Previous Article | Next Article ![]()
Infection and Immunity, April 2000, p. 1919-1927, Vol. 68, No. 4
INSERM U447, Institut Pasteur de Lille, 59019 Lille Cedex,1 and Laboratoire des
Bordetella, Institut Pasteur, 75724 Paris Cedex
15,2 France
Received 23 August 1999/Returned for modification 21 October
1999/Accepted 20 December 1999
In gram-negative bacteria, high-affinity iron uptake requires the
TonB/ExbB/ExbD envelope complex to release iron chelates from their
specific outer membrane receptors into the periplasm. Based on sequence
similarities, the Bordetella pertussis tonB exbB exbD locus
was identified on a cloned DNA fragment. The tight organization of the
three genes suggests that they are cotranscribed. A putative
Fur-binding sequence located upstream from tonB was detected in a Fur titration assay, indicating that the tonB exbB exbD operon may be Fur-repressed in high-iron growth conditions. Putative structural genes of the Most bacteria require an iron
concentration of 10 We were interested in deciphering the iron uptake systems and the
potential influence of the iron regulatory network in virulence in
bordetellae. Bordetella pertussis, the etiologic agent of
whooping cough, Bordetella parapertussis, which infects
humans and sheep, and Bordetella bronchiseptica, the
causative agent of swine atrophic rhinitis and kennel cough, synthesize
alcaligin, a hydroxamate-type siderophore. Bordetella
avium, a poultry pathogen, does not seem to produce
siderophore (17, 51). We and others independently identified
and characterized alcR, the gene encoding an AraC-type activator of the alcaligin biosynthesis operon in B. pertussis, B. parapertussis, and B. bronchiseptica (6, 51). The expression of the recently
identified alcaligin receptor gene is also AlcR regulated in B. bronchiseptica (6, 14). Surprisingly, the virulence of
a B. pertussis alcR null mutant is not impaired in the mouse
respiratory infection model (51). This observation suggests
that B. pertussis possesses alcaligin-independent iron uptake systems which may contribute to efficient colonization of the
host. An LF-binding protein has been detected in membrane fractions of
bordetellae, but its role in iron uptake has not been established yet
(40). In addition, several exogenous siderophore receptors
have been identified in B. pertussis. These include BfeA,
which binds enterobactin, and BfrB and BfrC, the receptors for unknown
siderophores (3, 5). A B. bronchiseptica-specific receptor, BfrA, has also been characterized, but its ligand remains unidentified (4). B. pertussis is also able to
use hemin as a sole iron source, suggesting that it produces an outer
membrane heme receptor (4). Heme uptake is Ton dependent in
several pathogens (29, 38, 60, 62), although in
Neisseria gonorrhoeae and Haemophilus ducreyi
heme uptake does not require the Ton system (8, 19). In
order to evaluate the role of the Ton system in B. pertussis
iron uptake and virulence, we first identified and characterized the
tonB exbB exbD locus in this species. A B. pertussis
Bacterial strains, plasmids, and growth conditions.
The
strains and plasmids used in this work are listed in Table
1. E. coli strains were grown
at 37°C in Luria-Bertani (LB) medium (42) or on solid
media obtained by addition of 1.5% (wt/vol) Bacto-Agar. In the Fur
titration assay (58), the Lac phenotype of E. coli H1717 transformants was tested on MacConkey lactose agar
plates containing 50 µM FeCl3. Bordetella
strains were grown at 37°C on Bordet-Gengou (BG) agar base plates
supplemented with 1% glycerol and 15% sheep blood. Liquid cultures
were usually grown in modified Stainer-Scholte (SS) medium containing
(per liter): 11.84 g of Na-L-glutamate · H2O, 0.24 g of L-proline, 2.5 g of
NaCl, 0.5 g of KH2PO4, 0.2 g of KCl,
0.1 g of MgCl2 · 6H2O, 20 mg of
CaCl2 · 2H2O, 1.5 g of Tris,
10 g of Casamino Acids, 1 g of dimethyl
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Bordetella pertussis TonB, a
Bvg-Independent Virulence Determinant
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-subunit of the histone-like protein HU and of a new two-component regulatory system were identified upstream from tonB and downstream from exbD,
respectively. A B. pertussis
tonB
exbB::Kmr mutant was constructed by allelic
exchange and characterized. The mutant was impaired for growth in
low-iron medium in vitro and could not use ferrichrome, desferal, or
hemin as iron sources. Levels of production of the major bacterial
toxins and adhesins were similar in the
TonB+/TonB
pair. The
tonB exbB
mutant was still responsive to chemical modulators of virulence; thus,
the BvgA/BvgS two-component system is not TonB dependent. Nevertheless,
in vivo in the mouse respiratory infection model, the colonization
ability of the mutant was reduced compared to the parental strain.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
6 to 10
8 M for growth.
In the host, iron is not readily available to microorganisms since
Fe(III) is bound to transferrin (TF) in the serum and to lactoferrin
(LF) in other secretions. The concentration of free iron in body fluids
is estimated to be less than 10
18 M; thus, the ability of
a pathogen to scavenge iron may represent an important virulence trait
(65). Some bacteria, e.g., Neisseria spp. and
Haemophilus influenzae, produce cell surface receptors for
TF, LF, heme, or heme-containing proteins (10, 24, 37, 53).
