Previous Article | Next Article ![]()
Infection and Immunity, March 2000, p. 1450-1456, Vol. 68, No. 3
Institute of Pathology, Case Western Reserve
University,1 and Department of
Pediatrics, Case Western Reserve University and Rainbow Babies and
Children's Hospital,2 Cleveland, Ohio 44106
Received 7 September 1999/Returned for modification 4 November
1999/Accepted 15 December 1999
Pneumococcal polysaccharide-protein conjugate vaccines elicit
antipolysaccharide antibodies, but multiple doses are required to
achieve protective antibody levels in children. In addition, the
immunogenicity of experimental multivalent pneumococcal conjugate vaccines varies with different polysaccharide serotypes. One strategy to improve these vaccines is to incorporate an adjuvant to enhance their immunogenicity. Synthetic oligodeoxynucleotides containing unmethylated CpG motifs (CpG ODN) are adjuvants that promote T-cell and
T-dependent antibody responses to protein antigens, but it has been
unclear whether CpG ODN can enhance polysaccharide-specific antibody
responses. The present studies demonstrate significant adjuvant
activity of CpG ODN for antibody responses against Streptococcus pneumoniae polysaccharide types 19F and 6B induced by conjugates of 19F and 6B with the protein carrier CRM197. BALB/c ByJ
mice were injected with 19F-CRM197 or 6B-CRM197
with or without CpG ODN, and sera were tested for anti-19F or anti-6B
antibodies by enzyme-linked immunosorbent assay. The
polysaccharide-specific antibody response to 19F-CRM197
alone was predominantly of the immunoglobulin G1 (IgG1) and IgM
isotypes, but addition of CpG ODN markedly increased geometric mean
titers of total anti-19F antibody (23-fold), anti-19F IgG2a (26-fold),
and anti-19F IgG3 (>246-fold). The polysaccharide-specific antibody
response to 6B-CRM197 alone consisted only of IgM, but
addition of CpG ODN induced high titers of anti-6B IgG1 (>78-fold
increase), anti-6B IgG2a (>54-fold increase), and anti-6B IgG3
(>3,162-fold increase). CpG ODN also increased anti-CRM197
IgG2a and IgG3. Adjuvant effects were not observed with control non-CpG
ODN. Thus, CpG ODN significantly enhance antipolysaccharide IgG
responses (especially IgG2a and IgG3) induced by these glycoconjugate vaccines.
The polysaccharide capsules of
encapsulated bacteria (e.g., Streptococcus pneumoniae and
Haemophilus influenzae type b) inhibit phagocytosis of these
organisms and are major virulence factors. Host protection against
infection caused by these encapsulated bacteria is mediated primarily
by anticapsular antibodies, which facilitate complement deposition and
allow for opsonization and phagocytosis (15). Capsular
polysaccharides, however, are T-independent type 2 antigens and thus
induce B-cell responses that are characterized by low-affinity
antibodies with a limited subclass distribution (primarily
immunoglobulin M [IgM] and IgG3 in mice; primarily IgM and IgG2 in
humans) and a lack of immunologic memory (reviewed in reference
18). In addition, the abilities of some groups of
patients (such as young children, the elderly, and immunocompromised patients) to respond to bacterial polysaccharides is impaired, making
them more susceptible to disease caused by these pathogens.
Vaccines consisting of bacterial polysaccharides conjugated to a
protein carrier have provided a successful approach for generating enhanced humoral immunity against the encapsulated bacterial pathogen, H. influenzae type b, via T-cell-dependent mechanisms
(21). This approach is particularly important in high-risk
populations, such as young children, and has led to a dramatic
reduction in infections with H. influenzae type b in the
United States (1). The carrier protein presumably allows for
stimulation and expansion of carrier protein-specific T cells, which
can then provide help for polysaccharide-specific B cells, thus
allowing for affinity maturation, Ig class switching, and the
development of B-cell memory.
While glycoconjugate vaccines are currently licensed in the United
States for use against H. influenzae type b, the development of vaccines against other encapsulated organisms such as S. pneumoniae and Neisseria meningiditis is still ongoing.
Clinical trials have assessed a heptavalent vaccine for S. pneumoniae, consisting of seven different serotype-specific
pneumococcal capsular polysaccharides conjugated to a carrier protein,
CRM197, a nontoxic mutant of diphtheria toxin (2, 12,
17, 19, 30). This heptavalent pneumococcal
polysaccharide-CRM197 glycoconjugate vaccine effectively generates antipolysaccharide antibody responses in humans
(19). With conventional glycoconjugate vaccines, however,
multiple doses are required to achieve protective immunity in
children. In addition, variable levels of antipolysaccharide
antibodies are produced against different pneumococcal
serotype-specific polysaccharides (19, 23, 32). Thus,
current and future glycoconjugate vaccines could be significantly
improved if adjuvants enhanced their immunogenicities so as to
consistently provide high antibody titers to all serotypes with a
minimum number of injections.
