome. Because the size of the
hybridizing DNA fragment
was invariant, transposition of
Tn
4001 from its initial insertion
site in the MGT-6
chromosome to an alternative site did not occur
in the subclones that
were analyzed. Thus, the phase-variable
expression of the
lacZ reporter did not occur as a consequence
of
Tn
4001 transposition. We conclude that the phase-variable
expression
of M9-
lacZ gene is regulated by the length of the
GAA repeat region.

View larger version (83K):
[in this window]
[in a new window]
|
FIG. 5.
Southern analysis of mycoplasmal genomic DNAs probed
with lacZ. HindIII-digested chromosomal DNAs were probed
with the 3-kb BamHI lacZ fragment used to
construct pCR2.1-M9.lacZ. The DNA fragment from each transformant that
hybridized with the probe was 4 kb (the DNA fragment from 6W2W2B8B5W1
had an apparent mobility of slightly less than 4 kb due to smiling
effects evident from the ethidium bromide-stained gel). Analysis of the
parent strain PG31 served as a control to verify that the
lacZ probe did not hybridize to mycoplasmal DNA from cells
that had not been transformed.
|
|
 |
DISCUSSION |
Colonies of M. gallisepticum containing the
M9-lacZ reporter appear intensely blue, weakly blue, or
white on X-Gal plates. We have shown that intensely blue colonies are
composed predominantly of cells containing 12 GAA repeats in the
reporter gene while white colonies contain either more or fewer than 12 repeats. One might propose that colonies possessing a weakly blue
phenotype are composed of cells that produce a low level of LacZ due to an intermediate level of M9-lacZ gene expression. This does
not appear to be the case. The subcloning of weakly blue colonies did
not result in progeny with a weakly blue phenotype. Subclone analysis
of weakly blue colonies revealed a high degree of heterogeneity of cell
phenotypes consisting of some progeny that produced intensely blue
colonies and other progeny that produced white colonies. Our
interpretation is that M9-lacZ gene transcription is
all-or-nothing. With 12 GAA repeats, the gene is fully transcribed.
Without 12 repeats, we suggest that no transcription occurs. Therefore,
we disagree with the interpretation of experiments in which Northern and reverse transcription-PCR data were used to argue that multiple pMGA genes are simultaneously transcribed, with most genes (pMGA1.2, pMGA1.4, and pMGA1.8) being expressed at low levels and only a single
gene (pMGA1.1), containing 12 GAA repeats, being transcribed at a high
level (7). A more likely interpretation for the data is that
the only M9/pMGA genes that are transcribed are those that contain 12 GAA repeats. The low level of expression of pMGA1.2, pMGA1.4, and
pMGA1.8 as described by Glew et al. (7) would result from
subpopulations of cells in which these alternative pMGA genes happen to
contain 12 GAA repeats.
The GAA repeat region appears to act as a transcriptional switch
regulating the expression of each member of the M9/pMGA gene family.
The pMGA gene family is very large, and the phase-variable expression
of each family member may play an important role in immune avoidance.
The incorporation of antibodies specific for pMGA protein into the
growth medium results in cultures containing cells that fail to produce
pMGA (8, 15). The most likely explanation is that
pMGA-specific antibodies inhibit cell growth, conferring a growth
advantage on cells that fail to produce pMGA. Regulation of M9/pMGA
gene expression by the GAA repeat permits cell cultures to contain cell
subpopulations producing alternative pMGA proteins or in some cases
lacking pMGA protein altogether. Thus, an antibody response could not
effectively attack all cells within the population.