Others, e.g., Escherichia coli and Pseudomonas
spp., secrete low-molecular-weight iron chelators termed siderophores
which are able to remove Fe(III) from TF or LF (44).
Iron-loaded siderophores can then bind to high-affinity receptors on
the bacterial cell surface, and be internalized. In gram-negative
bacteria the TonB/ExbB/ExbD complex, referred to as the Ton system,
interacts with the outer membrane receptors involved in iron uptake and
transduces the energy required for the transfer of Fe(III) from TF and
LF or that of heme or ferrisiderophores into the periplasm. TonB is anchored in the inner membrane, where it is stabilized by the ExbB and
ExbD proteins (for a review, see reference 43).
Vitamin B12, group B colicins, and certain phages are also
delivered into the cell via specific receptors and the Ton system in
E. coli (13, 30, 50). Through a cycle of
conformational changes TonB couples the cytoplasmic membrane
protonmotive force to active transport across the outer membrane
(35).
tonB exbB mutant was constructed and compared to the parental
strain. The mutant presented reduced growth in iron-depleted medium and
was deficient in exogenous siderophores, hemin and albomycin uptake.
The mutant was also impaired in its ability to colonize the respiratory
tract of infected mice, although the expression and in vitro regulation
of Bvg-dependent virulence factors proved to be unaffected. Thus, our
data suggest that TonB-dependent transport systems are important, yet
Bvg-independent virulence traits in B. pertussis.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-cyclodextrin (a
gift from Teijin, Japan), 40 mg of L-cystein, 4 mg of
nicotinic acid, 0.4 g of ascorbic acid, 0.15 g of
glutathione, and 10 mg of FeSO4 · 7H2O.
Low-iron medium was SS without addition of FeSO4 · 7H2O (SS-Fe). Some growth tests were performed in Casamino
Acid-free SS medium or in SS supplemented with only 0.1% Casamino
Acids. Modulation conditions were obtained by the addition of 50 mM
MgSO4 or 15 mM nicotinic acid to SS. When necessary,
antibiotics were included in the growth media at the following final
concentrations: ampicillin (Ap), 150 mg/ml; chloramphenicol (Cm), 30 mg/ml; gentamicin (Gn), 10 µg/ml; kanamicin (Km), 30 µg/ml;
nalidixic acid (Nal), 30 µg/ml; streptomicin (Sm), 100 µg/ml.
TABLE 1.
Bacterial strains and plasmids
DNA techniques. Plasmid DNA was routinely isolated by the alkaline lysis method (55) or purified by using the Nucleobond AX kit (Macherey-Nagel, Hoerdt, France) for sequencing purposes. Restriction endonucleases and T4 DNA ligase were obtained from Roche (Meylan, France) and used according to standard procedures (55). DNA fragments were sequenced using an ABI PRISM Dye Terminator Cycle Sequencing kit and an ABI PRISM 377 sequencer (PE Applied Biosystems, Warrington, United Kingdom) and a combination of universal, reverse, and custom-synthesized primers. PCRs were carried out with VentR DNA polymerase (New England Biolabs, Inc., Beverly, Mass.).
Computer analysis of sequences. The nucleotide and protein sequences were analyzed by using the DNA Strider 1.2 software (Service de Biochimie et de Génétique Moléculaire du CEA, Saclay, France). Sequence similarities were identified with the help of the BLASTN and BLASTP programs (2). Sequence alignments were performed with the Multalin 5.3.3 software (18). Oligonucleotides were designed using the Oligo 5.0 software (NBI, Plymouth, Minn.).
Construction of pCG475 and pEP491 and cloning of the B. bronchiseptica tonB upstream region.
Plasmid pCG475 was
isolated from a B. pertussis partial genomic DNA library we
had previously constructed in pUC18. The BamHI
Kmr cassette was isolated from pHP45
-Km and inserted
into the unique BclI site in pCG475. The resulting plasmid,
pEP487, was digested with EcoRI, and the 5.3-kb fragment
bearing tonB exbB::
Kmr exbD
basR was cloned into the Bordetella suicide vector
pJQ200mp18rpsL (Gnr) to obtain pEP491 (Fig.
