Previous Article | Next Article 
Infection and Immunity, March 2000, p. 1337-1349, Vol. 68, No. 3
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Characterization of In Vitro DNA Binding Sites
of the EUO Protein of Chlamydia psittaci
Li
Zhang,
Martha M.
Howe, and
Thomas P.
Hatch*
Department of Microbiology and Immunology,
University of Tennessee, Memphis, Tennessee 38163
Received 1 June 1999/Returned for modification 30 July
1999/Accepted 11 November 1999
 |
ABSTRACT |
The EUO gene of chlamydia is highly expressed early in the
developmental cycle, relative to other genes, but continues to be
expressed throughout the active growth phases. The precise function of
EUO protein is not known, but it binds to DNA in vitro. In this study,
we developed a selection and amplification scheme for
identifying chlamydial genomic fragments to which EUO
preferentially binds in vitro. The scheme involved mixing recombinant
EUO with a Chlamydia psittaci genomic library in a
pBluescript plasmid vector in vitro, trapping EUO-bound plasmid clones
on filters, and amplifying the clones in Escherichia coli.
After nine rounds of enrichment, the EUO binding sites of the
three most highly enriched clones were identified by DNase I footprint
analysis. All three clones had multiple binding sites of various sizes
with no clear distinguishing feature other than they were AT-rich and were usually not located in putative promoter regions. We used limited
site-specific mutagenesis to characterize the strongest binding site of
the most-highly-enriched clone, which represented about 50% of the
population after nine rounds. This mutagenesis identified a core
binding site of 15 nucleotides (nt) whose sequence was used to find
related sequences within each of the strong binding sites in the other
two clones. Using the frequency of bases at specific positions within
this group of sequences as a guide, we carried out trial-and-error
searching with many related sequences, eliminating those which
identified nonfootprinted sites. This process led us to the consensus
15-nt sequence AHGAAAWVTYTWDAY, which, when
allowing two mismatches, picked out all of the strong binding sites and no nonfootprinting sites within the three
enriched clones. This sequence may be useful for predicting
additional possible EUO binding sites in the chlamydial genome.
 |
INTRODUCTION |
Species of the genus
Chlamydia are obligate intracellular parasites of humans and
animals. A unique developmental cycle in which chlamydiae alternate
between an infectious elementary body (EB) and the vegetative
reticulate body (RB) distinguishes the genus Chlamydia from
other intracellular bacteria (19, 22). The EB is
metabolically inert and resistant to the hostile extracellular environment, whereas the RB divides intracellularly and cannot survive
outside of a host cell. The cycle commences with entry of EBs into host
cells by a phagocytic process, followed by differentiation of EBs to
dividing RBs, a process that takes several hours to complete. RBs
divide over a period of 1 or more days before they reorganize back into
the inert EB form. Ultimately, EBs are released, usually by lysis of
the host cell, and the cycle begins anew upon uptake of EBs into new
host cells. Very little is known about how gene expression is regulated
during the developmental cycle other than the few late-stage genes that
have been identified so far appear to require the major chlamydial
sigma factor for transcription initiation (9). Environmental
stimuli and transcriptional activators that trigger macromolecular
synthesis in EBs upon entry into host cells are completely unknown.
Wichlan and Hatch (33) cloned a Chlamydia
psittaci 6BC gene, designated EUO, on the basis of a high level of
expression at 1.5 h postinfection (hpi) compared to that at 24 hpi. In a subsequent study, Zhang et al. (36) found that EUO
transcripts are most abundant early (1 to 2 hpi) in the developmental
cycle relative to the major outer membrane protein (MOMP) gene
transcripts and the 16S rRNA content of chlamydiae; however, EUO
transcripts were detected until the end of the log phase of growth.
Synthesis of EUO protein in chlamydiae was also found as early as 1 hpi, but EUO protein was most abundant, relative to the MOMP, during the log phase of growth. EUO protein appears to be unstable, because levels decline at late times postinfection and are completely absent in
EBs (36). EUO is a minor protein and lacks significant homology to known proteins, but it does contain a putative
helix-turn-helix (HTH) DNA-binding motif, as determined by the
algorithm of Dodd and Egan (4). Using the
late-developmental-stage-specific cysteine-rich envelope protein
(crp) operon promoter region as a model, Zhang et al.
(36) demonstrated that recombinant EUO (rEUO) binds to multiple AT-rich sites in DNA in vitro, with the strongest binding site
located in the crp promoter between bp
60 and
9.
In the present study, we demonstrate that deletion of the putative HTH
motif results in the loss of EUO binding to the crp promoter
region. We also found that rEUO inhibited the in vitro transcription of
the crp operon. However, rEUO also inhibited the in vitro
transcription of two chlamydial genes that are expressed during the
growth phases of the developmental cycle, suggesting that EUO is not a
specific regulator of late-stage gene expression and that its effect on
in vitro transcription may be nonspecific. We therefore attempted to
identify potential target genes for EUO binding, without prejudice
concerning the function of EUO. Toward this end, we developed a
selection-amplification procedure that enriched for DNA sequences
within a chlamydial genomic library to which rEUO preferentially binds
in vitro. The strongest binding site of the most highly enriched clone
was partially characterized by deletion and mutation analysis.
Sequences containing the most important bases in this site were used to
search the enriched clones to identify a 15-bp consensus binding
sequence which matched (allowing two errors) at least one sequence in
every strong binding site and none outside the binding sites.
 |
MATERIALS AND METHODS |
Preparation of rEUO.
His-tagged rEUO was purified by
nickel-agarose affinity chromatography, according to the
manufacturer's instructions (Novagen, Madison, Wis.), and was used in
all experiments, except for gel mobility shift assays carried out with
an rEUO HTH-deletion mutant (rEUO-
HTH). For these experiments, the
rEUO gene without a His tag was amplified by PCR with the template
pDGWE-47 and primers E1 and E2 (36). After EcoRI
digestion and gel purification, the fragments were ligated into the
EcoRI site of pBluescript KS(+) vector (Stratagene, La
Jolla, Calif.). The resulting plasmid pLZ1F1 was treated with
BsaAI, which digested the plasmid at a unique site within
the sequence encoding the HTH motif. A linear plasmid lacking HTH
sequence was then amplified by PCR from two divergent primers, DHTHEHF
(5' ACAGGGACGATGGCAGG 3') and DHTHEHR (5'
ACAACCCTTCTCATTATC 3'), which hybridized to sequences immediately flanking the motif sequence. The amplified linear plasmid was blunt end
ligated to form a circular plasmid, and the DNA insert was sequenced to
confirm the in-frame deletion of the HTH motif from the EUO gene. The
EcoRI fragment of the plasmid was ligated into the
EcoRI site of the expression vector, pT7-5 (29),
and overexpression and gel purification of rEUO-
HTH were performed as previously described for rEUO without a His tag (36).
In vitro transcription assay.
In vitro transcription assays
were carried out by using partially purified C. psittaci 6BC
RNA polymerase preparations (18) under the conditions
described by Douglas and Hatch (6) with templates consisting
of promoter regions of chlamydial genes cloned into the
pUC19-spf' transcription assay vector (7). The
templates assayed were pALR202, which contains the promoter of the
plasmid antisense transcripts gene of Chlamydia trachomatis
L2 (10), pLZBMP3, which contains a 124-bp insert encoding
the C. psittaci 6BC MOMP gene P3 promoter region (
85 to
+39) (35) ligated into XbaI and BamHI
sites of pUC19-spf', and pLZ208C, which contains a 416-bp
DNA fragment encoding the promoter region (
404 to +12) of the
crp operon of C. psittaci 6BC (8)
ligated into the XbaI and BamHI sites of
pUC19-spf'.
Construction of a chlamydial genomic library.
The genomic
DNA of C. psittaci 6BC was partially digested with
Sau3AI to generate relatively small fragments with a broad distribution of end points. The endonuclease-treated DNA was
fractionated by electrophoresis on a 0.8% agarose gel, and fragments
from 400 to 700 bp were electroeluted from the gel (32) and
ethanol precipitated. The pellet was suspended in water, and the
fragments were ligated at equal molar ratio to pBluescript KS(+) vector
(Stratagene), which had been previously digested with BamHI
and treated with calf intestine alkaline phosphatase. Escherichia
coli XL1-Blue (Stratagene) was transformed, and about 20,000 colonies were collected and combined in Luria broth (LB) medium.
Plasmids from the combined genomic library were prepared by using a
Midiprep kit (GmbH, Qiagen, Valencia, Calif.).
In vitro enrichment for rEUO binding sites.
A nitrocellulose
filter-binding assay was used for separation of His-tag rEUO
protein-DNA complexes from protein-free plasmids. Binding reactions
were carried out in triplicate for 30 min at room temperature, each in
a final volume of 50 µl of 1× DNA-binding buffer (36).
The reaction mixtures contained 2 µg of genomic library plasmid DNA,
300 ng of rEUO protein, and 200 µg of calf thymus DNA as a
nonspecific competitor. The reactions were passed through a Protran
BA85 nitrocellulose filter (Schleicher and Schuell, Keene, N.H.),
presoaked in 1× DNA-binding buffer for 30 min at room temperature, a
procedure which retains protein-DNA complexes on the filter but not
unbound double-stranded DNA (dsDNA) (23, 28). After the
filter was washed three times with 0.5 ml of 1× DNA binding buffer, it
was placed facedown in a 20-ml scintillation vial containing 450 µl
of filter elution buffer (20 mM Tris-HCl [pH 7.8], 0.2% sodium
dodecyl sulfate, 0.3 M sodium acetate) and was incubated in a water
bath at 30°C for 2 h with gentle agitation. The eluate was
removed to a microcentrifuge tube and extracted with phenol, and
plasmid DNA was ethanol precipitated. The resulting plasmids were
transformed into E. coli host XL1-Blue and amplified by
overnight growth on LB agar plates containing 100 µg of carbenicillin per ml and 17 µg of tetracycline per ml. Each transformation yielded approximately 2,000 to 3,000 colonies, for a total of about 7,000 colonies. After randomly picking 20 individual colonies, the remaining colonies were collected from the plates by adding LB medium, and mini
plasmid preparations (2) were performed to extract DNA, representing the population of genomic recombinant plasmids after the
first round of enrichment. Mini plasmid preparations were also
performed with the 20 individual colonies, and inserts were obtained by
digestion with HindIII and XbaI and analyzed
by 0.8% agarose gel electrophoresis. Eight additional rounds of
enrichment for rEUO binding sites were performed by exactly repeating
the first-round enrichment procedure, except that 20 individual
colonies were picked only after rounds 5 and 9.
Two controls were carried out to test the specificity of the enrichment
process. In one, rEUO was added in the binding reaction to equal molar
concentrations of pBluescript KS(+) vector and pALR207. pALR207
contains a 267-bp insert in pBluescript KS(+) and encodes the
crp promoter (
200 to +67), an AT-rich sequence, to which
rEUO binds strongly (36). After filter binding, elution, and
transformation, transformants were grown on LB plates containing IPTG
(isopropyl-
-D-thiogalactopyranoside), X-Gal
(5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside), and
antibiotics. The total number of the transformants was around 2,000 to
3,000, and the ratio of white (pALR 207) to blue colonies (empty
vector) was between 5 and 8 to 1, which represented the selection force
per round. In the second control, rEUO was omitted from the binding
reaction described above. In this case, only about 100 colonies in
approximately equal ratios of white to blue were noted, indicating that
nonspecific retention of circular plasmid DNA by the filter was low
(5%) compared to that of the rEUO-plasmid DNA complexes.
DNase I footprinting of enriched clones.
Overlapping linear
DNA fragments, which covered the entire insert of each enriched clone,
were generated by PCR amplification with
[
-32P]ATP-end-labeled oligonucleotides (10)
shown in Table 1. Binding reactions were
carried out in a final volume of 50 µl of 1× DNA binding buffer
containing 1.8 nM 32P-dsDNA (equal to about 30 to 40 ng of
dsDNA), various amounts of rEUO, and 100-fold excess of sonicated calf
thymus DNA (3 to 4 µg) as competitor. DNase I treatment and analysis
on DNA sequencing gels were carried out as described by Sasse-Dwight
and Gralla (24).
Gel mobility shifts of rEUO binding site mutants.
Mutant
forms of the strongest binding site (site 2) of the most highly
enriched clone (pLZ9R8) were generated by annealing synthetic
oligonucleotides. After annealing at 65°C for 3 min and slowly
cooling to room temperature, gel shifts were performed with 10 ng of
32P-end-labeled mutant dsDNA and 0, 1, 10, or 50 ng of rEUO
(36).
Circular permutation (bending) assay.
The assay was carried
out according to the procedure of Wu and Crothers (34). Two
oligonucleotides, representing site 2 of pLZ9R8 (9R8T2/32Xb [5'
CTAGATTTTCGTATTCCAAGAAATGTCTTAACAATGT 3'] and 9R8B2/32Xb
[5' CTAGACATTGTTAAGACATTTCTTGGAATACGAAAAT 3']), were
annealed and cloned into the pBend2 vector (17), which was
previously digested with XbaI. The resulting plasmid,
pBend(LZ9R8/2), was sequenced on both strands with
oligonucleotides HOW3 (5' AAAATAGGCGTATCACGAGG 3')
and HOW4 (5' CTGCGTTAGCAATTTAACTGTG 3') to confirm the
construction and then digested with MluI, NheI,
SpeI, DraI, PvuII, StuI,
and BamHI and treated with calf intestine alkaline
phosphatase (Boehringer Mannheim, Indianapolis, Ind.). The seven
digested products were extracted with phenol, precipitated with
ethanol, end labeled with [
-32P]ATP, and purified with
MicroSpin G-25 columns (Pharmacia LKB Biotechnology, Piscataway, N.J.).
Binding reactions were performed with 1 ng of rEUO and 1 ng of labeled
DNA probes, as in the gel mobility shifts, except that samples were
analyzed on 10% rather than 6% nondenaturing acrylamide gels.
DNA sequencing.
The dideoxy-chain termination DNA sequencing
was performed with Sequenase kits, following the instructions of the
manufacturer (U.S. Biochemical Corp., Cleveland, Ohio).
Computer analysis.
The homology searches of DNA and protein
sequences of enriched clones were performed by using Blast, Fasta,
Fastn, Tfasta, and BestFit of GCG software (Genetics Computer Group,
Inc., Madison, Wis.) and the Chlamydial Genome Project database
(26). The alignment and sequence analysis of EUO binding
sites were carried out with the Motifs, BestFit, FindPatterns, PileUp,
and Window programs of GCG software (3, 5); BLOCKS
(16); and the Megalign program in DNASTAR (DNASTAR, Inc.,
Madison, Wis.).
 |
RESULTS |
The role of the HTH motif in rEUO binding to DNA.
The
algorithm of Dodd and Egan (4) predicts an HTH motif in EUO;
however, neither the Motifs nor the BLOCKS program identifies an HTH
motif in the protein. To test whether the putative HTH motif was
required for DNA binding, we constructed a recombinant EUO protein
(rEUO-
HTH) lacking only the sequence encoding the motif. As we had
observed previously (36), we found multiple shifted bands at
high concentrations of wild-type EUO, as determined by gel mobility
shift assay (Fig. 1). This ladder pattern
of shifted bands probably reflected the binding of EUO to multiple
sites on the 267-bp DNA probe, the promoter region of the
crp operon (8). In contrast, rEUO-
HTH failed
to shift the probe at any concentration tested. Although the
possibility that the deletion induced conformational changes that were
responsible for the loss of DNA binding activity in the EUO protein
cannot be eliminated, these results are consistent with the conclusion
that EUO binds to DNA through an HTH motif.