What is the mechanism by which the GAA repeats regulate pMGA gene
expression? Mycoplasmas are thought to possess only a single
factor
analogous to the eubacterial general factor
A. However, the region
upstream of the transcription start site of the M9/pMGA genes lacks
significant sequence similarity to the well-defined consensus
10
(TATAAT) and
35 (TTGACA)
A recognition
sequences (3). Thus, the failure of most pMGA genes (those
lacking 12 GAA repeats) to be transcribed is understandable. The
mechanism by which genes containing 12 GAA repeats are transcribed
remains to be elucidated. Perhaps M9/pMGA transcription uses an
activator similar to the TRAP system of Bacillus subtilis,
in which tryptophan biosynthesis is regulated by 11 copies of a (G/U)AG
repeat (1). However, the (G/U)AG repeats are in the
trp leader transcript, and TRAP acts by binding to this RNA.
The GAA repeats of the M9/pMGA genes are upstream of the putative
transcription start site (7). M9/pMGA RNA transcripts would
lack the GAA repeat region, and regulation of gene expression is
predicted to occur by binding of a positive regulator to the GAA repeat
region of the DNA. This putative activator might bind to
single-stranded GAA repeat DNA, because it has recently been shown that
GAA tandem repeats near the physiological pH will form a triple-helix
structure in which the TTC strand folds onto either side of the same
GAA strand, leaving the remaining portion of the GAA strand not base
paired (13). A single-stranded GAA repeat region may be able
to wrap around an activator protein similarly to how the repeat portion of the trp leader transcript binds to TRAP.
 |
ACKNOWLEDGMENTS |
This work was supported by the U.S. Department of Agriculture
National Research Initiative Competitive Grants Program (grant 93-37204-9113) and by Auburn University College of Veterinary Medicine
(grant ALAV 304).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pathobiology, College of Veterinary Medicine, Auburn University,
Auburn, AL 36849. Phone: (334) 844-4953. Fax: (334) 844-4955. E-mail: pananvs{at}vetmed.auburn.edu.
Editor:
P. E. Orndorff
 |
REFERENCES |
| 1.
|
Babitzke, P.
1997.
Regulation of tryptophan biosynthesis: Trp-ing the TRAP or how Bacillus subtilis reinvented the wheel.
Mol. Microbiol.
26:1-9[CrossRef][Medline].
|
| 2.
|
Baseggio, N.,
M. D. Glew,
P. F. Markham,
K. G. Whithear, and G. F. Browning.
1996.
Size and genomic location of the pMGA multigene family of Mycoplasma gallisepticum.
Microbiology
142:1429-1435[Abstract/Free Full Text].
|
| 3.
|
Busby, S., and R. H. Ebright.
1994.
Promoter structure, promoter recognition, and transcription activation in prokaryotes.
Cell
79:743-746[Medline].
|
| 4.
|
Cao, J.,
P. A. Kapke, and F. C. Minion.
1994.
Transformation of Mycoplasma gallisepticum with Tn916, Tn4001, and integrative plasmid vectors.
J. Bacteriol.
176:4459-4462[Abstract/Free Full Text].
|
| 5.
|
Dybvig, K.,
R. Sitaraman, and C. T. French.
1998.
A family of phase-variable restriction enzymes with differing specificities generated by high-frequency gene rearrangements.
Proc. Natl. Acad. Sci. USA
95:13923-13928[Abstract/Free Full Text].
|
| 6.
|
Frey, M. L.,
R. P. Hanson, and D. P. Anderson.
1968.
A medium for isolation of avian mycoplasmas.
Am. J. Vet. Res.
29:2163-2171[Medline].
|
| 7.
|
Glew, M. D.,
P. F. Markham,
G. F. Browning, and I. D. Walker.
1995.
Expression studies on four members of the pMGA multigene family in Mycoplasma gallisepticum S6.
Microbiology
141:3005-3014[Abstract/Free Full Text].
|
| 8.
|
Glew, M. D.,
N. Baseggio,
P. F. Markham,
G. F. Browning, and I. D. Walker.
1998.
Expression of the pMGA genes of Mycoplasma gallisepticum is controlled by variation in the GAA trinucleotide repeat lengths within the 5' noncoding regions.
Infect. Immun.
