Previous Article | Next Article ![]()
Infection and Immunity, March 2000, p. 1048-1053, Vol. 68, No. 3
Mikrobielle Genetik, Universität
Tübingen, 72076 Tübingen, Germany
Received 6 July 1999/Returned for modification 30 August
1999/Accepted 23 November 1999
The physiological significance of the accessory gene regulator
(agr) system of Staphylococcus epidermidis was
investigated by construction of an agr deletion mutant via
allelic replacement with a spectinomycin resistance cassette. Sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis
showed that the protein pattern was strongly altered in the
mutant; the amounts of most surface proteins were higher, whereas
the amounts of most exoproteins were lower. The agr
system of S. epidermidis thus appears to have an important
impact on growth phase-dependent protein synthesis as has been
shown for Staphylococcus aureus. The activity of the exoenzymes lipase and protease, assumed to be involved in
staphylococcal pathogenicity, was investigated by agar diffusion assays
and SDS-PAGE activity staining. A general reduction of these enzyme
activities in the agr mutant was found. The difference in
overall lipase activity was small, but zymographic analysis suggested a
clear defect in lipase processing in the agr mutant.
In recent years Staphylococcus
epidermidis has emerged as one of the most important pathogens in
nosocomial infections (11). Effective antibiotic treatment
of S. epidermidis is difficult because of the slime capsule
which surrounds biofilm-forming colonies of this bacterium and which
can barely be penetrated by many antibiotics. The situation
has become even more severe because of the appearance of
multiresistant and vancomycin-resistant S. epidermidis
strains (26). Although these problems have been
recognized for a number of years, the identification of S. epidermidis virulence factors and the investigation of their
regulation has not kept pace with the research done in
Staphylococcus aureus. Virtually nothing is known about the
regulation of potential virulence determinants in S. epidermidis.
The S. aureus accessory gene regulator (agr)
system is responsible for the growth-phase-dependent regulation of
virulence factors and has been extensively investigated (14,
17). We have recently identified the S. epidermidis
agr system, whose gene structure and sequence is very similar to
that of S. aureus and which may therefore play a role
comparable to that in S. aureus. The agr
systems of S. aureus and of S. epidermidis,
approximately 3.5 kb in size, comprise the agrA,
agrC, agrD, and agrB genes, which are cotranscribed (RNAII), and the gene for the effector molecule
of the agr system, RNAIII, which also encodes the gene for
delta-toxin (hld). RNAIII controls expression of
target genes in an unknown manner (20, 22, 24). The
agr system is activated during the transition from the
exponential growth phase to the stationary phase by an autoregulatory
mechanism involving a modified pheromone peptide (14, 22).
The agr system in S. aureus downregulates the
synthesis of many surface proteins, and upregulates the synthesis
of many exoproteins at the onset of the stationary growth
phase. Both groups of proteins mainly comprise factors that
contribute to the pathogenic potential of S. aureus. To
date, agr-regulated targets of S. epidermidis, which are likely to include virulence determinants, have not yet been identified.
The most important virulence factor of S. epidermidis is
assumed to be biofilm formation on indwelling medical devices
(reviewed in references 7 and
8). In association with sepsis or wound infection of
immunocompromised patients (6; A. Berges, J. Gutierrez-Cebollada, J. M. Garces, and O. Pallas, Letter,
Enferm. Infecc. Microbiol. Clin. 9:383-384, 1991), some
other determinants might also contribute to the virulence of
S. epidermidis. These determinants include proteases,
delta-toxin, lipases, and unknown bacterial components.
Here we report the construction of an agr deletion mutant of
an S. epidermidis wild-type strain and the effects of the
agr deletion on protein synthesis in general and
virulence factor production in particular. The expression of two
important virulence-determining exoproteins, lipase and
protease, was analyzed in detail.
Bacterial strains, plasmids, and growth conditions.