View larger version (103K):
[in this window]
[in a new window]
|
FIG. 1.
Gel electrophoresis mobility shift assay with rEUO and
rEUO- HTH. A standard gel shift assay was carried out with the
amounts of gel-purified recombinant proteins indicated above the lanes.
Electrophoresis of 1 ng of free probe ( 200 to +67 of the
crp operon promoter region) is shown in the far-left lane.
|
|
The effect of rEUO binding on in vitro transcription.
Because
rEUO binds to the promoter region of the crp operon
(36), the effect of rEUO on crp transcription in
vitro was examined. Inhibition of transcription was noted at
concentrations of rEUO of 100 nM and above (Fig.
2, lanes 2 to 5). The inhibition probably was not due to extraneous substances in the gel-purified rEUO preparation, since an irrelevant E. coli protein purified
from the same gel had no effect (Fig. 2, lanes 6 to 9). However, the in
vitro transcription of two other chlamydial genes, the MOMP gene of
C. psittaci and the plasmid antisense transcript genes of
C. trachomatis, was also inhibited by similar
concentrations of rEUO (data not shown). The MOMP and plasmid
antisense genes are expressed during the growth phases of the
developmental cycle (21, 27); therefore, it is
unlikely that rEUO is a negative regulator of these genes in vivo. The
mechanism by which rEUO inhibited transcription of all three genes is
not known, but may have been due to the ability of the protein to bind
to multiple DNA sequences at high protein concentrations rather than to
binding solely to specific regulatory elements.