Short oligodeoxynucleotides (ODN) that contain unmethylated CpG motifs
have been demonstrated to be potent adjuvants for protein antigens,
increasing specific antibodies, gamma interferon (IFN- The studies presented here tested the ability of CpG ODN to enhance
production of antipolysaccharide antibodies after immunization of mice
with polysaccharide-protein conjugate vaccines consisting of
pneumococcal polysaccharide type 19F or type 6B conjugated to
CRM197. These polysaccharides derive from common
pneumococcal serotypes that are virulent in humans, and they are
components of the experimental heptavalent pneumococcal vaccine
described above. CpG ODN significantly enhanced polysaccharide-specific IgG2a and IgG3, and polysaccharide-specific IgG1 and IgM were increased
to a lesser degree. Similar to other studies using protein antigens
(5, 7, 16, 27), CpG ODN also enhanced antibody responses to
the protein carrier, CRM197, particularly
CRM197-specific IgG2a and IgG3.
This is the first study to examine the ability of CpG ODN to act as
adjuvants for antipolysaccharide antibody responses after immunization
with a polysaccharide-protein conjugate vaccine. Other studies
regarding the effect of CpG ODN on antipolysaccharide antibody
responses following immunization with unconjugated polysaccharide antigens have produced mixed results, depending on the composition of
the vaccine, the length and sequence of the CpG ODN, and the dose of
CpG ODN administered (28, 29). Unconjugated polysaccharide vaccines, however, do not elicit T-cell help, and modulation of T-cell
help for antibody responses may be an important mechanism for adjuvant
activity of CpG ODN. These results indicate that CpG ODN act as
adjuvants that effectively enhance antipolysaccharide antibody
responses after immunization with a pneumococcal polysaccharide-protein conjugate vaccine.
Synthetic ODN.
Synthetic ODN were from Operon Technologies
(Alameda, Calif.) or Oligos Etc. (Wilsonville, Oreg.). ODN were
phosphorothioate modified to increase their resistance to nuclease
degradation. ODN with the following sequences were used (CpG motifs or
reversed non-CpG motifs are underlined): CpG ODN 1826, TCCATGACGTTCCTGACGTT; non-CpG ODN
1982, TCCAGGACTTCTCTCAGGTT; CpG ODN
1760, ATAATCGACGTTCAAGCAAG; and non-CpG ODN
1908, ATAATAGAGCTTCAAGCAAG. These ODN have been well characterized for adjuvant activity in protein antigen systems (5). ODN were dissolved in 10 mM Tris-1 mM EDTA.
Lipopolysaccharide content of ODN was <1 ng/mg of DNA, as measured by
Limulus amebocyte assay (QCL-1000; BioWhittaker,
Walkersville, Md.).
Mice and immunizations.
BALB/c ByJ female mice (The Jackson
Laboratory, Bar Harbor, Maine) were housed under specific-pathogen-free
conditions and used at 7 to 9 weeks of age. Mice were bled by tail vein
on day 0, prior to immunization. Immunizations were performed and
assessed using conditions (e.g., antigen dose and time points for
bleeding) that were characterized in our prior published studies with
these glycoconjugates (17) and in other preliminary studies
(data not shown). The studies presented here used an amount of
glycoconjugate to achieve doses of 5 µg of total polysaccharide and
7.5 µg of CRM197 per mouse (see below). Without the
addition of CpG ODN, this was a suboptimal dose that produced
antipolysaccharide antibodies (see below) but not the higher titers
that were obtained with doses of 10 to 20 µg of total polysaccharide
per mouse. The dose of ODN was optimized in preliminary studies and was
similar to that used in previously published studies of immunization
with protein antigens (5). Mice were injected
intraperitoneally (i.p.) to be consistent with optimization in prior
studies and to allow for the required vaccine volume in this
small-animal model. Mice were injected i.p. on days 0 and 14 with
vaccines containing S. pneumoniae polysaccharide type 19F or
6B conjugated to CRM197 (19F-CRM197 or
6B-CRM197, respectively; generously provided by
Wyeth-Lederle Vaccines, West Henrietta, N.Y.). The approximate concentrations of polysaccharide and protein in the stock vaccine preparations were as follows: 19F-CRM197, 0.504 mg of
carbohydrate/ml and 0.759 mg of protein/ml; 6B-CRM197,
0.497 mg of carbohydrate/ml and 0.718 mg of protein/ml (personal
communication from Ronald Eby, Wyeth-Lederle Vaccines). The stock
preparations of 19F-CRM197 or 6B-CRM197 were
mixed with ODN in pyrogen-free 0.9% NaCl solution (Sigma Chemical
Company, St. Louis, Mo.) and diluted to achieve 5 µg of total
polysaccharide, 7.5 µg of CRM197, and 100 µg of ODN per
mouse with an injection volume of 0.2 ml. Mice were bled weekly by tail
vein at the indicated times.