1B). E. coli SM10 was
transformed with pEP491 and used as a donor in conjugation with
B. bronchiseptica BB1015. Genomic DNA of a Gnr
Kmr BB1015 mutant bearing pEP491 inserted into the
tonB locus was digested with NsiI, which does not
cut pEP491, and ligated. The ligation mixture was used to transform
E. coli XL1-Blue to gentamicin resistance. A recombinant
plasmid resulting from the intramolecular ligation of a chromosomal
NsiI fragment containing pEP491 was isolated. Restriction
mapping of this plasmid permitted identification of the B. bronchiseptica tonB 5' region. A 2.4-kb EcoRI DNA
fragment localized immediately upstream from the tonB locus
was subcloned into pBCSK+ to yield pEP532 (Fig. 1C).
|
Construction of the B. pertussis
tonB
exbB::
Kmr mutant.
To delete
tonB and exbB in pEP491, this plasmid was
digested with SalI and religated to yield pEP549 (Fig. 1B).
Oligonucleotides T13 (5'-GCCAGTTGTCCGAGCAGCAC-3'), which
hybridizes between the first SalI site and the
PstI site in piuC, and T14
(5'-CACGACGAAGCGGCATTCCTA-3'), which hybridizes 39 bp
downstream from the EcoRI site preceding tonB, were used to amplify the tonB upstream
region from B. pertussis BPSM genomic DNA. PCR conditions
were 35 cycles of 1 min of denaturation at 96°C, 1 min of
hybridization at 60°C, and 1.5 min of elongation at 72°C. The
1.6-kb PCR product containing the B. pertussis tonB upstream
region ('piuChupB) was digested with SalI, and
the resulting 1.3-kb fragment, which bore a SalI and a
blunt-ended extremity, was inserted into pEP549 opened with
SalI and NruI to generate pEP552 (Fig. 1B). The
NruI site in pEP549 is located downstream of the
Kmr gene; thus, pEP552 still confers resistance to Km.
E. coli SM10 was transformed with pEP552 and used as a donor
in conjugation with B. pertussis BPSM. Exconjugants were
selected on BG-Nal-Km plates. All 27 isolated colonies tested showed a
Smr Kmr Gns double recombination
phenotype. Genomic DNA of two clones was prepared and subjected to
Southern blot hybridization with the 1.9-kb
KpnI-EcoRI fragment of pCG475 carrying exbB
exbD. Correct allelic exchange was confirmed in both strains. One
of these
tonB exbB::
Kmr mutants,
BPEP98, was chosen for further study.
Construction of BPEP269 and BPEP270. Plasmid pEP498 was digested with PstI and EcoRI and ligated with the 1.5-kb PstI-EcoRI fragment from pEP532 to reconstitute the 'piuC hupB tonB exbBD basR' locus in pBCSK+. Taking advantage of the XbaI site present in the multiple cloning site, the 4.5-kb XbaI-XhoI fragment was then cloned into pJQ200mp18 opened with XbaI and SalI to yield pEP636. This Gnr Bordetella suicide plasmid was introduced into BPSM and BPEP98 by conjugation with E. coli SM10(pEP636). Exconjugants were selected on BG-Sm-Gn. Two derivatives of BPSM and BPEP98 bearing pEP636 integrated on the chromosome, BPEP269 and BPEP270, respectively, were tested for iron source utilization and albomycin sensitivity.
Siderophore detection. The Chrome Azurol S (CAS) assay (56) was used to assess alcaligin production by Bordetella cells grown to stationary phase in iron-limited (SS-Fe) medium. A 0.5-ml volume of culture supernatant was added to 0.5 ml of CAS solution, and the A630 of the CAS dye was measured after incubation for 4 h at room temperature.
Iron source utilization and albomycin sensitivity tests. Fresh B. pertussis cells were scraped from BG plates and diluted into SS-Fe to an optical density at 600 nm (OD600) of 1. A 200-µl aliquot of this suspension was added to 20 ml of molten SS-Fe plus 0.1% Casamino Acids plus 10 µM EDDHA plus 0.8% agarose and poured into petri dishes. Agarose was used in plates because B. pertussis did not grow well on agar plates. Wells (4 mm in diameter) were punched in plates with a sterile plastic pipette and filled with 20 µl of 15 µM solutions of FeSO4, FeCl3, ferrichrome (Sigma Aldrich, St. Quentin Fallavier, France), desferal (a gift from Ciba-Geigy, Rueil Malmaison, France), or hemin (Sigma Aldrich) in SS-Fe or with SS-Fe alone as a control. Diameters of growth zones around wells were measured after 24 h of incubation at 37°C. To test albomycin sensitivity, 20 ml of molten SS-Fe plus 0.1% Casamino Acids plus 0.8% agarose were seeded with 200 µl of cell suspension and poured into petri dishes. Filter paper disks impregnated with 10 µl of albomycin (50 µg/ml in SS-Fe; a gift from K. Hantke and H.-P. Fiedler) or SS-Fe were applied to the surface. Growth inhibition was checked after 24 h of incubation at 37°C.
Mouse respiratory infection model.