66:5833-5841[Abstract/Free Full Text].
|
| 9.
|
Heydreyda, C. T.,
K. K. Lee, and D. C. Krause.
1993.
Transformation of Mycoplasma pneumoniae with Tn4001 by electroporation.
Plasmid
30:170-175[CrossRef][Medline].
|
| 10.
|
Hwang, Y. S.,
V. S. Panangala,
C. R. Rossi,
J. J. Giambrone, and L. H. Lauerman.
1989.
Monoclonal antibodies that recognize specific antigens of Mycoplasma gallisepticum and Mycoplasma synoviae.
Avian Dis.
33:42-52[CrossRef][Medline].
|
| 11.
|
Knudtson, K. L., and F. C. Minion.
1993.
Construction of Tn 4001 lac derivatives to be used as promoter probe vectors in mycoplasmas.
Gene
137:217-222[CrossRef][Medline].
|
| 12.
|
Liu, L.,
D. M. Payne,
V. L. van Santen,
K. Dybvig, and V. S. Panangala.
1998.
A protein associated with monoclonal antibody-mediated agglutination of Mycoplasma gallisepticum is a member of the pMGA family.
Infect. Immun.
66:5570-5575[Abstract/Free Full Text].
|
| 13.
|
Mariappan, S. V. S.,
P. Catasti,
L. A. Silks III,
E. M. Bradbury, and G. Gupta.
1999.
The high-resolution structure of the triplex formed by the GAA/TTC triplet repeat associated with Friedreich's ataxia.
J. Mol. Biol.
285:2035-2052[CrossRef][Medline].
|
| 14.
|
Markham, P. F.,
M. D. Glew,
K. G. Whithear, and I. D. Walker.
1993.
Molecular cloning of a member of the gene family that encodes pMGA, a hemagglutinin of Mycoplasma gallisepticum.
Infect. Immun.
61:903-909[Abstract/Free Full Text].
|
| 15.
|
Markham, P. F.,
M. D. Glew,
G. F. Browning,
K. G. Whithear, and I. D. Walker.
1998.
Expression of two members of the pMGA gene family of Mycoplasma gallisepticum oscillates and is influenced by pMGA-specific antibodies.
Infect. Immun.
66:2845-2853[Abstract/Free Full Text].
|
| 16.
|
Voelker, L. L.,
K. E. Weaver,
L. J. Ehle, and L. R. Washburn.
1995.
Association of lysogenic bacteriophage MAV1 with virulence in Mycoplasma arthritidis.
Infect. Immun.
63:4016-4023[Abstract].
|
Infection and Immunity, February 2000, p. 871-876, Vol. 68, No. 2
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Vasconcelos, A. T. R., Ferreira, H. B., Bizarro, C. V., Bonatto, S. L., Carvalho, M. O., Pinto, P. M., Almeida, D. F., Almeida, L. G. P., Almeida, R., Alves-Filho, L., Assuncao, E. N., Azevedo, V. A. C., Bogo, M. R., Brigido, M. M., Brocchi, M., Burity, H. A., Camargo, A. A., Camargo, S. S., Carepo, M. S., Carraro, D. M., de Mattos Cascardo, J. C., Castro, L. A., Cavalcanti, G., Chemale, G., Collevatti, R. G., Cunha, C. W., Dallagiovanna, B., Dambros, B. P., Dellagostin, O. A., Falcao, C., Fantinatti-Garboggini, F., Felipe, M. S. S., Fiorentin, L., Franco, G. R., Freitas, N. S. A., Frias, D., Grangeiro, T. B., Grisard, E. C., Guimaraes, C. T., Hungria, M., Jardim, S. N., Krieger, M. A., Laurino, J. P., Lima, L. F. A., Lopes, M. I., Loreto, E. L. S., Madeira, H. M. F., Manfio, G. P., Maranhao, A. Q., Martinkovics, C. T., Medeiros, S. R. B., Moreira, M. A. M., Neiva, M., Ramalho-Neto, C. E., Nicolas, M. F., Oliveira, S. C., Paixao, R. F. C., Pedrosa, F. O., Pena, S. D. J., Pereira, M., Pereira-Ferrari, L., Piffer, I., Pinto, L. S., Potrich, D. P., Salim, A. C. M., Santos, F. R., Schmitt, R., Schneider, M. P. C., Schrank, A., Schrank, I. S., Schuck, A. F., Seuanez, H. N., Silva, D. W., Silva, R., Silva, S. C., Soares, C. M. A., Souza, K. R. L., Souza, R. C., Staats, C. C., Steffens, M. B. R., Teixeira, S. M. R., Urmenyi, T. P., Vainstein, M. H., Zuccherato, L. W., Simpson, A. J. G., Zaha, A.