ELISA for detection of specific antibody.
Ninety-six well
plates (Immunosorp or Maxisorp; Nalge Nunc, Naperville, Ill.) were
coated with purified pneumococcal type 19F or 6B polysaccharide (1 to
10 µg/ml; American Type Culture Collection, Manassas, Va.) in
phosphate-buffered saline (PBS) or with purified CRM197 (1 µg/ml; courtesy of Wyeth-Lederle Vaccines) in 0.1 M sodium
bicarbonate buffer overnight at 4°C, washed in PBS with 0.5% Tween,
and blocked with PBS containing 1% bovine serum albumin (BSA) for
1 h at room temperature. For the 19F and 6B enzyme-linked
immunosorbent assays (ELISAs), purified S. pneumoniae cell
wall polysaccharide (purchased from Wyeth-Lederle Vaccines) was added
at 50 µg/ml to neat mouse sera to block any antibodies specific for
contaminating cell wall polysaccharide. Mouse sera were then serially
diluted in PBS with 1% BSA and incubated in the polysaccharide-coated
plates overnight at 4°C. The plates were washed, and one of the
following detecting antibodies was added in PBS with 0.5% Tween and
1% BSA for 1 h at room temperature. The detecting antibody for
total polysaccharide-specific Ig was goat anti-mouse kappa
chain-alkaline phosphatase conjugate, and individual isotypes were
detected by alkaline phosphatase conjugates of antibodies specific for
mouse IgG1, IgG2a, IgG3, or IgM (Southern Biotechnology Associates,
Birmingham, Ala.). Plates were developed with p-nitrophenyl
phosphate (50 mg/ml in 2.5 M sodium bicarbonate-2.5 M magnesium
chloride). Absorbance at 405 nm was determined using a Bio-Rad
(Hercules, Calif.) model 550 microplate reader. Each serum titration
was assayed in duplicate, and an internal positive reference serum was
used to ensure comparable plate values for each set of assays. Titers
were determined at an optical density (OD) of 0.5, using two-point
curve fit analysis (Microplate Manager III program; Bio-Rad). Two-point
curve fit analysis was used to plot the line between the dilution
points of each curve that encompassed an OD of 0.5. A dilution
x value (titer) was then interpolated for the y
value of 0.5, using the line equation generated by two-point curve fit
analysis. Statistical differences between geometric mean titer values
were determined by the Mann-Whitney U test. When the maximum
OD was less than 0.5, indicating a titer of <1, a titer value of zero
was assigned for statistical purposes.
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
CpG Oligodeoxynucleotides Act as Adjuvants for
Pneumococcal Polysaccharide-Protein Conjugate Vaccines and Enhance
Antipolysaccharide Immunoglobulin G2a (IgG2a) and IgG3
Antibodies
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) secretion by
Th cells, and cytolytic T-cell responses (5, 7, 13, 16, 20).
The CpG motif is derived from sequences found in bacterial DNA and
consists of a central unmethylated CpG dinucleotide preferentially
flanked by two 5' purines and two 3' pyrimidines (14). B
cells, NK cells, macrophages, and dendritic cells are all directly
activated by CpG DNA, resulting in production of cytokines such as
IFN-
, interleukin-6 (IL-6), IL-12, and tumor necrosis factor alpha,
as well as increased NK cell killer activity (14, 25, 26,
33). The activation of these immune cells by CpG DNA allows for
modulation of antigen-specific immune responses.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
| |
RESULTS |
|---|
|
|
|---|
CpG ODN enhance total antipolysaccharide antibodies after
immunization with a pneumococcal polysaccharide-protein conjugate
vaccine, 19F-CRM197, and particularly enhance
anti-polysaccharide IgG2a and IgG3.
To determine whether CpG ODN
act as adjuvants for antipolysaccharide responses after immunization
with a pneumococcal polysaccharide-protein conjugate, BALB/c ByJ mice
were injected i.p. with 19F-CRM197 with or without 100 µg
CpG ODN 1826 or 100 µg of control non-CpG ODN 1982 in pyrogen-free
saline on days 0 and 14. Sera were collected 2 weeks after the second
immunization (day 28) and tested for the presence of anti-19F
antibodies by ELISA. In the representative experiment shown in Fig.