After 24 h of growth
on BG plates, BPSM or BPEP98 cells were resuspended in saline. Mice
were intranasally infected with 50 µl of suspension containing 2 × 106 bacteria. Infected mice were sacrificed by cervical
dislocation 2 h after exposure and at 5, 8, 12, and 16 and 22 days
thereafter (two to four mice per time point). The lungs were removed
and homogenized in saline with tissue grinders. Numeration of bacteria was performed on BG. To assess stability of the
tonB
exbB::
Kmr mutation, bacteria reisolated
from the lungs of BPEP98-infected mice were tested for their resistance
to Km and the absence of desferal, ferrichrome, or hemin utilization.
All phenotypes had been retained.
B. pertussis TonB production in E. coli.
B. pertussis TonB was overexpressed using the T7 RNA
polymerase-promoter system (Novagen, Madison, Wis.). The
tonB open reading frame (ORF) was amplified from pCG475 with
primers NdeI-TonB (5'-ATATCATATGCCTAGCCCCCAATCTGGT-3') and TonB-EcoRI
(5'-ATATGAATTCTGGCGGTGTTGATAGCGTTG-3') by 35 PCR cycles of 1 min of denaturation at 96°C, 1 min of hybridization at 63°C, and 1 min of elongation at 72°C. The amplification product was digested
with NdeI and EcoRI and cloned into
pET24a+ to obtain pEP583. BL21(DE3)(pLysS) was transformed
with either pET24a+ or pEP583 and grown in LB-Km-Cm at
37°C. At an OD600 of 0.6, cells were induced with 1 mM
isopropyl-
-D-thiogalactoside (IPTG) and grown for
another 1 to 3 h before proteins were precipitated with
trichloroacetic acid (TCA).
Immunoblotting. E. coli strains were grown in LB to an OD600 of 0.6, and then 1 ml of culture was precipitated at 4°C with one-third volume of 30% TCA, pelleted, washed with 50 mM Tris-HCl (pH 8.0), and then solubilized at 95°C for 5 min in 200 µl of Laemmli buffer (32). Bordetella strains were grown in SS to an OD600 of 3, and then a culture volume corresponding to 6 OD600 units was TCA precipitated (1 OD600 unit is equivalent to 1 ml of culture at an OD600 of 1), washed, and solubilized as described above for E. coli. Aliquots [15 µl for RK5048(pSUTonBExbBD), 5 µl for BL21(DE3)(pLysS) containing pET24a+ or pEP583, and 20 µl for Bordetella strains] were resolved by electrophoresis on sodium dodecyl sulfate (SDS)-11% polyacrylamide gels. Proteins were then electrotransfered to Immobilon-P membranes (Millipore, St-Quentin-en-Yvelines, France), probed with a 1:5,000 dilution of murine monoclonal antibody (MAb) 4H4 raised against E. coli TonB (a gift from K. Postle) (34), and developed by colorimetric detection with alkaline phosphatase-conjugated secondary antibodies.
Nucleotide sequence accession numbers. Sequence data were submitted to the EMBL database under accession nos. AJ132741 and AJ132742.
| |
RESULTS |
|---|
|
|
|---|
Cloning and sequence analysis of the B. pertussis tonB exbB
exbD locus.
In the course of cloning in connection with
another research project 6 years ago, we had isolated pCG475, a
recombinant plasmid bearing a B. pertussis 3.1-kb
EcoRI DNA fragment. Sequence analysis of the insert revealed
the presence of four ORFs located on the same DNA strand (Fig. 1A).
Similarity searches with the deduced amino acid sequences suggested
that the first three ORFs encode homologues of TonB, ExbB, and ExbD and
that the fourth one codes for a transcriptional activator of a
bacterial two-component regulatory system. This latter ORF was called
basR. The putative tonB ATG start codon is
located 80 bp downstream from the EcoRI site. It is not
preceded by a sequence resembling the canonical E. coli ribosome binding site; this is often observed with B. pertussis genes. The putative exbB ATG initiation codon
at position 882 is separated from the tonB TGA stop codon by
1 bp, and the putative exbD ATG start codon at position 1859 overlaps the exbB TAA termination codon. Such a tight
organization suggests that the three genes are cotranscribed. Most
tonB genes contain a Fur-binding sequence (FBS) in their
promoter region, and their expression is repressed by Fur in iron-rich
growth conditions (22, 46, 48, 49). No obvious promoter
sequence was identified in the short region upstream from
tonB in pCG475. In addition, a pBCSK+ derivative
containing the 3-kb EcoRI-XhoI tonB exbB
exbD basR' fragment from pCG475 conferred a Lac
phenotype in the Fur titration assay, a genetic test for the presence
of FBS using an E. coli indicator strain (58)
(Fig. 1A). This suggested the absence of an FBS in the
EcoRI-XhoI fragment and therefore that pCG475
does not contain the tonB promoter. A G+C-rich inverted
sequence starting 27 bp downstream from the exbD stop codon
(GCCCGCGCCGCGGGCGCGGGC) could
constitute a termination signal for tonB exbB exbD
transcription. Alternately, this sequence could play a role in
basR expression, whose ORF starts 36 bp downstream from this
hairpin structure with an ATG at position 2409. This ORF extends to
position 3080, 60 bp upstream from the second EcoRI site
(Fig. 1A).