(2005). Swine and Poultry Pathogens: the Complete Genome Sequences of Two Strains of Mycoplasma hyopneumoniae and a Strain of Mycoplasma synoviae. J. Bacteriol.
187: 5568-5577
[Abstract]
[Full Text]
-
Otsuka, Y., Parniewski, P., Zwolska, Z., Kai, M., Fujino, T., Kirikae, F., Toyota, E., Kudo, K., Kuratsuji, T., Kirikae, T.
(2004). Characterization of a Trinucleotide Repeat Sequence (CGG)5 and Potential Use in Restriction Fragment Length Polymorphism Typing of Mycobacterium tuberculosis. J. Clin. Microbiol.
42: 3538-3548
[Abstract]
[Full Text]
-
van der Woude, M. W., Baumler, A. J.
(2004). Phase and Antigenic Variation in Bacteria. Clin. Microbiol. Rev.
17: 581-611
[Abstract]
[Full Text]
-
Napierala, M., Dere, R., Vetcher, A., Wells, R. D.
(2004). Structure-dependent Recombination Hot Spot Activity of GAA{middle dot}TTC Sequences from Intron 1 of the Friedreich's Ataxia Gene. J. Biol. Chem.
279: 6444-6454
[Abstract]
[Full Text]
-
Papazisi, L., Gorton, T. S., Kutish, G., Markham, P. F., Browning, G. F., Nguyen, D. K., Swartzell, S., Madan, A., Mahairas, G., Geary, S. J.
(2003). The complete genome sequence of the avian pathogen Mycoplasma gallisepticum strain Rlow. Microbiology
149: 2307-2316
[Abstract]
[Full Text]
-
Napierala, M., Parniewski, P., Pluciennik, A., Wells, R. D.
(2002). Long CTG{middle dot}CAG Repeat Sequences Markedly Stimulate Intramolecular Recombination. J. Biol. Chem.
277: 34087-34100
[Abstract]
[Full Text]
-
Liu, L., Panangala, V. S., Dybvig, K.
(2002). Trinucleotide GAA Repeats Dictate pMGA Gene Expression in Mycoplasma gallisepticum by Affecting Spacing between Flanking Regions. J. Bacteriol.
184: 1335-1339
[Abstract]
[Full Text]
-
Metzgar, D., Liu, L., Hansen, C., Dybvig, K., Wills, C.
(2002). Domain-Level Differences in Microsatellite Distribution and Content Result from Different Relative Rates of Insertion and Deletion Mutations. Genome Res
12: 408-413
[Abstract]
[Full Text]
-
Teachman, A. M., French, C. T., Yu, H., Simmons, W. L., Dybvig, K.
(2002). Gene Transfer in Mycoplasma pulmonis. J. Bacteriol.
184: 947-951
[Abstract]
[Full Text]
-
Shen, X., Gumulak, J., Yu, H., French, C. T., Zou, N., Dybvig, K.
(2000). Gene Rearrangements in the vsa Locus of Mycoplasma pulmonis. J. Bacteriol.
182: 2900-2908
[Abstract]
[Full Text]