The
bacterial strains and plasmids used in this study are listed in Table
1. S. epidermidis cells were
grown in B medium (1% tryptone [Difco], 0.5% yeast extract [Gibco
BRL], 0.5% NaCl, 0.1% K2HPO4, 0.1%
glucose). Antibiotics were used at the following concentrations:
chloramphenicol, 10 µg/ml; spectinomycin, 150 µg/ml; and
ampicillin, 100 µg/ml. Cultures were generally incubated at 37°C
with shaking at 140 rpm, unless otherwise noted.
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Construction and Characterization of an
agr Deletion Mutant of Staphylococcus
epidermidis
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Bacterial strains and plasmids used
Molecular cloning techniques, transformation, and DNA sequencing. DNA manipulation, isolation of plasmid DNA, and transformation of E. coli were performed by using standard procedures (29). Staphylococcal plasmid DNA was prepared by using the Qiagen Plasmid Midi Kit (Qiagen, Hilden, Germany). The manufacturer's instructions were followed except that the cells were incubated for 15 min at 37°C at 37°C in 4 ml of P1 buffer containing 25 µg of lysostaphin (Sigma, St. Louis, Mo.) per ml before buffer P2 was added. Chromosomal DNA was isolated according to the procedure of Marmur (16). Enzymes for molecular cloning were obtained from Boehringer Mannheim (Mannheim, Germany), Gibco BRL, and Amersham Pharmacia Biotech (Freiburg, Germany); incubation conditions were as recommended by the suppliers. PCR was performed with Vent polymerase (New England Biolabs) as recommended by the manufacturer. The primers for PCR were as follows: cvIaBam, GGAAAAGGGCAAGGATCCACTAGCGTTTAG; cvIbSph, GAAGAAAAGCCAATGGCATGCGCTTTACGAAC; cvIIaSal, CAAGCCGTGAGTCGACCCCAAGCTCACGG; and cvIIbHind, GTAGTTACCATGAAAGCTTAGCCCGTA. Restriction sites are underlined. PCR primers were purchased from Interactiva (Ulm, Germany) or from MWG-Biotech (Ebersberg, Germany).
DNA was sequenced by using fluorescent-labeled primers and a LI-COR sequencer (MWG-Biotech). The nucleotide sequences were analyzed by using the program MacDNASIS Pro (Hitachi Software Engineering, San Bruno, Calif.).Construction of plasmid pBT
agr and homologous
recombination.
In order to delete the agr genes in
S. epidermidis Tü3298, DNA fragments of 821 bp (with
PCR primers cvIaBam and cvIbSph) and 1,235 bp (with PCR primers
cvIIaSal and cvIIbHind) upstream and downstream of the agr
region were amplified by PCR and digested with
BamHI/SphI and
SalI/HindIII, respectively. The two DNA
fragments were inserted into the polylinker region of the
temperature-sensitive shuttle vector pBT2 together with a 1,277-bp
SphI/SalI-digested fragment encoding the
spectinomycin adenyltransferase gene (spc) from
Tn554 (18), as shown in Fig. 1. The fidelity of
the sequence of PCR-amplified regions was proven by nucleotide
sequencing. S. epidermidis Tü3298 was transformed by
electroporation with the resulting plasmid pBT
agr (2).
The recombination procedure has been described recently in detail
(4). The proper integration of spc was verified
by direct sequencing of the chromosomal DNA at the borders of the
PCR-derived regions (25).
Lipase assay. Lipase activity was determined by an agar plate assay with Ca2+-containing tributyrylglycerol-basic agar (Merck) containing 1% Tween 20. Overnight precultures of S. epidermidis and S. aureus strains grown in B medium at 37°C were diluted 1:100 in B medium and incubated for 12 h at 37°C with shaking at 140 rpm. Then, 10-ml supernatants of 12-h bacterial cultures were lyophylized; the lyophilysate was dissolved in 2 ml of 20 mM Tris-HCl (pH 8.0) and passed through 0.22-µm-pore-size filters. Next, 25 µl was applied four times onto filters, which were air dried and placed on Tween 20 agar plates (19). Plates were then incubated at 37°C for 24 h.