View larger version (126K):
[in this window]
[in a new window]
|
FIG. 2.
The effect of rEUO on in vitro transcription from the
crp operon. The templates were empty vector without
insert (EV); pLZ208C, containing the C. psittaci
crp operon promoter from 404 to +12 (lanes 2 to 9); and pALR202,
containing the C. trachomatis L2 plasmid antisense
transcripts promoter (PT) from 498 to +6. The concentrations of EUO
protein (lanes 2 to 5) and an irrelevant E. coli protein
(lanes 6 to 9), purified from the same gel from which rEUO was
purified, are shown above the lanes; no recombinant protein was present
in the EV and PT controls. The position of the in vitro-generated
crp and PT transcripts are indicated on the right side.
Other bands represent transcription from unknown sites within the
vector or the inserts. A DNA ladder, which was used to estimate the
length of the transcripts, is shown on the left side.
|
|
Enrichment for rEUO binding sites.
To identify preferred
binding sites for EUO without prejudice concerning its function, we
devised a selection-amplification system for enrichment of EUO-bound
DNA fragments within the chlamydial genome. A scheme of the procedure
is shown in Fig. 3. A chlamydial genomic
library was constructed, consisting of 400- to 700-bp inserts from a
partial Sau3AI digest ligated into pBluescript KS(+).
Plasmid DNA from the library of approximately 20,000 clones was
incubated with rEUO, and the protein-DNA complexes were separated from
free plasmid DNA by trapping on a nitrocellulose filter. The DNA was
eluted from the filters, extracted with phenol, and used to transform
E. coli for the purpose of amplification. Plasmid DNA was
reisolated and subjected to eight additional rounds of enrichment for
rEUO-DNA complexes. The conditions in the multiple-round enrichment
procedure were set up so that when pBluescript without an insert and
pALR207, a pBluescript plasmid containing the crp promoter
region, were incubated in equimolar amounts with rEUO, five to eight
times as much pALR207 plasmid as pBluescript was recovered from the
filters. Under these conditions, the retention of plasmids in the
absence of rEUO was reduced by 95%. A portion of the isolated,
undigested plasmid preparations after each round of enrichment was
fractionated by agarose-gel electrophoresis (Fig.
4). After round 1, the library consisted
of a heterogeneous population of plasmids, including a relatively large
proportion of pBluescript without insert. As the enrichment processes
progressed, the heterogeneity of the library diminished, with a
focusing of plasmids with inserts of approximately 500 bp and some
other larger species; pBluescript without insert could not be detected
after round 5.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
Scheme for in vitro enrichment of rEUO binding sites
from a chlamydial genomic library. ppt, precipitated.
|
|