1, the geometric mean titer (± standard error of the mean [SEM]) of total anti-19F antibody was increased significantly (23-fold) by addition of CpG ODN 1826 (Fig. 1A and data
not shown). CpG-specific enhancement was particularly marked for
certain antibody isotypes. As shown in Fig. 1C and D, the addition of
CpG ODN 1826 significantly increased the geometric mean titers of
anti-19F IgG2a (26-fold) and anti-19F IgG3 (>246-fold, from <1 to
246). Enhancements of IgG1 and IgM were seen, but the differences in
mean titer were not statistically significant. Non-CpG ODN failed to
produce significant enhancements of antibody titers, indicating the
presence of a CpG-specific effect. The antibodies detected in this
assay were specific for the 19F polysaccharide, since sera from mice
immunized with 19F-CRM197 failed to bind the 6B
polysaccharide in a 6B-specific ELISA (data not shown). The inclusion
of soluble 19F to 19F-coated plates during their incubation with sera
competitively inhibited the binding of antibody to the plates,
confirming the specificity of the assay. Unimmunized or sham-immunized
animals had little or no 19F-specific antibody, and mean titers were
zero for all groups of unimmunized mice for all antibody isotypes,
consistent with our previously published data (17). These
results demonstrate that CpG ODN enhanced anti-19F antibody responses,
primarily as a result of significant enhancement of IgG2a and IgG3
responses.
|
CpG ODN also enhance antibody responses to a second pneumococcal
polysaccharide-protein conjugate vaccine, 6B-CRM197.
A
similar adjuvant effect for antipolysaccharide responses was seen in
mice that were immunized twice (days 0 and 14) with a different
glycoconjugate vaccine preparation, 6B-CRM197, with or
without 100 µg of CpG ODN or non-CpG ODN in saline. As shown in Fig.
2, CpG ODN 1826 significantly enhanced
the geometric mean titer of total anti-6B antibody (36-fold increase)
in sera collected from mice on day 28. These studies showed
particularly marked and significant increases in geometric mean titers
of anti-6B IgG2a (54-fold increase) and anti-6B IgG3 (>3,162-fold
increase, from <1 to 3,162). Interestingly, significant increases in
anti-6B IgG1 were also seen, as BALB/c ByJ mice immunized with
6B-CRM197 alone did not produce detectable levels of
anti-6B IgG1 (anti-6B IgG1 titer increased >78-fold, from <1 to 78).
Anti-19F IgM titer was increased 3.9-fold by the addition of CpG ODN
1826, but this change was not statistically significant. In contrast to
the results with CpG ODN 1826, non-CpG ODN 1982 did not significantly
affect the levels or isotype profile of anti-6B antibodies. Unimmunized animals had little or no 6B-specific antibody, consistent with our
previously published data (17). Thus, CpG ODN essentially converted BALB/c ByJ mice from anti-6B IgG nonresponders to anti-6B IgG
responders for all IgG isotypes that were assessed in these studies.
This is consistent with the ability of CpG ODN to enhance isotype
switching to different IgG subclasses, including IgG1 and IgG2a, as
previously described for protein antigens (7).
|
CpG ODN do not alter the kinetics of the anti-19F antibody response
after immunization with 19F-CRM197.
To determine the
kinetics of the anti-19F antibody response after treatment with CpG ODN
1826, anti-19F antibodies were measured for up to 9 weeks after
immunization on days 0 and 14. As shown in Fig.
3, CpG ODN 1826 did not accelerate the
rate of production of anti-19F antibodies, and strong antibody
responses of all isotypes were not detected until 1 week after the
second immunization. Anti-19F antibody titers declined over time, but
CpG ODN-mediated enhancement of total anti-19F antibodies and anti-19F
IgG2a and IgG3 was still detectable on day 63, although the statistical significance of the enhancement at this time point varied with isotype.
For the differences on day 63 between mice immunized with
19F-CRM197 versus 19F-CRM197 plus CpG ODN 1826, P values were 0.132 for total anti-19F, 0.064 for anti-19F
IgG2a, and 0.008 for anti-19F IgG3.
|
CpG ODN enhance antibodies against the CRM197 carrier
protein after immunization with 19F-CRM197.
Anti-CRM197 antibody responses were examined after
immunization of mice (on days 0 and 14) with 19F-CRM197.
The addition of CpG ODN 1826 significantly enhanced
anti-CRM197 IgG2a and IgG3 titers measured on day 28 (Fig.
4). Increases in total
anti-CRM197 antibodies and in anti-CRM197 IgG1
were also detected but did not reach statistical significance. As
expected, non-CpG ODN 1982 did not increase anti-CRM197
antibodies. Unimmunized animals had little or no
CRM197-specific antibody. These results are consistent with
previous studies demonstrating an adjuvant effect of CpG ODN for
antibody responses against protein antigens, particularly for
enhancement of IgG2a and IgG3 (5, 7, 16, 27).
|
| |
DISCUSSION |
|---|
|
|
|---|
Current glycoconjugate vaccines for H. influenzae type b require multiple doses to elicit protective antibody titers. In addition, clinical trials with new pneumococcal polysaccharide-protein conjugates have shown variable responses with different polysaccharide serotypes. While glycoconjugate vaccines generate greater antipolysaccharide antibody responses of greater isotype range (mainly IgM and IgG1 in mice) than pure polysaccharide vaccines, further increases in response rate and magnitude and expansion of isotypes are desirable. Thus, it is interesting to explore the possibility that some remaining limitations of glycoconjugate vaccines could be addressed by the inclusion of an adjuvant to enhance their immunogenicity.