Protease assay. Protease activity was determined by an agar plate assay. The test agar contained 1% skim milk, 1% tryptone (Difco), 0.5% yeast extract (Gibco BRL), 0.5% NaCl, and 1.5% agar. Bacterial strains were grown overnight on the agar plates at 37°C.
Protein isolation and SDS-PAGE. Exoproteins of 12-h bacterial cultures were isolated by precipitation with a 1/9 volume of trichloroacetic acid. Pellets were dissolved in 7 M urea-100 mM Tris-HCl (pH 8.0). Surface proteins were isolated by incubating the cells with 25 µg of lysostaphin/ml (Sigma, St. Louis, Mo.) for 15 min at 37°C and subsequently centrifuging at 19,000 × g for 10 min. Surface-associated proteins were isolated by boiling cells at 100°C for 5 min and subsequently centrifuging them at 19,000 × g for 10 min. Proteins were separated by Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) as described by Schägger and von Jagow (30) using a Bio-Rad Protean II XI chamber and a separation length of 16 cm. Molecular mass standards were purchased from Gibco BRL.
Zymographic analysis of protease and lipase activity. SDS-PAGE was performed as outlined above, but under nonreducing conditions. After electrophoresis, gels were washed twice in 20% isopropanol for 15 min and then twice in water for 30 min. Gels were then laid on 1% agarose plates containing 50 mM Tris-HCl (pH 7.8), 1 mM CaCl2, and 1% casein (according to Hammersten; for protease detection) or 1% Tween 20 (for lipase detection) and incubated at 37°C overnight.
Delta-toxin detection by HPLC. The amount of delta-toxin in culture filtrates was determined by analytical high-performance liquid chromatography (HPLC) on a Kontron HPLC system with Kroma System 2000 software as described previously (23). A Pharmacia Resource PHE 1-ml column was eluted with 15 column volumes of a linear gradient (0 to 100% of B in A [A, 0.1% trifluoroacetic acid in water; B, 0.1% trifluoroacetic acid in acetonitrile]). The detection wavelength was 280 nm.
| |
RESULTS |
|---|
|
|
|---|
Deletion of the agr system of S. epidermidis.
We have previously published the sequence of the
agr genes of S. epidermidis. The genes have high
sequence similarity to those of the agr system of S. aureus and Staphylococcus lugdunensis (22).
To investigate its function in S. epidermidis, we deleted the agr genes in S. epidermidis Tü3298 by
homologous recombination. First, two DNA fragments upstream and
downstream of the agr region were amplified by PCR
(Fig. 1). The two amplified DNA
fragments and an appropriate antibiotic resistance marker
(spectinomycin adenyltransferase gene [spc]
from Tn554 [18]) were
cloned into the polylinker region of the temperature-sensitive shuttle
plasmid pBT2 (4), yielding plasmid pBT
agr. This
plasmid was sequenced in order to prove (i) that the two PCR fragments
did not harbor any polymerase-introduced mutation and (ii) that the
orientation of the antibiotic resistance marker was correct. S. epidermidis Tü3298 was transformed with plasmid pBT
agr by
electroporation (2). Transformants were selected for
chloramphenicol and spectinomycin resistance. The procedure used for
homologous recombination was that described by Brückner et al.
(4), and we then screened for spectinomycin-resistant and
chloramphenicol-sensitive clones.
|
Production of exoproteins, surface-associated proteins,
and surface proteins.
The general influence of the
agr system of S. epidermidis on protein
synthesis was investigated by SDS-PAGE analysis of exoprotein and surface protein samples from stationary-phase cultures. The agr deletion in S. epidermidis TüF38
resulted in a pleiotropic alteration of the pattern of
exoproteins, surface-associated proteins (prepared by
boiling with SDS), and surface proteins (prepared by treatment with
lysostaphin) on SDS-polyacrylamide gels, compared to the parental
strain S. epidermidis Tü3298 (Fig.