|
Presence of the tonB locus in other Bordetella genomes. B. parapertussis and B. bronchiseptica are closely related to B. pertussis, while B. avium is phylogenetically more distant. The presence of the tonB exbB exbD genes in these species was tested in Southern blot experiments. Chromosomal DNA from B. pertussis BPSM, B. bronchiseptica BB1015, B. parapertussis PEP, and B. avium 103004 was digested with EcoRI and probed with the 3-kb EcoRI-XhoI DNA fragment of pCG475 containing the whole tonB exbB exbD locus. A single hybridization product was detected in each genome: a 3.1-kb DNA fragment in B. pertussis and B. bronchiseptica and a larger DNA fragment, of about 10 and 15 kb, in B. parapertussis and B. avium, respectively (data not shown). Thus, the tonB exbB exbD locus is present in these four species. Furthermore, both EcoRI sites flanking this region appear to be conserved in B. pertussis and B. bronchiseptica. Since, unlike the other three species, B. avium does not seem to synthesize the siderophore alcaligin (17, 51), the presence of a ton locus in its genome suggests that iron uptake is mediated by other Ton-dependent systems in B. avium.
Cloning and sequencing of the tonB upstream
region.
To localize the tonB promoter, we first
isolated the tonB upstream region from B. bronchiseptica by using the strategy described in Materials and
Methods. The 2.4-kb EcoRI fragment located immediately upstream from tonB was cloned into pBCSK+ to
obtain pEP532 (Fig. 1C). Sequence analysis of this insert revealed the
presence of three ORFs oriented in the same direction as the
tonB gene (Fig. 1C). Databases were scanned for similarities to the deduced amino acid sequences. The first ORF translates into a
product presenting 34% of identity in a 181-aa overlap with the
C-terminal domain of MetY, an O-acetylhomoserine
sulfhydrylase involved in methionine synthesis in Leptospira
meyeri (7). The second ORF, starting 41 bp downstream
from the metY termination codon, encodes a 226-aa protein
homologous to PiuC, a putative P. aeruginosa iron uptake
factor (65% identity in a 226-aa overlap) (47). No putative
transcription terminator could be identified downstream from B. bronchiseptica piuC. A 322-bp noncoding region separates this ORF
from the next one. The third ORF, hupB, codes for the 90-aa
-subunit of a putative histone-like protein HU (71% identity with
HU-
from E. coli). A 12-bp inverted repeat, AGGCAAATCGGCGCTGCCGATTTGCCT, located
9 bp downstream from the hupB termination codon could form a
transcriptional termination signal. Another inverted repeat
GCGCGCTCGGCGCGTGCCGAGCGCGC is present 294 bp downstream from hupB. No similarity with any
sequence in the databases could be detected in the 423-bp sequence
downstream from hupB. Based on the B. bronchiseptica
piuC and B. pertussis tonB sequences, we designed
primers to PCR amplify the B. pertussis tonB upstream
region. Sequence analysis of the PCR product indicated that this region
is identical in both species.
A B. pertussis
tonB exbB mutant is affected in iron
uptake.
To construct a B. pertussis tonB null mutant,
the tonB upstream region was first spliced to the
Kmr cassette of pEP491 as described in experimental
procedures to yield pEP552 (Fig. 1B). This plasmid was then introduced
into B. pertussis BPSM. Selection for Kmr
Smr clones enabled us to isolate the
tonB
exbB::
Kmr BPEP98 mutant by allelic
exchange. BPEP98 colonies were hemolytic on BG plates, indicating that
the adenylate cyclase-hemolysin (AC-Hly) virulence factor was produced.
bvgAS mutant BPLOW was tested under the same conditions. Similar to BPSM, BPLOW could use
all five iron sources (Table 2), indicating that the iron uptake
systems involved are not Bvg dependent.
|
Iron uptake is restored by the integration of a tonB
exbBD operon copy into the
tonB exbB mutant
chromosome.
In order to complement the
tonB exbB
mutation, we first cloned the B. pertussis tonB exbBD operon
into a Bordetella multicopy plasmid. However, the
introduction of this construct into BPEP98 or BPSM greatly reduced the
viability of both strains, perhaps due to overproduction of the Ton
system (data not shown). Thus, we reconstituted the 'piuC hupB
tonB exbBD basR' locus on a Bordetella suicide plasmid
to obtain pEP636 as described in Materials and Methods. This plasmid
was then introduced into BPSM and BPEP98 by conjugation. Selection for
Gnr Smr clones enabled us to isolate BPEP269
and BPEP270 bearing pEP636 inserted on the chromosome in the
tonB region. Both strains were able to grow on SS-Fe plates
containing 5 µM EDDHA. Furthermore, as shown in Table 2, BPEP270 was
able to utilize all iron sources tested and was albomycin sensitive.
