TEXT

Top Abstract Text References

Exopolysaccharides of pathogenic bacteria, including lipopolysaccharides (LPS), lipooligosaccharides, and capsules, play a major role in virulence (reviewed in references 9, 11, 29, and 32). We are interested in identifying enzymes that are conserved amongst various exopolysaccharide biosynthetic pathways in order to provide targets for the rational design of inhibitor molecules. WbpM was previously identified as being a highly conserved and essential protein for the biosynthesis of the O antigens of serotypes O5 and O6 of Pseudomonas aeruginosa, although these molecules have different sugar compositions (5, 7). A gapped BLASTP search (3) of the GenBank database revealed a large number of WbpM homologues in both gram-negative and gram-positive bacteria, as well as in the Archeae (Table 1). These homologues could be divided into two subfamilies. Subfamily 1, including WbpM, contains large (approximately 600 amino acids) proteins with two distinct domains, with an NAD⁺ or NADP⁺ binding motif in the C terminus, and often a second motif in the N terminus (7). The other subfamily, embodied by the product of the Helicobacter pylori HP0840 gene (FlaA1) (36), consists of smaller (between 300 and 400 amino acids) proteins that are homologous to the C-terminal half of the larger proteins in the other subfamily (7) (Table 1). Interestingly, some species of bacteria contain examples of both subfamilies. In the capsular biosynthestic clusters of Staphylococcus aureus serotypes 5 and 8, contiguous large (capD) and small (capE) wbpM homologues are present in the same operon (29, 30, 31), whereas S. aureus serotype 1 has only capD (21). P. aeruginosa serotype O11 has recently been shown to contain both WbpM and a subfamily 2 homologue, WbjB (10).

Although the specific function of these proteins has not yet been demonstrated at the biochemical level, they can be shown by complementation to be functionally homologous. The wbpM homologues from Bordetella pertussis strain BP536 (1), S. aureus serotype 8 (29), and H. pylori strain 26695 (36) were individually cloned into the broad-host-range vector, pUCP26 (37) (Table 2) and used to transform a P. aeruginosa O5 wbpM::Gm^r mutant, which cannot synthesize B-band LPS (7). Silver-stained sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western immunoblot analyses showed that the P. aeruginosa wbpM::Gm^r mutant was complemented for O-antigen production by wlbL from B. pertussis (1), cap8D of S. aureus (29), and, partially, by HP0840 of H. pylori (36) (Fig. 1). The ability of HP0840 to partly complement a wbpM mutation demonstrates that the subfamily 2 homologues have activities related to those of subfamily 1. These data support the hypothesis previously stated by members of our group (7) that the larger proteins may have arisen through a fusion between two contiguous open reading frames, with the carboxy-terminal region, corresponding to subfamily 2, containing the putative active site. Further characterization of the larger proteins will permit the identification of the minimum structure required for function in P. aeruginosa.

View larger version (54K): [in this window] [in a new window]   FIG. 1.   Complementation of a serotype O5 B-band-deficient mutant. Plasmids (see Table 2) containing wbpM or its homologues from S. aureus serotype 8 (capD), H. pylori 26695 (HP0840) and B. pertussis (wlbL) were used to complement a wbpM::Gmr mutant of P. aeruginosa PAO1 (7). B-band LPS prepared by the proteinase K digestion method of Hitchcock and Brown (15) was separated on SDS-PAGE, transferred to nitrocellulose, and detected using monoclonal antibody 18-19, which recognizes the O5 O unit (18). The fastest-migrating band represents the core plus one O unit, the most abundant species.

All 20 serotypes of P. aeruginosa contain wbpM, despite the fact that they produce structurally distinct O antigens (7, 25). Therefore, it was of interest to understand the role of WbpM in O-antigen synthesis in P. aeruginosa and to determine whether it is essential in serotypes other than O5 and O6 (5, 7). Members of our group proposed previously (7) that WbpM could be a C4 epimerase required for the conversion of UDP-N-acetyl-D-glucosamine (UDP-D-GlcNAc) to UDP-N-acetyl-D-galactosamine (UDP-D-GalNAc). However, results from studies on the biosynthesis of the UDP-D-GalNAc residues required for serotype O6 O-antigen synthesis showed that among the proteins encoded by the O-antigen biosynthesis genes, WbpP, and not WbpM, is the C4 epimerase involved in conversion of UDP-D-GlcNAc to UDP-D-GalNAc (5). Instead, WbpM is likely involved in the formation of the 6-deoxyaminohexose UDP-N-acetyl-D-quinovosamine (UDP-D-QuiNAc) (or UDP-6-deoxy-D-GlcNAc) residues of the serotype O6 O antigen. In serotype O5, the UDP-D-QuiNAc product of WbpM activity could be epimerized at C4 to form UDP-N-acetyl-D-fucosamine (UDP-D-Fuc2NAc) (or UDP-6-deoxy-D-GalNAc) by the UDP-galactose-4-epimerase (GalE) homologue, WbpK. This hypothesis is supported by the observation that WbpK is able to partly complement a Salmonella enterica serovar Typhimurium galE mutant (M. Matewish, H. L. Rocchetta, L. L. Burrows, R. Rahim, K. Pigeon, and J. S. Lam, Abstr. 60th N. Am. Cyst. Fibros. Meet., abstr. 374, 1998), suggesting it possesses C4 epimerase activity.