2). Treatment with SDS releases
noncovalently attached proteins from the cell surface, including,
for example, many autolysins (13, 32). Lysostaphin releases
covalently linked proteins from the cell by cleaving within the
pentapeptide crossbridges of the staphylococcal peptidoglycan
(31).
|
Regulation of specific exoenzyme activities.
S.
epidermidis does not produce exotoxins as does S. aureus. Also, little is known about the specific exoenzyme
activities of S. epidermidis. We focused on lipase and
protease activity because it is known that lipase and protease are
important virulence factors of S. aureus (9,
10). This might also be the case in S. epidermidis. We
tested the activities of lipase and protease in the supernatant of the
S. epidermidis wild type and the agr mutant
strain by agar plate assays. We also compared the activities of
S. epidermidis to the activities of an S. aureus
agr+ strain (RN6390) and an agr mutant
strain (RN6911). On protease test plates (Fig.
3A), S. aureus showed a
generally higher protease activity than S. epidermidis, and
the agr+ strain exhibited clearly higher
activity than the agr mutant strain in both species. On
lipase test plates, effects could hardly be seen in S. epidermidis because of the low lipase activity of the test strain.
Therefore, supernatants were concentrated by repetitively applying
aliquots to filters, which were air dried between each application and
then laid on test plates. Activities in S. aureus were
generally higher than in S. epidermidis, but in both cases
the agr+ strains showed larger lysis zones than
the agr mutant strains (Fig. 3B).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
In S. aureus, many virulence factors are regulated by a global regulatory quorum-sensing system called agr for accessory gene regulator (20, 24). We have previously shown that the agr system is present in S. epidermidis, that its genes show strong sequence similarity to those in S. aureus, and that the expression of the agr system in S. epidermidis is growth phase dependent (22).
The aims of the present study were to investigate which phenotypic factors of S. epidermidis are regulated by the agr system and to determine what influence agr has on the expression of S. epidermidis virulence factors. We constructed an agr mutant (TüF38) in which the entire agr gene cluster was replaced by a spectinomycin resistance cassette. Correct insertion was proven by direct sequencing of the flanking regions; loss of functionality of the agr system was additionally shown by the inability of the mutant to synthesize delta-toxin. The agr system of S. aureus affects the synthesis of many exoproteins (e.g., toxic shock syndrome toxin 1, alpha-toxin, and tissue-degrading enzymes) and surface proteins (e.g., protein A, coagulase, and fibronectin-binding proteins) in a growth phase-dependent manner (12, 15, 24, 27). Samples prepared from stationary-phase cultures of the S. epidermidis TüF38 agr deletion mutant showed a pronounced alteration in the production pattern on the SDS-polyacrylamide gels of exoproteins, surface-associated proteins, and surface proteins compared to that of the isogenic strain S. epidermidis Tü3298. As in S. aureus, the agr system in S. epidermidis appears to be responsible for the upregulation of many exoproteins and the downregulation of many surface-bound and surface-associated proteins in the stationary growth phase, although a small number of proteins seem to be under the opposite control.
Lipase and protease activities are involved in tissue damage and the inflammatory host response (9, 10). Proteases can also play a role in the degradation of host peptide signaling factors, such as neutrophile defensins (33), platelet microbiocidal proteins (35), and antibodies (e.g., degradation of immunoglobulin G by V8 serine protease of S. aureus [33]). These two degradative exoenzymes clearly contribute to the destruction of tissue proteins and enhanced invasiveness (9, 10).