The present studies demonstrate that CpG ODN act as adjuvants to increase total antipolysaccharide antibodies after glycoconjugate immunization and also expand isotypes of the antipolysaccharide response. CpG ODN enhanced polysaccharide-specific antibody responses after immunization with either 19F-CRM197 or 6B-CRM197, and CpG-specific enhancement of antibody responses persisted for up to 7 weeks after immunization. CpG ODN increased geometric mean titers of total antipolysaccharide antibodies 23- to 36-fold after immunization with 19F-CRM197 or 6B-CRM197 (Fig. 1 and 2), and particularly significant CpG-associated increases in polysaccharide-specific IgG2a (26- to 54-fold) and IgG3 (>246- to >3,162-fold) were consistently seen. Induction of IgG responses was especially notable in studies with 6B-CRM197. BALB/c ByJ mice did not make 6B-specific IgG when 6B-CRM197 was administered alone (even IgG1 responses were not detected), yet substantial IgG1, IgG2a, and IgG3 anti-6B responses were produced when 6B-CRM197 was administered with CpG ODN. These results indicate that CpG ODN are effective adjuvants for glycoconjugate vaccines that not only elevate antipolysaccharide antibody responses in responders but may also convert IgG nonresponders to IgG responders, a point of potential clinical significance.
CpG ODN provided effective adjuvant activity in mice after two injections with an experimental glycoconjugate vaccine in saline vehicle without additional adjuvant. Additional studies are necessary to optimize the use of CpG ODN, evaluate possible combinations of CpG ODN with other adjuvants, and establish the effectiveness of CpG ODN for use in humans with a multivalent glycoconjugate vaccine. Preliminary studies showed CpG-specific enhancements of antipolysaccharide antibody responses in mice when alum was included in the glycoconjugate vaccine preparation (data not shown). It is possible that the combination of CpG ODN with additional adjuvant components, e.g., alum, may provide longer-lasting CpG-specific increases in antipolysaccharide antibodies and/or long-lasting immunity with fewer injections. Alum is already used to enhance responses to many human vaccines, including the multivalent pneumococcal polysaccharide-CRM197 conjugate vaccine that is being examined in human trials (personal communication from S. Pillai and R. Eby, Wyeth-Lederle Vaccines). In summary, our results establish the principle that CpG ODN can significantly enhance antipolysaccharide antibody responses after immunization of mice with a polysaccharide-protein conjugate vaccine. Future studies are needed to optimize the use of CpG ODN with glycoconjugate vaccines in humans and determine whether CpG ODN can increase titers of antibodies against all pneumococcal polysaccharides in a multivalent glycoconjugate vaccine.
The ability of CpG ODN to expand the antibody isotypes represented in
antipolysaccharide responses may have significant functional impact in
vivo. Several lines of evidence suggest that IgG2a and IgG3 may be
protective during infection with encapsulated bacteria, including
pneumococcal infection. In the mouse, IgG2a and IgG3 are highly
effective at fixing complement and promoting opsonophagocytosis (6, 8-10, 22), and IgG2a binds to the high-affinity
macrophage Fc
receptor (31). In addition, passively
administered IgG3 antibodies directed against pneumococcal capsular
polysaccharide type 3 or phosphocholine in the cell wall provide better
protection of mice from lethal pneumococcal infection than IgM or IgA
(4). These considerations suggest that the changes in
antipolysaccharide antibody isotypes and titers that were associated
with CpG ODN in these studies may enhance host protection against
pneumococcal infection, although the ability of antipolysaccharide
antibodies enhanced by CpG ODN to protect against S. pneumoniae infection in an in vivo model or in humans remains to
be determined.