To further investigate the role of WbpM in synthesis of P. aeruginosa O antigens containing D-QuiNAc and its derivatives, we generated nonpolar chromosomal wbpM::Gm^r mutations, using previously described methodology (7), in serotypes O3, O10, O15, and O17. These serotypes have primary O-antigen structures that are distinct from those of serotypes O5 and O6 (Table 3). The O antigen of serotype O10 contains D-QuiNAc, while serotype O3 contains a D-QuiNAc derivative, bacillosamine (4-amino-D-QuiNAc; shown in bold in Table 3). In contrast, the O antigens of O15 and O17 contain neither D-QuiNAc nor D-FucNAc. Briefly, a gentamicin-resistance cassette containing its own promoter sequence was inserted within a unique XhoI site approximately in the middle of the 1.9-kb wbpM gene of serotype O5, and the mutated gene was introduced first into the chromosome of serotype O5 to demonstrate that the mutation abrogated O-antigen synthesis (data not shown). The wbpM::Gm^r construct was then introduced in the chromosomes of serotypes O3, O10, O15, and O17 by homologous recombination. To demonstrate the correct replacement of wild-type wbpM with the knockout construct, PCR using wbpM-specific primers flanking the XhoI site was performed. Upon agarose gel analysis, amplicons from the mutants were approximately 1 kb larger than those of the parental serotype strains, corresponding to the size of the Gm^r cassette (Fig. 2A). Silver-stained SDS-PAGE analysis of LPS from the O3, O10, O15, and O17 parent strains and their isogenic wbpM mutants showed that synthesis of the serotype O3 and O10 O antigens containing 4-amino-D-QuiNAc {4-amino-2,4,6-trideoxy-N-acetylglucosamine [Bac(2NAc4N)]} and D-QuiNAc, respectively (Table 3), was abrogated by the loss of WbpM (Fig. 2B). The deficiency in B-band O-antigen production was restored in the serotype O3 and O10 wbpM::Gm^r mutants by complementation with the wbpM_O5 gene in trans (Fig. 2B). In contrast, synthesis of the serotype O15 and O17 O antigens that contain neither D-QuiNAc nor D-Fuc2NAc was not affected by the wbpM mutation (Fig. 2B). These data are consistent with our previous results (5, 7) showing wbpM is essential for the synthesis of the serotype O6 and O5 O antigens, containing D-QuiNAc and its C4 epimer D-FucNAc, respectively.

View larger version (51K): [in this window] [in a new window]   FIG. 2.   Analysis of wbpM::Gmr mutants of selected P. aeruginosa serotype strains. (A) Correct insertion of the gentamicin resistance cassette within wbpM was ascertained by PCR using the wbpM-specific primers flanking the unique XhoI site (upstream primer, 5' AGGGTGGCTATCTATGGCGCGGGG 3'; downstream primer, 5' AACGGGTGATGCTCGGGTGGGTGA 3'). The mutants showed a shift in the size of the amplicon of approximately 1 kb, corresponding to the size of the Gmr cassette. (B) LPS prepared from selected serotype strains, their wbpM::Gmr mutants, and their complemented mutants was analyzed by silver-stained SDS-PAGE. Mutants lacking B-band O antigen were complemented with the serotype O5 wbpM gene on pFV163-26. It is not clear why the O17 wbpM mutant produces somewhat less B-band LPS than the wild-type strain, but the banding pattern is very similar and its O antigen is genuine O17 as determined by slide agglutination with O17-specific antiserum (data not shown).

In summary, we have shown that WbpM is a member of a large and growing family of functionally homologous proteins that are involved in synthesis of exopolysaccharides in both gram-positive and gram-negative bacteria. WbpM is thought to play a role in the synthesis of the deoxyhexose, UDP-D-QuiNAc, and its derivatives, including UDP-D-Bac(2NAc4N) and UDP-D-FucNAc. Work is underway in our laboratory to provide biochemical evidence for the role of WbpM in the biosynthesis of these unusual sugars. Since homologues of WbpM occur in a number of medically significant bacteria, these proteins may be of interest as therapeutic targets.