In our assays, a clear reduction of protease activity in the S. epidermidis agr mutant strain was detected, which by zymographic analysis could be attributed exclusively to the reduced expression of a strong proteolytic activity with an apparent molecular mass of about 34 kDa. The accordance of molecular size and the inhibition of the proteolytic activity by EDTA strongly suggest that this activity is due to the published metalloprotease of S. epidermidis (34).
Reduced lipolytic activity of the agr mutant seems to be mainly due to the strongly reduced processing of lipase to the mature form. This might be due to reduced production of the processing protease. The lipolytic activity in the agr mutant is still relatively high because the pro-form of staphylococcal lipases exhibits considerable activity (10). In S. hyicus, growth phase-dependent processing has been demonstrated to be performed by a 34-kDa metalloprotease. It is homologous to the S. epidermidis 34-kDa metalloprotease (34), which as discussed above is most likely the protease we detected in the zymographic analysis. This protease is therefore very likely the one that cleaves the lipase pro-form. The extreme inhibition of the processing of the lipase pro-form in the agr mutant accordingly is in agreement with the fact that the putative processing protease was only detectable in the wildtype, but not in the agr mutant. The agr system thus seems to be responsible for the appearance of mature lipase in stationary growth phase, which is managed by upregulation of the expression of the processing protease. Whether the lipase expression is also regulated on a transcriptional level still remains to be shown. However, although the relation between the activity of the pro-form and the mature form of the lipase is not known, the high activity of the pro-form in the agr mutant does not suggest that there is a strong regulation on the transcriptional level or even any regulation at all.
The virulence of S. epidermidis so far has mainly been attributed to its ability to form biofilms on indwelling medical devices (8). We have also found an impact of the agr system on this virulence factor and will report on this issue elsewhere.
Taken together, our results suggest that the general role of agr in S. epidermidis is the same as in S. aureus: in an early stage of infection, when the cell density is still low and planktonic cells are present, binding proteins are synthesized to allow colonization of host tissues. When cell clusters are formed on host tissue or on the skin, and the cell density is high, activation of the agr quorum-sensing system allows the cells to respond to the changed physiological needs by synthesizing tissue-degrading proteins and other exoproteins. The virulence of S. aureus is mainly caused by agr-regulated proteins, and deletion of the agr system in S. aureus may lead to mutants with decreased virulence (1, 3, 5, 21). Animal models will show if global regulators as agr have a similar impact on the virulence of S. epidermidis.
| |
ACKNOWLEDGMENTS |
|---|
We thank Vera Augsburger, Phuong Lan Huynh, and Ulrike Pfitzner for technical assistance, Ambrose L. Cheung for S. aureus strains, and Karen A. Brune for editing the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Mikrobielle Genetik, Universität Tübingen, Waldhäuserstr. 70/8, D-72076 Tübingen, Germany. Phone: 49-7071-2974648. Fax: 49-7071-295937. E-mail: michael.otto{at}uni-tuebingen.de.
Editor: S. H. E. Kaufmann
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Abdelnour, A.,
S. Arvidson,
T. Bremell,
C. Ryden, and A. Tarkowski.
1993.
The accessory gene regulator (agr) controls Staphylococcus aureus virulence in a murine arthritis model.
Infect. Immun.
61:3879-3885 |
| 2. | Augustin, J., and F. Götz. 1990. Transformation of Staphylococcus epidermidis and other staphylococcal species with plasmid DNA by electroporation. FEMS Microbiol. Lett. 66:203-208[CrossRef]. |
| 3. |
Booth, M. C.,
R. V. Atkuri,
S. K. Nanda,
J. J. Iandolo, and M. S. Gilmore.
1995.
Accessory gene regulator controls Staphylococcus aureus virulence in endophthalmitis.
Investig. Ophthalmol. Vis. Sci.
36:1828-1836 |
| 4. | Brückner, R. 1997. Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus. FEMS Microbiol. Lett. 151:1-8[Medline]. |
| 5. |
Cheung, A. L.,
K. J. Eberhardt,
E. Chung,
M. R. Yeaman,
P. M. Sullam,
M. Ramos, and A. S. Bayer.
1994.