View larger version (87K):
[in this window]
[in a new window]
|
FIG. 4.
Plasmid content of the genomic library through nine
rounds of enrichment. Plasmids were prepared from the entire library
after each round of enrichment (rounds 1 to 9), fractionated by agarose
gel electrophoresis, and stained with ethidium bromide. Linear DNA
markers (M) were run in the first lane, and their sizes in kilobases
are shown on the left side. The migration of monomeric pBluescript
without inserts is indicated on the right side (pBS). Because the
plasmids were not digested with restriction enzymes, covalently closed,
nicked, and concatameric forms were present in the population.
|
|
Approximately 7,000 colonies were obtained after each round of
enrichment. The inserts from 20 randomly selected clones were
examined
by electrophoresis after rounds 5 and 9 (Fig.
5). Restriction
fragment analysis and
subsequent sequencing indicated that after
round 9, 3 clones were
present more than once among the 20 selected.
The most-highly-enriched
clone, pLZ9R8 (9 of 20), was found to
contain a single
Sau3AI fragment of 529 bp. DNA sequencing indicated
that the
fragment is homologous to part of the
dcd gene, which
encodes the C-terminal portion of deoxycytidine triphosphate deaminase
(Fig.
6). This clone was also detected
twice among the 20 enriched
clones after round 5 (Fig.
5). Southern
blot analysis was performed
by dot blotting of 600 individual colonies
from the
C. psittaci 6BC genomic library (round 0) and 200 colonies after nine rounds
to distinguish between enrichment and
possible overrepresentation
of pLZ9R8 in the library. Whereas 96 of the
round 9 clones (48%)
hybridized to a pLZ9R8 probe, only 1 of the 600 clones in the
original library tested positive, confirming that pLZ9R8
was highly
selected by the in vitro DNA binding and amplification
process
(data not shown).

View larger version (95K):
[in this window]
[in a new window]
|
FIG. 5.
Insert DNA fragments of representative clones enriched
at rounds 5 and 9. The plasmids of 20 random clones picked after round
5 (top panel) or round 9 (bottom panel) were digested with
HindIII and XbaI and fractionated by agarose
gel electrophoresis. Lanes marked M represent linear DNA markers (in
kilobases). , clones with an insert size of approximately 500 bp.
DNA sequencing revealed that all of these clones contain the same
insert, which was designated LZ9R8. #, clones with identical insert DNA
fragments totaling about 1.2 kb. The insert of these clones was
designated LZ9R17. , clones with identical inserts of 2.3 kb, which
were designated LZ9R5. Migration of the linear vector (pBluescript
[pBS]) is indicated on the right side.
|
|

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 6.
Summary of the rEUO binding sites of LZ9R8. The binding
sites, as determined by rEUO protection from DNase I and numbered in
order from the beginning to the end of the insert, are underlined. Site
2 (designated in boldface) was the only strong binding site. An ORF
with homology to the C-terminal portion of dCTP deaminase
(dcd [ORF D039 in C. trachomatis serovar D]) is
shown below the DNA sequence.
|
|
The second most highly enriched clone of round 9, pLZ9R17 (3 of 20),
was generated by ligation of three
Sau3AI fragments (Fig.
7) to yield a 1.2-kb insert. It encodes
four partial open reading
frames (ORFs) which bear homology to
ORFs D263, D264 (MSBA-transport
ATP-binding protein), D425, and
D602 of
C. trachomatis serovar
D genome (
26). The
third enriched clone of round 9, pLZ9R5 (2
of 20; 2.3 kb), was the
ligation product of six
Sau3AI fragments
(Fig.
8). The six fragments
encode eight partial ORFs that are
homologous to genes found in the
C. trachomatis serovar D genome
(
26):
dnaA (DnaA),
tdk (thymidylate kinase),
gyrA (gyrase A),
ypdp (hypothetical protein),
recA (recombination protein A),
ygfA (possible
formyl tetrahydrofolic acid cycloligase),
yABC/yraL (possible methyltransferase), and a 23S rRNA gene.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 7.
Summary of the rEUO binding sites in LZ9R17.
The binding sites are underlined, with the single strong site (site 2)
designated in boldface. ORFs with homology to known proteins, including
ORFs identified in the genome of C. trachomatis serovar D,
are shown below the coding sequence, with arrowheads indicating the
orientation of ORFs. The Sau3AI sites are underlined and in
italic.
|
|


View larger version (5655K):
[in this window]
[in a new window]
|
FIG. 8.
Summary of the rEUO binding sites in LZ9R5.
The binding sites are underlined, with ORFs and Sau3AI sites
designated as described for Fig. 7. Strong sites are designated in
boldface (sites 1, 7, 8, 10, 11, and 13).
|
|
The A + T content of the
C. psittaci 6BC genome is not
precisely known, but the kinetics of DNA melting suggest that it is
about 60% (
12), similar to the genome of
C. trachomatis D/UW-3/Cx
(
26). The A + T content of
the inserts in the three most highly
enriched clones ranged from 59 to
63%, similar to the expected
overall content of the
genome.
Southern blot analysis of plasmid DNA prepared from the combined 7,000 colonies collected after rounds 1, 5, and 9 were probed
with the insert
of pALR207, which encodes the
crp promoter region
from