This phenotype indicated complementation of the
tonB exbB mutation.
The Ton system is required for efficient colonization in the mouse
model.
To test whether the Ton system is required for virulence,
mice were infected with either BPSM or BPEP98, and bacteria in the lungs were numerated at different time intervals after infection. As
shown in Fig. 3, the parental strain was
able to adhere and multiply in the lungs. Then, 1 week after infection,
the number of bacteria declined. The
tonB exbB mutant
behavior was different; it was unable to multiply during the first
phase of the infection, but it was cleared at a rate similar to that of
the parental strain. Thus, BPEP98 is affected in its capacity to
multiply in the respiratory tract of the mouse.
|
The
tonB exbB mutant produces virulence factors and
is sensitive to modulation signals.
The colonization of the mouse
respiratory tract depends on the production of B. pertussis
adhesins and toxins, such as filamentous hemagglutinin
(FHA), pertactin (PRN), pertussis toxin (PTX), and AC-Hly (for a
review, see reference 39). The production of these virulence factors is controlled by the two-component regulatory system
BvgAS, which undergoes phenotypic modulation in response to
MgSO4 or nicotinic acid. To investigate whether the
tonB mutation affects the production of the Bvg-dependent
virulence factors or modifies Bvg regulation, WCLs and culture
supernatants of BPSM and BPEP98 grown in SS, SS plus MgSO4,
or SS plus nicotinic acid were compared by SDS-PAGE and immunoblot
analyses. Both strains were found to produce similar amounts of FHA,
AC-Hly, PRN, and PTX (data not shown). Protein profiles of BPSM or
BPEP98 grown in modulation conditions were identical (data not shown),
indicating that BPEP98 is responsive to chemical modulators. These
observations imply that TonB is not required for virulence factor
production or for modulation.
TonB production is independent of the BvgA and AlcR
activators.
To determine whether tonB is Bvg or AlcR
regulated, the presence of TonB was examined in B. pertussis
bvgAS or alcR null mutants. WCLs of B. pertussis BPSM, BPEP98 (
tonB exbB), BPEP184
(alcR::Kmr), BPLOW
(
bvgAS), and wild-type B. bronchiseptica and
B. parapertussis strains were analyzed by immunoblotting
using MAb 4H4 raised against E. coli TonB (34).
As shown in Fig. 4, an immunoreactive
protein was detected in all Bordetella extracts (lanes 5 to
9) except for BPEP98 (lane 4). This protein had an apparent MW of
42,000 compared to about 38,000 for E. coli TonB (lane 1)
and presented the same migration profile as B. pertussis
TonB overproduced in E. coli (lane 3). TonB proteins exhibit
a retarded migration due to their high proline content. Some minor
reactive polypeptides in lanes 5 to 9 correspond probably to B. pertussis TonB degradation products since they were not observed
in the BPEP98 WCL (lane 4) but were detected in E. coli
overproducing B. pertussis TonB (lane 1). These results show
that (i) B. pertussis, B. bronchiseptica, and
B. parapertussis synthesize a TonB homologue; that (ii) this protein is absent in B. pertussis
tonB exbB, and that
(iii) B. pertussis TonB production does not require the
BvgAS system or AlcR.
|
| |
DISCUSSION |
|---|
|
|
|---|
In this study we report the identification and functional characterization of the B. pertussis tonB exbB exbD locus. In light of their tight organization, tonB, exbB, and exbD are probably transcribed as a single operon. A similar gene arrangement has been documented for the Ton systems of Neisseria meningitidis (59), N. gonorrhoeae (8), X. campestris (66) and for the first set of Vibrio cholerae tonB genes (46). In other species, such as P. putida (9), H. influenzae (28), H. ducreyi (19), Pasteurella haemolytica (23), Helicobacter pylori (61), and in the second tonB locus of V. cholerae (46), genes are clustered in the order exbB exbD tonB. In Enterobacteriaceae, tonB is not linked to the exbB exbD genes on the chromosome (15, 16, 22, 25). The E. coli tonB promoter has been shown to be Fur repressed (49), and exbB exbD are cotranscribed from an iron-regulated promoter (1). We identified an FBS upstream from tonB, suggesting that expression of the B. pertussis tonB exbBD operon is also derepressed in low-iron growth conditions.