As an adjuvant for antipolysaccharide antibody responses to a glycoconjugate vaccine, CpG ODN could influence polysaccharide-specific B cells either directly or indirectly (via enhancement of T-cell help). CpG ODN can mediate direct activation of B cells in vitro, inducing proliferation, antibody production, and isotype switching (7, 14). CpG ODN-mediated increases in antibody secretion in vitro are of greater magnitude when B cells are simultaneously stimulated via surface Ig receptors (14), suggesting a possible role for CpG ODN in augmenting antigen-specific responses. On the other hand, it is likely that the major in vivo effect of CpG ODN on B-cell responses to glycoconjugate vaccines is mediated by increasing carrier-specific Th responses and cytokine secretion to provide increased T-cell help for polysaccharide-specific B cells that present glycoconjugate-derived peptides to T cells. The direct activation of antigen-presenting cells may also increase such Th responses via increased costimulation and/or antigen presentation (3, 11, 25). The importance of enhanced T-cell responses to the adjuvant effect of CpG ODN is supported by preliminary experiments with CpG ODN and unconjugated pneumococcal capsular polysaccharides. Antibody responses induced by unconjugated pneumococcal capsular polysaccharides were enhanced by CpG ODN to only a minor degree (e.g., a 3-fold enhancement of total anti-19F antibody titer), and CpG-specific enhancement of antipolysaccharide antibody titers was generally about 10-fold less efficient than with glycoconjugate (data not shown). This suggests that CpG-enhanced T-cell help provides the major mechanism for the adjuvant effect of CpG ODN for enhancing antipolysaccharide antibody responses to these glycoconjugate vaccines.
CpG ODN were found to enhance antipolysaccharide antibody responses of
multiple isotypes, especially after immunization with 6B-CRM197. The enhancement of antipolysaccharide IgG2a and
IgG3 antibodies by CpG ODN may be partly explained by indirect effects that are mediated by CpG ODN-induced cytokines. For example, CpG ODN
induce IFN-
, which causes class switching to IgG2a and IgG3 (24). IFN-
induced by CpG ODN could be secreted by NK
cells (stimulated by IL-12 from macrophages activated by CpG ODN) or antigen-specific Th1 cells (specific for carrier protein, e.g., CRM197, in the case of a glycoconjugate vaccine). The
development of antigen-specific IFN-
-secreting Th1 cells is enhanced
by immunization with CpG ODN and protein antigens (5, 20,
27). In addition, however, CpG ODN have been reported to enhance
in vitro isotype switching to IgG1 (with simultaneous exposure of B
cells to IL-4) as well as IgG2a (with simultaneous exposure of B cells
to IFN-
) (7). Thus, the effects of CpG ODN do not all
follow the simple predictions associated with responses labeled
"Th1", and this may explain the enhancement of anti-6B IgG1 by CpG
ODN. Our previous study of the adjuvant function of CpG ODN for immune
responses to protein antigen (5) did not reveal enhancement
of IgG1 responses by CpG ODN when added to a control vaccine containing
incomplete Freund's adjuvant (IFA) because IgG1 responses were already
effectively induced by antigen in IFA. IFA was not a component of the
vaccines used in this study and is not an adjuvant that is used in
humans. In summary, following immunization of mice with a clinically
relevant polysaccharide-protein conjugate vaccine, CpG ODN enhanced
responses of multiple IgG isotypes (including IgG1, IgG2a, and IgG3).
The development of effective glycoconjugate vaccines is crucial for the prevention of diseases caused by encapsulated bacteria, and the development of effective adjuvants may have an important impact on this effort. Effective adjuvants could potentially reduce the number of doses needed to establish protective immunity (thereby providing protective immunity within a shorter period and at reduced cost) and provide more uniform effectiveness for the induction of responses to various polysaccharide serotypes. This study demonstrates that CpG ODN significantly enhance antipolysaccharide antibody responses and induce antibody isotypes that may give increased protection against infection. Moreover, under some circumstances, CpG ODN may convert IgG nonresponders to responders for a particular polysaccharide serotype (e.g., 6B in this study), potentially extending the proportion of the population that is effectively protected by a polysaccharide-protein conjugate vaccine. These findings indicate the importance of future studies in humans to determine the efficacy of CpG ODN as adjuvants for glycoconjugate vaccines.
| |
ACKNOWLEDGMENTS |
|---|
J.R.S. and C.V.H. share senior authorship.
We thank Mark Schluchter for statistical analyses, Cindy Brenneman for technical assistance, and Subramanian Pillai and Ronald Eby (Wyeth-Lederle Vaccines, West Henrietta, N.Y.) for generously providing CRM197, 6B-CRM197, and 19F-CRM197. ODN and much valuable advice were provided by Arthur Krieg, University of Iowa, Iowa City.
This work was supported by NIH grants AI35726 and AI34343 to C.V.H., AI27862 and AI32596 to J.R.S., and AI41657 to N.S.G. Additional support was provided by a grant from Wyeth-Lederle Vaccines. R.S.C. was supported in part by NIH grant 5T32 GM07250-21.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address for Clifford V. Harding: Department of Pathology, Case Western Reserve University, BRB 925, 10900 Euclid Ave., Cleveland, OH 44106. Phone: (216) 368-5059. Fax: (216) 368-1300. E-mail: cvh3{at}po.cwru.edu. Mailing address for John R. Schreiber: Division of Infectious Diseases, Rainbow Babies and Children's Hospital, 11100 Euclid Ave., Cleveland, OH 44106. Phone: (216) 844-3645. Fax: (216) 844-8362. E-mail: jrs3{at}po.cwru.edu.