200
to +67. A relatively strong signal was observed after
round 1, a weak
signal after round 5, and a background signal
after round 9 (data not
shown). These observations suggest that
at least part of the
crp promoter region was present in the genomic
library, but
was not selected by the enrichment scheme. It is
possible that plasmids
encoding this promoter did not replicate
as well as the enriched
plasmids or that in vitro binding of rEUO
to the enriched inserts under
the chosen selection condition was,
in fact, better than binding to the
crp promoter
sequences.
DNase I footprinting of the enriched clones.
DNase I
footprinting analysis was carried out to determine the sites to which
rEUO binds in vitro. Inserts of pLZ9R8 (LZ9R8) and pLZ9R17 (LZ9R17) are
shown as representative footprint results (Fig.
9 and
10). All three clones contained
multiple protection sites, with a total of 24 being detected. Several
of the sites included hypersensitive bands, including the strong
binding sites in LZ9R8 (site 2, Fig. 9) and LZ9R17 (site 2, Fig. 10).
The protected sites are underlined in Fig. 6 (LZ9R8), 7 (LZ9R17), and 8 (LZ9R5). The DNA strands in the sites were arbitrarily designated
"top" and "bottom." The concentration of rEUO required to
protect the sites from DNase I ranged from 30 or 50 nM (high affinity,
strong sites) to between 100 nM and 1 µM (low affinity, weak sites). The lengths of the footprinted regions ranged from 15 to 260 nucleotides (nt), with half falling in the 27- to 37-nt range. The
shortest strong binding site found was the 24-bp site 2 of LZ9R8. Three sites were noticeably longer than the others (60, 129, and 260 nt) and
probably resulted from the presence of multiple closely spaced binding
sites along with cooperative extension of the footprints from an
initial binding site. The sites identified in the enriched clones were
located entirely within coding regions, except for site 4 of LZ9R8 and
site 4 of LZ9R17, which included both coding and upstream sequences.
There were three notable features among the footprinted sites. The
first was their AT-rich nature; they had an average AT content of 69%
(range, 59 to 75% for strong sites and 53 to 80% for weak sites).
Most also contained a region within the site that was even more AT
rich. Finally, all of the strong sites and 60% of the weak sites
contained at least one stretch of four contiguous A's or T's. To
determine whether high AT content is the sole determinant for EUO
binding, we analyzed the inserts of all three clones for average AT
content with the Window program in the GCG software package (3,
5) over window lengths of 15, 20, and 30 nt (not shown). Although
regions with very high AT content were most often located within strong
sites, other areas with similarly high AT content were also found
within weak sites and nonfootprinting sites. For example, the best
predictor of a strong site was a peak average AT content above 80%
when calculated in 1-nt increments with a window of 20 nt. Under this search condition, only five of the eight strong sites and one weak site
were identified, along with one nonfootprinting site. All strong sites
reached a minimum peak average AT content of 75%; however, peaks of
75% identified as many nonfootprinted as footprinted sites. Similarly,
strings of at least four consecutive A's or T's were also located in
many AT-rich nonfootprinting sites. We conclude that whereas high AT
content is required for rEUO binding to DNA in vitro, other factors
such as specific nucleotide sequence or DNA secondary structure are
responsible for discrimination between footprinting and nonfootprinting
sites. We also used the computer algorithms BestFit, Pileup, and
Megalign to align the sites; unfortunately, all three failed to
identify a common sequence pattern within the strong or weak sites of
the three enriched clones, perhaps in part because the binding sites
were of such different sizes.

View larger version (130K):
[in this window]
[in a new window]
|
FIG. 9.
Representative DNase I footprints of the LZ9R8 insert by
rEUO. (A) Top strand. (B) Bottom strand. The concentrations of rEUO
that were used in the protection study are shown at the top of the
lanes. Protected regions are indicated by vertical lines, and an
asterisk indicates a hypersensitive site in the top strand. DNA
sequencing ladders, produced by using the same primers that were used
in the protection study, are shown on the left side of each panel.
|
|

View larger version (125K):
[in this window]
[in a new window]
|
FIG. 10.
Representative DNase I footprints of LZ9R17 insert by
rEUO. (A) Top strand. (B) Bottom strand. The concentrations of rEUO are
shown on top of the lanes. Protected regions are indicated by vertical
lines, and hypersensitive sites are indicated by asterisks. DNA
sequencing ladders are shown on the left side of each panel.
|
|
Bending of LZ9R8 site 2 DNA upon rEUO binding.
Several
hypersensitive bands were noted in DNase I footprints, suggesting that
EUO may induce local distortions in DNA upon binding. LZ9R8 site 2 was
examined by the circular permutation assay of Wu and Crothers
(34) to determine whether rEUO can induce bends in DNA. This
site lacks lengthy A and T tracts and therefore is not likely to
contain intrinsic bends (15). Site 2 was cloned into pBend2,
and the resulting plasmid was digested with restriction enzymes to
yield seven circularly permuted DNA fragments of identical size (158 bp), differing only in the position of the rEUO binding site. The seven
fragments were then examined by standard gel mobility shift assay (Fig.
11). The slower migration of the
fragments with the EUO binding site nearer the middle of the fragment
suggests that rEUO may induce a small bend upon its binding to LZ9R8
site 2.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 11.
Circular permutation assay for rEUO-induced DNA bending.
The top panel shows DNA fragments generated by restriction endonuclease
digestion of pBend(LZ9R8/2) with MluI (a), NheI
(b), SpeI (c), DraI (d), PvuII (e),
StuI (f), or BamHI (g). The 32-bp LZ9R8 site 2 is
shown as a solid box. The bottom panel shows the results of the gel
shift experiment with rEUO binding and circular permutated DNA
pBend(LZ9R8/2) fragments (a to g). Lane 0, rEUO not added. Fragments in
which the rEUO binding sites were closer to the center were shifted
more than the fragments in which the sites were closer to the ends.
|
|
Mutational analysis of LZ9R8 site 2.
Because site 2 in LZ9R8
is the only strong site in the most highly enriched clone and is of
relatively small size (24 nt, top strand; 32 nt, bottom strand), it was
chosen for deletion studies in an attempt to define the minimal
sequence required for rEUO binding to a given site as defined by
mobility shift analysis. The results of the deletion study are
summarized in Fig. 12. The minimal
length for full binding affinity of rEUO required a probe (M20) of 20 bp (TCCAAGAAATGTCTTAACAA [top strand]).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 12.
Summary of rEUO binding to deletion fragments of LZ9R8
site 2. The 32-bp rEUO binding site, as determined by DNase I
protection studies, is shown at the top. Gel mobility shift analysis
was carried out with synthetic double-stranded oligonucleotides,
deleted from either or both ends of the site, and 1, 10, or 50 ng of
rEUO, as described in Materials and Methods. The lengths of fragments
are represented by horizontal lines. The gel shift phenotype was scored
as follows: +++, shift equal to that of the wild type at all three rEUO
concentrations; ++, decreased shift at 1 ng of rEUO, wild-type shift at
higher concentrations; +, decreased shift at 1 and 10 ng of rEUO,
wild-type shift at 50 ng; , no major band shift at any of three rEUO
concentrations.
|
|
To identify the nucleotides which are critical for rEUO binding in
LZ9R8 site 2, sequential, 3-bp-at-a-time mutations were
made in 39-bp
double-stranded oligonucleotides (site 2 and flanking
sequence) and
tested by gel mobility shift assay for binding affinity
to rEUO. The
changes were a mixture of radical (either A or T
to either G or C and
vice versa) and conservative (the AT content
was not
changed) alterations. As shown in Fig.
13, rEUO shifted
the wild-type 39-bp
site 2 sequence when present at 1 ng, whereas
an unrelated,
control 39-bp LZ9R8 sequence that failed to footprint
required a
50-fold-larger amount. Only four of the mutant triplets
had a
decreased binding affinity for rEUO: T6 (AAA

TGC) showed
the
most severe decrease in binding; the other three mutant triplets,
T5
(AAG

GTC), T8 (CTT

TCG), and T9 (AAC

CTG), showed a more moderate
decrease. All of these down mutants were clustered in a 15-bp
core
region of LZ9R8 site 2 and entailed changes that made the
triplets more
GC rich. One mutant triplet in this region, T7 (TGT

GTA),
had no
effect on binding affinity to rEUO. This triplet is roughly
in the
center of the core and may not contain sequence required
for binding;
however, the overall AT content of the mutant was
the same as that in
the wild-type triplet, and the changes may
have had a neutral effect
for this reason. The 15-bp core is located
inside of the 20-bp minimal
binding sequence determined by deletion
analysis (Fig.
12), further
indicating that this region is critical
for binding to rEUO.