The deduced B. pertussis TonB sequence presents the highest degree of similarity with that of P. aeruginosa TonB (48), which is in agreement with the phylogenetic proximity of these two species. A second tonB gene was recently identified in P. aeruginosa through sequence analysis of the Pseudomonas Genome Project, but its physiological role has not been identified yet (67). This tonB2 gene precedes putative exbB and exbD genes on the P. aeruginosa chromosome, unlike tonB1, which is not linked to potential exb genes (E. Pradel, personal observation). Two sets of tonB exbB exbD genes have been identified in V. cholerae, and both of them are involved in iron uptake (46). We used the Bordetella BLAST server of the Sanger Centre to scan the available B. pertussis genomic DNA sequences for similarities with tonB, exbB, and exbD. A unique tonB exbBD locus was detected in the 543 assembled contigs which cover most of the B. pertussis genome. On a distinct contig, we identified two linked ORFs encoding products similar to B. pertussis ExbB and ExbD (27 and 35% conserved residues, respectively). However, the deduced proteins showed a higher degree of sequence similarity with P. aeruginosa TolQ and TolR (52 and 38% identity, respectively) (data not shown). No second ORF similar to tonB was detected. This analysis suggests that B. pertussis possesses a unique tonB exbBD operon and potential tolQR genes. The tolQR genes were not detected in our Southern hybridization experiments on B. pertussis chromosomal DNA, probably due to insufficient sequence conservation with the exbBD probe.
The B. pertussis TonB protein was overproduced in E. coli. Recombinant B. pertussis TonB was recognized by
MAb 4H4 directed against E. coli TonB. This MAb has been
shown to bind to the proline-rich region of E. coli TonB and
to react with a unique protein in WCLs of a wide range of gram-negative
species (34). However, 4H4 recognizes two putative TonB
proteins in P. aeruginosa WCLs (34). A single
protein presenting an electrophoretic migration similar to that of
recombinant B. pertussis TonB was immunodetected in WCLs of
B. pertussis, B. parapertussis, and B. bronchiseptica. This protein was absent from the WCL of a B. pertussis
tonB exbB::Kmr mutant.
Together, these observations suggest that B. pertussis, B. bronchiseptica, and B. parapertussis produce
only one TonB protein.
We showed that a B. pertussis
tonB
exbB::Kmr mutant is more sensitive to iron
deprivation than the parental strain, while it is still able to
synthesize and secrete alcaligin in low-iron growth conditions.
Brickman and Armstrong recently characterized FauA, the B. pertussis and B. bronchiseptica alcaligin receptor, and
suggested that FauA is TonB dependent based on its primary structure
(14). The reduced growth of the
tonB exbB
strain in iron-restricted medium could result from its inability to
transfer the ferrialcaligin complex to the periplasm in the absence of TonB. Furthermore, the mutant is unable to use exogenous siderophores or hemin as sole iron source and to internalize the antibiotic albomycin, a ferrichrome structural analogue. Three additional outer
membrane siderophore receptors have been characterized in B. pertussis, and analysis of their primary structure suggested that
these proteins are TonB dependent (3, 5). Although no
B. pertussis receptor for ferrichrome, desferal
(ferrioxamine B), or hemin has been identified yet, our data indicate
that these iron uptake systems are also TonB dependent.
E. coli tonB mutants are relatively iron starved, and genes
normally regulated by Fur are derepressed even in high-iron conditions (50). We observed no difference in the iron-regulated
protein profiles of the B. pertussis
tonB
exbB::Kmr and parental strains. Most likely,
Fe(II) diffusion through porins is sufficient to maintain Fur
repression in the mutant grown in iron-rich medium (36 µM
FeSO4). Transport of periplasmic Fe(II) into the cell is
TonB independent and may occur via a cytoplasmic membrane protein
similar to the Feo system in E. coli (12). We
also showed that the production of the major B. pertussis
virulence factors, such as FHA, PRN, PTX, and AC-Hly, does not require
TonB. In addition, phenotypic modulation in response to chemical
stimuli occurs in the absence of the Ton system; thus, the BvgAS
virulence regulatory system is TonB independent. Conversely, we
established that the production of TonB in B. pertussis is
BvgAS independent, which is consistent with our observation that
ferrichrome, desferal, or hemin usage as iron sources is not affected
in a
bvgAS mutant. Thus, tonB is not part of
the bvg regulon. In addition, tonB is also not
regulated by AlcR, the transcriptional activator of alcaligin biosynthesis and receptor genes (6, 51).