Diminished virulence of a sar /agr mutant of Staphylococcus aureus in the rabbit model of endocarditis.
J. Clin. Investig.
94:1815-1822.
|
| 6. | Christensen, G. D. 1993. The `sticky' problem of Staphylococcus epidermidis sepsis. Hosp. Pract. 28:27-36, 38. |
| 7. | Christensen, G. D., L. Baldassarri, and W. A. Simpson. 1994. Colonization of medical devices by coagulase-negative staphylococci, p. 45-78. In A. L. Bisno, and F. A. Waldvogel (ed.), Infections associated with indwelling medical devices, 2nd ed. American Society for Microbiology, Washington, D.C. |
| 8. |
Christensen, G. D.,
W. A. Simpson,
A. L. Bisno, and E. H. Beachey.
1982.
Adherence of slime-producing strains of Staphylococcus epidermidis to smooth surfaces.
Infect. Immun.
37:318-326 |
| 9. | Goguen, J. D., N. P. Hoe, and Y. V. Subrahmanyam. 1995. Proteases and bacterial virulence: a view from the trenches. Infect. Agents Dis. 4:47-54[Medline]. |
| 10. | Götz, F., H. M. Verheij, and R. Rosenstein. 1998. Staphylococcal lipases: molecular characterisation, secretion, and processing. Chem. Phys. Lipids 93:15-25[CrossRef][Medline]. |
| 11. | Huebner, J., and D. A. Goldmann. 1999. Coagulase-negative staphylococci: role as pathogens. Annu. Rev. Med. 50:223-236[CrossRef][Medline]. |
| 12. | Janzon, L., S. Lofdahl, and S. Arvidson. 1989. Identification and nucleotide sequence of the delta-lysin gene, hld, adjacent to the accessory gene regulator (agr) of Staphylococcus aureus. Mol. Gen. Genet. 219:480-485[CrossRef][Medline]. |
| 13. |
Jenkinson, H. F.
1992.
Adherence, coaggregation, and hydrophobicity of Streptococcus gordonii associated with expression of cell surface lipoproteins.
Infect. Immun.
60:1225-1228 |
| 14. |
Ji, G.,
R. Beavis, and R. P. Novick.
1997.
Bacterial interference caused by autoinducing peptide variants.
Science
276:2027-2030 |
| 15. | Kornblum, J., B. N. Kreiswirth, S. J. Projan, H. F. Ross, and R. P. Novick. 1990. agr: a polycistronic locus regulating exoprotein synthesis in Staphylococcus aureus, p. 373-402. In R. P. Novick (ed.), Molecular biology of the staphylococci. VCH Publisher, Inc., New York, N.Y. |
| 16. | Marmur, J. 1961. A procedure for the isolation of deoxyribonucleic acid from microorganisms. J. Mol. Biol. 3:208-218. |
| 17. | Morfeldt, E., K. Tegmark, and S. Arvidson. 1996. Transcriptional control of the agr-dependent virulence gene regulator, RNAIII, in Staphylococcus aureus. Mol. Microbiol. 21:1227-1237[CrossRef][Medline]. |
| 18. | Murphy, E., L. Huwyler, and M. C. de Freire Bastos. 1985. Transposon Tn554: complete nucleotide sequence and isolation of transposition-defective and antibiotic-sensitive mutants. EMBO J. 4:3357-3365[Medline]. |
| 19. | Nikoleit, K., R. Rosenstein, H. M. Verheij, and F. Götz. 1995. Comparative biochemical and molecular analysis of the Staphylococcus hyicus, Staphylococcus aureus and a hybrid lipase. Eur. J. Biochem. 228:732-738[Medline]. |
| 20. | Novick, R. P., H. F. Ross, S. J. Projan, J. Kornblum, B. Kreiswirth, and S. Moghazeh. 1993. Synthesis of staphylococcus virulence factors is controlled by a regulatory RNA molecule. EMBO J. 12:3967-3975[Medline]. |