View larger version (87K):
[in this window]
[in a new window]
|
FIG. 13.
Triple-mutation analysis of pLZ9R8 site 2. (A) Gel
mobility shift. The double-stranded oligonucleotides used as probes
were as follows: NC, a 39-bp negative control DNA from
nonfootprinting sequence of pLZ9R8
(CGATTACTGATGATGTTTGTATCATTCCTCCGAATTCAT); WT, 39 bp of
wild-type LZ9R8 site 2 and surrounding sequence (see panel B); T1 to
T13, 13 triple mutants of LZ9R8 site 2, as indicated in panel B. (B)
Summary of the results of the triple-mutation analysis. The number of
plus signs reflects the relative strength of the shift, with +++
being equivalent to wild type. The triple substitutions (T1 to
T13) in the wild-type sequence are shown below the wild-type
sequence.
|
|
Single-base-pair mutations were made by sequentially
changing each A or T in the 15-bp core binding sequence
of site 2 to
a G; the total length of the fragment analyzed (26 bp)
included
LZ9R8 sequence on each side of the core to ensure that the
mutated
oligomers formed stable double strands and were of sufficient
length to allow binding of rEUO. The results (Fig.
14) indicated
that loss of A's at
positions 2, 5, and 6 and T's at positions
11 and 12 had the greatest
negative effects on binding; when G's
were substituted in these
positions, 10 ng of rEUO was required
to produce a shift equivalent to
that seen with 1 ng on the wild-type
sequence. Less-negative effects
were seen when G's were substituted
in positions 4, 7, 9, 13, and 14, and essentially no effect was
noted when a G was substituted for
the A in position 1 of the
wild type. A 26-bp poly(A)-poly(T) DNA
(AT in Fig.
14) fragment
was also tested. Interestingly, the AT
fragment shifted less well
than the wild-type fragment at 1 ng of rEUO.
However, at a high
concentration, rEUO bound better to the AT fragment,
inducing
a second shifted species that was much weaker for the other
fragments.
These results suggest that poly(A) is not the optimal
binding
sequence for rEUO, but it may provide multiple sites for
binding.