Editor: E. I. Tuomanen
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Adams, W. G.,
K. A. Deaver,
S. L. Cochi,
B. D. Plikaytis,
E. R. Zell,
C. V. Broome, and J. D. Wenger.
1993.
Decline of childhood Haemophilus influenzae type b (Hib) disease in the Hib vaccine era.
JAMA
269:221-226 |
| 2. |
Anderson, P.
1983.
Antibody responses to Haemophilus influenzae type b and diphtheria toxin induced by conjugates of oligosaccharides of the type b capsule with the nontoxic protein CRM197.
Infect. Immun.
39:233-238 |
| 3. | Askew, D., R. Chu, A. Krieg, and C. V. Harding. 1999. CpG DNA and LPS cause dendritic cell (DC) maturation with distinct effects on nascent and recycling MHC-II antigen processing. FASEB J. 13:A279. |
| 4. | Briles, D. E., J. L. Claflin, K. Schroer, and C. Forman. 1981. Mouse IgG3 antibodies are highly protective against infection with Streptococcus pneumoniae. Nature 294:88-90[CrossRef][Medline]. |
| 5. |
Chu, R.,
O. S. Targoni,
A. M. Krieg,
P. V. Lehmann, and C. V. Harding.
1997.
CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity.
J. Exp. Med.
186:1623-1631 |
| 6. | Cooper, L. J., J. C. Schimenti, D. D. Glass, and N. S. Greenspan. 1991. H chain C domains influence the strength of binding of IgG for streptococcal group A carbohydrate. J. Immunol. 146:2659-2663[Abstract]. |
| 7. |
Davis, H. L.,
R. Weeranta,
T. J. Waldschmidt,
L. Tygrett,
J. Schorr, and A. M. Krieg.
1998.
CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen.
J. Immunol.
160:870-876 |
| 8. | Ey, P. L., G. J. Russell-Jones, and C. R. Jenkin. 1980. Isotypes of mouse IgG-I. Evidence for "non-complement-fixing" IgG1 antibodies and characterization of their capacity to interfere with IgG2 sensitization of target red blood cells for lysis by complement. Mol. Immunol. 17:699-710[CrossRef][Medline]. |
| 9. | Greenspan, N. S., and L. J. N. Cooper. 1992. Intermolecular cooperativity: a clue to why mice have IgG3? Immunol. Today 13:164-168[CrossRef][Medline]. |
| 10. | Greenspan, N. S., W. J. Monafo, and J. M. Davie. 1987. Interaction of IgG3 anti-streptococcal group A carbohydrate (GAC) antibody with streptococcal group A vaccine: enhancing and inhibiting effects of anti-GAC, anti-isotypic, and anti-idiotypic antibodies. J. Immunol. 138:285-292[Abstract]. |
| 11. |
Jakob, T.,
P. S. Walker,
A. M. Krieg,
M. C. Udey, and J. C. Vogel.
1998.
Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA.
J. Immunol.
161:3042-3049 |
| 12. | Käyhty, H., and J. Eskola. 1996. New vaccines for the prevention of pneumococcal infections. Emerg. Infect. Dis. 2:289-298[Medline]. |
| 13. |
Kovarik, J.,
P. Bozzotti,
L. Love-Homan,
M. Pihlgren,
H. L. Davis,
P. H. Lambert,
A. M. Krieg, and C. A. Siegrist.
1999.
CpG oligodeoxynucleotides can circumvent the Th2 polarization of neonatal responses to vaccines but may fail to fully redirect Th2 responses established by neonatal priming.
J. Immunol.
162:1611-1617 |
| 14. | Krieg, A. M., A.-K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, and D. M. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B cell activation. Nature 374:546-549[CrossRef][Medline]. |
| 15. |
Lee, C.-J.
1987.
Bacterial capsular polysaccharides biochemistry, immunity and vaccine.
Mol. Immunol.
24:1005-1019[CrossRef][Medline].
|
| 16. | Lipford, G. B., M. Bauer, C. Blank, R. Reiter, H. Wagner, and K. Heeg. 1997. CpG-containing synthetic oligonucleotides promote B and cytotoxic T cell responses to protein antigen: a new class of vaccine adjuvants. Eur. J. Immunol. 27:2340-2344[Medline]. |
| 17. |
McCool, T. L.,
C. V. Harding,
N. S. Greenspan, and J. R. Schreiber.
1999.
B- and T-cell immune responses to pneumococcal conjugate vaccines: divergence between carrier- and polysaccharide-specific immunogenicity.
Infect. Immun.