| 21. | O'Callaghan, R. J., M. C. Callegan, J. M. Moreau, L. C. Green, T. J. Foster, O. M. Hartford, L. S. Engel, and J. M. Hill. 1997. Specific roles of alpha-toxin and beta-toxin during Staphylococcus aureus corneal infection. Infect. Immun. 65:1571-1578[Abstract]. |
| 22. | Otto, M., R. Sussmuth, G. Jung, and F. Gotz. 1998. Structure of the pheromone peptide of the Staphylococcus epidermidis agr system. FEBS Lett. 424:89-94[CrossRef][Medline]. |
| 23. | Otto, M., R. Sussmuth, C. Vuong, G. Jung, and F. Gotz. 1999. Inhibition of virulence factor expression in Staphylococcus aureus by the Staphylococcus epidermidis agr pheromone and derivatives. FEBS Lett. 450:257-262[CrossRef][Medline]. |
| 24. |
Peng, H. L.,
R. P. Novick,
B. Kreiswirth,
J. Kornblum, and P. Schlievert.
1988.
Cloning, characterization, and sequencing of an accessory gene regulator (agr) in Staphylococcus aureus.
J. Bacteriol.
170:4365-4372 |
| 25. |
Peschel, A.,
M. Otto,
R. W. Jack,
H. Kalbacher,
G. Jung, and F. Gotz.
1999.
Inactivation of the dlt operon in Staphylococcus aureus confers sensitivity to defensins, protegrins, and other antimicrobial peptides.
J. Biol. Chem.
274:8405-8410 |
| 26. | Raad, I., A. Alrahwan, and K. Rolston. 1998. Staphylococcus epidermidis: emerging resistance and need for alternative agents. Clin. Infect. Dis. 26:1182-1187[Medline]. |
| 27. | Recsei, P., B. Kreiswirth, M. O'Reilly, P. Schlievert, A. Gruss, and R. P. Novick. 1986. Regulation of exoprotein gene expression in Staphylococcus aureus by agr. Mol. Gen. Genet. 202:58-61[CrossRef][Medline]. |
| 28. | Rupp, M. E., and G. D. Archer. 1994. Coagulase-negative staphylococci: pathogens associated with medical progress. Clin. Infect. Dis. 19:231-245[Medline]. |
| 29. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 30. | Schägger, H., and G. von Jagow. 1987. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166:368-379[CrossRef][Medline]. |
| 31. | Schindler, C. A., and V. T. Schuhardt. 1965. Purification and properties of lysostaphin-a lytic agent for Staphylococcus aureus. Biochem. Biophys. Acta 97:242-250. |
| 32. | Schneewind, O., P. Model, and V. A. Fischetti. 1992. Sorting of protein A to the staphylococcal cell wall. Cell 70:267-281[CrossRef][Medline]. |
| 33. |
Selsted, M. E.,
Y. Q. Tang,
W. L. Morris,
P. A. McGuire,
M. J. Novotny,
W. Smith,
A. H. Henschen, and J. S. Cullor.
1993.
Purification, primary structures, and antibacterial activities of beta-defensins, a new family of antimicrobial peptides from bovine neutrophils.
J. Biol Chem.
268:6641-6648 |
| 34. |
Teufel, P., and F. Gotz.
1993.
Characterization of an extracellular metalloprotease with elastase activity from Staphylococcus epidermidis.
J. Bacteriol.
175:4218-4224 |
| 35. |
Yeaman, M. R.,
P. M. Sullam,
P. F. Dazin, and A. S. Bayer.
1994.
Platelet microbicidal protein alone and in combination with antibiotics reduces Staphylococcus aureus adherence to platelets in vitro.
Infect. Immun.
62:3416-3423 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|