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 14.
Single-mutation analysis of pLZ9R8 site 2. (A) Gel
mobility shift. The assay was carried out with 0, 1, 10, or 50 ng, as
described in Materials and Methods. NC, a 26-bp negative control DNA
from nonfootprinting sequence of pLZ9R8
(CATTACTGATGATGTTTGTATCATTC); WT, wild-type 26-bp LZ9R8 site
2 (see panel B); P1 to P15, single-base-pair mutations, as indicated in
panel B. Arrows indicate the positions of DNA-protein complexes. (B)
Summary of the results of single-mutation analysis. The number of plus
signs reflects the relative strength of the shift, with +++ being
equivalent to wild type.
|
|
Derivation of a consensus EUO binding site.
Since we were
unable to identify a common sequence pattern within the binding sites
in the enriched clones by using computer algorithms, we decided to
apply the information derived from the mutagenesis studies described
above to identify related sequences within each of the eight strong
binding sites and then to develop a consensus from those sequences. By
using the FindPatterns program (3, 5), we searched the three
enriched clones with the 15-bp LZ9R8 site 2 core sequence that was
identified in the mutagenesis study. It was necessary to allow six
mismatches to recover at least one matching sequence within each strong
site. Under this search condition, a total of 19 sequences were
identified in the strong sites (Table 2).
Two possible consensus sequences that can be derived from the frequency
table for the 19 matches are AAGAAATGTCTTAAC and
AADAAHNNTNTTDNH (by convention, D = not C; H = not
G; N = G, A, T, or C; W = A or T; V = not T; and Y = C or T). The first represents the most common nucleotide at each position and is identical to the original search sequence (site 2 of
LZ9R8). It is not a useful consensus, because it required four to six
mismatches to identify any given strong site, and under the search
condition of six mismatches, it identified many nonfootprinting sites.
The second consensus was derived by choosing a single nucleotide for a
given position if it were present in 14 or more of the 19 sequences
(approximately 75%); otherwise, a symbol representing all of the
observed bases in a given position was used. This consensus, with two
mismatches, is found at least once in all eight of the strong binding
sites, at least once in 13 of 16 weak binding sites, and in 26 nonfootprinting sites. We next attempted, by trial and error, to find a
less degenerate sequence which would identify at least one sequence in
every strong site without identifying any nonfootprinting sites, when
allowing two mismatches. After searching with approximately 100 candidate sequences, we found that the sequence AHGAAAWVTYTWDAY
fulfilled these criteria. Interestingly, only one sequence in
each strong site, including even the long footprinting sites, was
identified when this consensus sequence was used to search (allowing
two mismatches) the three enriched clones (Table
3). That is, many of the original 19 sites identified by matches to the 15-nt core sequence were
eliminated when the search was carried out with a sequence
that specifically excluded nonfootprinting sites. In addition, one of
the final consensus-matching sequences in Table 3,
ATGAAAAATTTTTAT, was not present in the original 19 sites, suggesting that this approach did not unduly bias the derived consensus
toward the 15-nt core sequence used for the first search. The most
striking feature of the frequency table based on the identified 8 sequences is the high degree of specificity for particular nucleotides in several positions (A-GAAA--T-TT-A-), suggesting that
these are the most important nucleotides required for binding of EUO to
DNA.
 |
DISCUSSION |
A number of approaches have been taken to identify consensus
binding sequences of DNA binding proteins, the most random of which are
variations of the SELEX (systematic evolution of ligands by exponential
enrichment) method developed by Tuerk and Gold (31). The
common theme of the SELEX methodology is the generation of completely
random RNA or DNA oligonucleotides as targets for in vitro protein
binding, followed by multiple rounds of selection and amplification of
the bound sequences. We chose to use less-random targets, namely
chlamydial genome fragments present in a pBluescript library.
This approach could potentially identify specific EUO binding sequences
within the chlamydial genome and did not require knowing beforehand the
length of DNA needed for rEUO binding. The amplification of bound
plasmids was accomplished by transformation and replication of the
pBluescript clones in E. coli. There were several potential
limitations to this approach: large Sau3AI genomic fragments
were excluded from the library, clones with large inserts presented
multiple targets for binding, and the amplification process may have
enriched for clones that replicate most successfully in E. coli. Nevertheless, this successfully enriched for three clones,
all of which contained at least one strong and multiple weak binding sites.
A common sequence pattern among the strong binding sites of the three
enriched clones was not detectable by simple inspection or computer
algorithms. As an alternative, we chose to use mutagenesis to
characterize the strong binding site of the most highly selected clone
(site 2 of LZ9R8) and to use sequences derived from its important core
region to find other related sequences in the other strong binding
sites. Refinement of these sequences by elimination of those matching
nonfootprinted sites led to the identification of the consensus
AHGAAAWVTYTWDAY. When two mismatches are allowed, this
consensus identifies one sequence in each of the eight strong sites and does not identify any nonfootprinting sites in any
of the three most-highly-enriched clones. Although some
additional refinement of the consensus may result from the
investigation of additional enriched clones, the current sequence may
already be useful for predicting additional possible EUO binding sites in the chlamydial genome. From the eight sequences identified by this
consensus, the most frequent, and therefore potentially the most
important, bases were A-GAAA--T-TT-A-. Interestingly, four out of
the five most important nucleotides identified by the limited
single-base-pair mutagenesis study are specified in this sequence.
The ability of EUO to bind to a broad spectrum of sequences and to
recognize a relatively degenerate AT-rich consensus sequence is a
property common to several so-called nucleoid-associated proteins. This
group, which includes HU (25), H-NS (1), FIS (10), IHF (11, 13, 14), and LRP (20),
are generally small, abundant, basic proteins that bind to DNA,
often resulting in DNA compaction and bending. In their
roles as chromosome organizers, they facilitate interaction of
proteins bound to contiguous and noncontiguous DNA sites, leading to
the assembly of specific nucleoprotein complexes that participate
in replication, recombination, and regulation of expression of a
large number of often unrelated target genes. Both H-NS and HU
show less sequence specificity than FIS, IHF, and LRP and
preferentially bind to curved, bent, or kinked DNA. We have not
yet determined whether the strong binding sites in the enriched clones
include curved or bent sequences. Like EUO, FIS and LRP have roughly
15-nt degenerate consensus sequences and, at low protein
concentrations, protect regions 20 to 30 nt in length. As is the case
with nucleoid-associated proteins, at high concentrations, EUO binds to
multiple weak sites, extends footprint lengths (possibly by cooperative
binding), and also covers long stretches of DNA. There are two striking
differences between these nucleoid-associated proteins and EUO. The
first is that EUO causes only a small DNA bend when bound to a single strong site, whereas FIS generates a 40° to 90° bend, the LRP monomer generates a roughly 50°C bend, the LRP dimer generates a
135° bend, and IHF generates a 140° bend. We do not know if binding
of EUO to multiple adjacent sites would generate a more pronounced
bend. The second difference is that EUO is a quantitatively minor
protein. Even when EUO is present in peak amounts at around 12 to 18 hpi, it represents only a small fraction of 1% of the total protein
(36). Therefore, it is likely that EUO can bind in vivo to
only a limited number of sites at any given time. Nevertheless, its low