67:4862-4869 |
| 18. | Mond, J. J., A. Lees, and C. M. Snapper. 1995. T cell-independent antigens type 2. Annu. Rev. Immunol. 13:655-692[CrossRef][Medline]. |
| 19. |
Rennels, M. B.,
K. M. Edwards,
H. L. Keyserling,
K. S. Reisinger,
D. A. Hogerman,
D. V. Madore,
I. Chang,
P. R. Paradiso,
F. J. Malinoski, and A. Kimura.
1998.
Safety and immunogenicity of heptavalent pneumococcal vaccine conjugated to CRM197 in United States infants.
Pediatrics
101:604-611 |
| 20. | Roman, M., E. Martin-Orozco, J. S. Goodman, M. D. Nguyen, Y. Sato, A. Ronaghy, R. S. Kornbluth, D. D. Richman, D. A. Carson, and E. Raz. 1997. Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nat. Med. 3:849-854[CrossRef][Medline]. |
| 21. |
Schneerson, R.,
O. Barrera,
A. Sutton, and J. B. Robbins.
1980.
Preparation, characterization, and immunogenicity of Haemophilus influenzae type b polysaccharide-protein conjugates.
J. Exp. Med.
152:361-376 |
| 22. | Schreiber, J. R., L. J. N. Cooper, S. Diehn, P. A. Dahlhauser, M. F. Tosi, D. D. Glass, M. Patawaran, and N. S. Greenspan. 1993. Variable region-identical monoclonal antibodies of different IgG subclass directed to Pseudomonas aeruginosa lipopolysaccharide O-specific side chain function differently. J. Infect. Dis. 167:221-226[Medline]. |
| 23. | Shinefield, H. R., S. Black, P. Ray, I. Chang, N. Lewis, B. Fireman, J. Hackell, P. R. Paradiso, G. Siber, R. Kohberger, D. V. Madore, F. J. Malnowski, A. Kimura, C. Le, I. Landaw, J. Aguilar, and J. Hansen. 1999. Safety and immunogenicity of heptavalent pneumococcal CRM197 conjugate vaccine in infants and toddlers. Pediatr. Infect. Dis. 18:757-763[CrossRef][Medline]. |
| 24. | Snapper, C. M., and J. J. Mond. 1993. Towards a comprehensive view of immunoglobulin class switching. Immunol. Today 14:15-17[CrossRef][Medline]. |
| 25. | Sparwasser, T., E. S. Koch, R. M. Vabulas, K. Heeg, G. B. Lipford, J. W. Ellwart, and H. Wagner. 1998. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur. J. Immunol. 28:2045-2054[CrossRef][Medline]. |
| 26. | Stacey, K. J., M. J. Sweet, and D. A. Hume. 1996. Macrophages ingest and are activated by bacterial DNA. J. Immunol. 157:2116-2122[Abstract]. |
| 27. |
Sun, S.,
H. Kishimoto, and J. Sprent.
1998.
DNA as an adjuvant: capacity of insect DNA and synthetic oligodeoxynucleotides to augment T cell responses to specific antigen.
J. Exp. Med.
187:1145-1150 |
| 28. | Threadgill, D. S., L. L. McCormick, T. L. McCool, N. S. Greenspan, and J. R. Schreiber. 1998. Mitogenic synthetic polynucleotides suppress the antibody response to a bacterial polysaccharide. Vaccine 16:76-82[CrossRef][Medline]. |
| 29. | Tygrett, L., S. Wiechert, X. Li, K. Takahashi, A. Krieg, and T. Waldschmidt. 1999. Capacity of CpG ODN to enhance TNP-Ficoll responses in mice. FASEB J. 13:A990. |
| 30. |
Uchida, T.,
A. M. Pappenheimer, Jr., and A. A. Harper.
1972.
Reconstitution of diphtheria toxin from two nontoxic cross-reacting mutant proteins.
Science
175:901-903 |
| 31. | Unkeless, J. C., E. Scigliano, and V. H. Freedman. 1988. Structure and function of human and murine receptors for IgG. Annu. Rev. Immunol. 6:251-281[CrossRef][Medline]. |
| 32. | Vernacchio, L., E. J. Neufeld, K. MacDonald, S. Kurth, S. Murakami, C. Hohne, M. King, and D. Molrine. 1998. Combined schedule of 7-valent pneumococcal conjugate vaccine followed by 23-valent pneumococcal vaccine in children and young adults with sickle cell disease. J. Pediatr. 133:275-278[CrossRef][Medline]. |
| 33. | Yamamoto, S., T. Yamamoto, S. Shimada, E. Kuramoto, O. Yano, T. Kataoka, and T. Tokunaga. 1992. DNA from bacteria, but not from vertebrates, induces interferons, activates natural killer cells and inhibits tumor growth. Microbiol. Immunol. 36:983-997[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»