abundance does not rule out the possibility that it may serve an
organizing and regulating effect at those few sites.
The enriched clones with the largest inserts that we identified contain
intergenic sequences, but DNase I-protected regions were almost
exclusively within coding regions, suggesting that EUO may not interact
directly with most promoter sequences. However, the enriched sequences
may not represent in vivo targets. It is possible that in vivo
conditions, such as the presence of other DNA binding proteins,
facilitate EUO binding to a limited number of sites that have lower
intrinsic affinities for EUO than do the enriched sites. In this
respect, two AT-rich regions have been noted adjacent to the
35
hexamer of several putative chlamydial promoters; both of these regions
have been shown by in vitro transcription studies to contribute to the
strength of the chlamydial MOMP gene and rRNA operon promoters (6,
30). The upstream sequence appears to be an UP element that is
most likely recognized by the carboxy-terminal domain of the
subunit of RNA polymerase (30). The second AT-rich element
appears to be unique to chlamydiae. It is located in the spacer region,
just downstream of
35 hexamers in many of the putative chlamydial
promoters thus far identified on the basis of primer extension studies
(30). It is intriguing to speculate that EUO in some way may
facilitate the recognition of this element by chlamydial RNA
polymerase. Investigation of the in vivo targets of EUO is needed to
address this possibility.
 |
ACKNOWLEDGMENT |
This work was supported by Public Health Service grant AI 19570.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, University of Tennessee, Memphis TN 38163. Phone: (901) 448-4664. Fax: (901) 448-8462. E-mail:
thatch{at}utmem.edu.
Editor:
P. E. Orndorff
 |
REFERENCES |
| 1.
|
Atlung, T., and H. Ingmer.
1997.
H-NS: a modulator of environmentally regulated gene expression.
Mol. Microbiol.
24:7-17[CrossRef][Medline].
|
| 2.
|
Birnboim, H. C., and J. Doly.
1979.
A rapid alkaline extraction procedure for screening recombinant plasmid DNA.
Nucleic Acids Res.
7:1513-1523[Abstract/Free Full Text].
|
| 3.
|
Devereux, J.,
P. Haeberli, and O. Smithies.
1984.
A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res.
12:387-395.
|
| 4.
|
Dodd, I. B., and J. B. Egan.
1990.
Improved detection of helix-turn-helix DNA binding motifs in protein sequences.
Nucleic Acids Res.
18:5019-5026[Abstract/Free Full Text].
|
| 5.
|
Dolz, R.
1994.
GCG: database searching.
Methods Mol. Biol.
24:101-116[Medline].
|
| 6.
|
Douglas, A. L., and T. P. Hatch.
1996.
Mutagenesis of the P2 promoter of the major outer membrane protein gene of Chlamydia trachomatis.
J. Bacteriol.
178:5573-5578[Abstract/Free Full Text].
|
| 7.
|
Erickson, J. W., and C. A. Gross.
1989.
Identification of the E subunit of Escherichia coli RNA polymerase: a second alternative factor involved in high temperature gene expression.
Genes Dev.
3:1462-1471[Abstract/Free Full Text].
|
| 8.
|
Everett, K. D. E., and T. P. Hatch.
1991.
Sequence analysis and lipid modification of the cysteine-rich envelope proteins of Chlamydia psittaci 6BC.
J. Bacteriol.
173:3821-3830[Abstract/Free Full Text].
|
| 9.
|
Fahr, M. J.,
A. L. Douglas,
W. Xia, and T. P. Hatch.
1995.
Characterization of late gene promoters in Chlamydia trachomatis.
J. Bacteriol.
177:4252-4260[Abstract/Free Full Text].
|
| 10.
|
Fahr, M. J.,
K. S. Sriprakash, and T. P. Hatch.
1992.
Convergent and overlapping transcripts of the Chlamydia trachomatis 7.5-kb plasmid.
Plasmid
28:247-257[CrossRef][Medline].
|
| 11.
|
Finkel, S. E., and R. C. Johnson.
1992.
The FIS protein: it's not just for DNA inversion anymore.
Mol. Microbiol.
6:3257-3265[Medline].
|
| 12.
|
Gerloff, R. K.,
D. B. Ritter, and W. O. Wilson.
1970.
Studies on thermal denaturation of DNA from various chlamydiae.
J. Infect. Dis.
121:65-69[Medline].
|
| 13.
|
Goodrich, J. A.,
M. L. Schwartz, and W. R. McClure.
1990.
Searching for and predicting the activity sites for DNA binding proteins: compilation and analysis of the binding sites for Escherichia coli integration host factor (IHF).
Nucleic Acids Res.
18:4993-5000[Abstract/Free Full Text].
|
| 14.
|
Goosen, N., and P. van de Putte.
1995.
The regulation of transcription initiation by integration host factor.
Mol. Microbiol.
16:1-7[CrossRef][Medline].
|
| 15.
|
Hagerman, P. J.
1990.
Sequence-directed curvature of DNA.
Annu. Rev. Biochem.
59:755-781[CrossRef][Medline].
|
| 16.
|
Henikoff, S., and J. G. Henikoff.
1991.
Automated assembly of protein blocks for database searching.
Nucleic Acids Res.
19:6565-6572[Abstract/Free Full Text].
|
| 17.
|
Kim, J.,
C. Zwieb,
C. Wu, and S. Adhya.
1989.
Bending of DNA by gene regulatory proteins: construction and use of a DNA bending vector.
Gene
85:15-23[CrossRef][Medline].
|
| 18.
|
Mathews, S. A.,
A. Douglas,
K. S. Sriprakash, and T. P. Hatch.
1993.
In vitro transcription in Chlamydia psittaci and Chlamydia trachomatis.
Mol. Microbiol.
7:937-946[CrossRef][Medline].
|
| 19.
|
Moulder, J. M.
1991.
Interaction of chlamydiae and host cells in vitro.
Microbiol. Rev.
55:143-190[Abstract/Free Full Text].
|
| 20.
|
Newman, E. B., and R. Lin.
1995.
Leucine-responsive regulatory protein: a global regulator of gene expression in E. coli.
Annu. Rev. Microbiol.
49:747-775[CrossRef][Medline].
|
| 21.
|
Pearce, B.,
M. J. Fahr,
T. P. Hatch, and K. S. Sriprakash.
1991.
A chlamydial plasmid is differentially transcribed during the life cycle of Chlamydia trachomatis.
Plasmid
26:116-122[CrossRef][Medline].
|
| 22.
|
Raulston, J. E.
1995.
Chlamydial envelope components and pathogen-host cell interactions.
Mol. Microbiol.
15:607-616[CrossRef][Medline].
|
| 23.
|
Riggs, A. D.,
S. Bourgeois,
R. F. Newby, and M. Cohn.
1968.
DNA binding of the lac repressor.
J. Mol. Biol.
34:361-368[CrossRef][Medline].
|
| 24.
|
Sasse-Dwight, S., and J. D. Gralla.
1991.
Footprinting of promoter-DNA complexes in vivo.
Methods Enzymol.
208:146-147[CrossRef][Medline].
|
| 25.
|
Schmid, M. B.
1990.
More than just "Histone-like" proteins.
Cell
63:451-453[CrossRef][Medline].
|
| 26.
|
Stephens, R. S.,
S. Kalman,
C. Lammel,
J. Fan,
R. Marathe,
L. Aravind,
W. Mitchell,
L. Olinger,
R. L. Tatusov,
Q. Zhao,
E. V. Koonin, and R. W. Davis.
1998.
Genome sequence of an obligate intracellular pathogen of humans: Chlamydia trachomatis.
Science
282:754-759[Abstract/Free Full Text].
|
| 27.
|
Stephens, R. S.,
E. A. Wagar, and U. Edman.
1988.
Developmental regulation of tandem promoters for the major outer membrane protein gene of Chlamydia trachomatis.
J. Bacteriol.
170:744-750[Abstract/Free Full Text].
|
| 28.
|
Stockley, P. G.
1994.
Filter-binding assays, p. 251-262.
In
G. G. Kneale (ed.), DNA-protein interactions. Humana Press, Totowa, N.J.
|
| 29.
|
Tabor, S., and C. C. Richardson.
1985.
A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes.
Proc. Natl. Acad. Sci. USA
82:1074-1078[Abstract/Free Full Text].
|
| 30.
|
Tan, M.,
T. Gaal,
R. L. Gourse, and J. N. Engel.
1998.
Mutational analysis of the Chlamydia trachomatis rRNA P1 promoter defines four regions important for transcription in vitro.
J. Bacteriol.
180:2359-2366[Abstract/Free Full Text].
|
| 31.
|
Tuerk, C., and L. Gold.
1990.
Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase.
Science
249:505-510[Abstract/Free Full Text].
|
| 32.
|
Weinand, U.,
Z. Schwarz, and G. Felix.
1978.
Electrophoretic elution of nucleic acids from gels adapted for subsequent biological tests: application for analysis of mRNAs from maize endosperm.
FEBS Lett.
98:319-323[CrossRef].
|
| 33.
|
Wichlan, D. G., and T. P. Hatch.
1993.
Identification of an early-stage gene of Chlamydia psittaci 6BC.
J. Bacteriol.
175:2936-2942[Abstract/Free Full Text].
|
| 34.
|
Wu, H. M., and D. M. Crothers.
1984.
The locus of sequence-directed and protein-induced DNA bending.
Nature
308:509-513[CrossRef][Medline].
|
| 35.
|
Yuan, Y.,
Y.-X. Zhang,
D. S. Manning, and H. D. Caldwell.
1990.
Multiple tandem promoters of the major outer membrane protein gene (omp1) of Chlamydia psittaci.
Infect. Immun.
58:2850-2855[Abstract/Free Full Text].
|
| 36.
|
Zhang, L.,
A. L. Douglas, and T. P. Hatch.
1998.
Characterization of a Chlamydia psittaci DNA binding protein (EUO) synthesized during the early and middle phases of the developmental cycle.
Infect. Immun.
66:1167-1173[Abstract/Free Full Text].
|
Infection and Immunity, March 2000, p. 1337-1349, Vol. 68, No. 3
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.