We had previously reported that a B. pertussis alcR mutant,
while unable to produce alcaligin, is not impaired in a murine respiratory infection model (51). In the present study we
demonstrate that the
tonB exbB mutant is affected in its
capability to multiply in the mouse respiratory tract. This observation
suggests that TonB-dependent iron uptake systems are required for
efficient proliferation in vivo. Involvement of TonB in virulence
expression in animal models in relation with iron uptake capability has
been documented previously for H. influenzae
(29), V. cholerae (27), and
Salmonella typhimurium (64). We cannot
discard the hypothesis that the B. pertussis TonB function
may not be restricted to iron uptake. Recently, P. aeruginosa TonB has been shown to play a role in efflux-mediated
multidrug resistance (67). We can therefore not exclude that
in B. pertussis, the Ton system could be involved in the
transport of other substrates or in the expression of yet-unidentified virulence factors in the host.
| |
ACKNOWLEDGMENTS |
|---|
We thank Kathleen Postle for her encouragement and the gift of
anti-TonB MAbs, Robert Kadner and Dominique Raze for the gift of
plasmids and strains, and Klaus Hantke and Hans-Peter Fiedler for that
of albomycin. We are grateful to Eve Willery, Sabine Thiberge, and
Claudie Gantiez for technical assistance; to Emmanuelle Fort for
photographic work; and to Franck Biet and Alain Baulard for computer
counseling. We acknowledge Teijin for the supply of dimethyl
-cyclodextrin, and Ciba-Geigy for that of desferal.
This work was supported by INSERM, the Institut Pasteur de Lille, the Région Nord-Pas-de-Calais, the Fondation de l'Institut Pasteur (Paris), and the Ministère de l'Education Nationale, de la Recherche, et de la Technologie.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: INSERM U447, Institut Pasteur de Lille, 1 rue du Prof. Calmette, BP 245, 59019 Lille Cedex, France. Phone: 33 (0) 3-20-87-11-51. Fax: 33 (0) 3-20-87-11-58. E-mail: Camille.Locht{at}pasteur-lille.fr.
Editor: J. T. Barbieri
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Ahmer, B. M.,
M. G. Thomas,
R. A. Larsen, and K. Postle.
1995.
Characterization of the exbBD operon of Escherichia coli and the role of ExbB and ExbD in TonB function and stability.
J. Bacteriol.
177:4742-4747 |
| 2. |
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402 |
| 3. | Beall, B. 1998. Two iron-regulated putative ferric siderophore receptor genes in Bordetella bronchiseptica and Bordetella pertussis. Res. Microbiol. 149:189-201[Medline]. |
| 4. |
Beall, B., and T. Hoenes.
1997.
An iron-regulated outer-membrane protein specific to Bordetella bronchiseptica and homologous to ferric siderophore receptors.
Microbiology
143:135-145 |
| 5. |
Beall, B., and G. N. Sanden.
1995.
A Bordetella pertussis fepA homologue required for utilization of exogenous ferric enterobactin.
Microbiology
141:3193-3205 |
| 6. |
Beaumont, F. C.,
H. Y. Kang,
T. J. Brickman, and S. K. Armstrong.
1998.
Identification and characterization of alcR, a gene encoding an AraC-like regulator of alcaligin siderophore biosynthesis and transport in Bordetella pertussis and Bordetella bronchiseptica.
J. Bacteriol.
180:862-870 |
| 7. |
Belfaiza, J.,
A. Martel,
D. Margarita, and I. Saint Girons.
1998.
Direct sulfhydrylation for methionine biosynthesis in Leptospira meyeri.
J. Bacteriol.
180:250-255 |
| 8. | Biswas, G. D., J. E. Anderson, and P. F. Sparling. 1997. Cloning and functional characterization of Neisseria gonorrhoeae tonB, exbB and exbD genes. Mol. Microbiol. 24:169-179[CrossRef][Medline]. |
| 9. | Bitter, W., J. Tommassen, and P. J. Weisbeek. 1993. Identification and characterization of the exbB, exbD and tonB genes of Pseudomonas putida WCS358: their involvement in ferric-pseudobactin transport. Mol. Microbiol. 7:117-130[CrossRef][Medline]. |
| 10. | Bonnah, R. A., R. H. Yu, H. Wong, and A. B. Schryvers. 1998. Biochemical and immunological properties of lactoferrin binding proteins from Moraxella (Branhamella) catarrhalis. Microb. Pathog. 24:89-100[CrossRef][Medline]. |
| 11. |
Braun, V.,
S. Gaisser,
C. Herrmann,
K. Kampfenkel,
H. Killmann, and I. Traub.
1996.
Energy-coupled transport across the outer membrane of Escherichia coli: ExbB binds ExbD and TonB in vitro, and leucine 132 in the periplasmic region and aspartate 25 in the transmembrane region are important for ExbD activity.
J. Bacteriol.
178:2836-2845 |
| 12. | Braun, V., K. Hantke, and W. Koster. 1998. Bacterial iron transport: mechanisms, genetics, and regulation. Metal Ions Biol. Syst. 35:67-145. |
| 13. | Braun, V., H. Pilsl, and P. Gross. 1994. Colicins: structures, modes of action, transfer through membranes, and evolution. Arch. Microbiol. 161:199-206[Medline]. |
| 14. |
Brickman, T. J., and S. K. Armstrong.
1999.
Essential role of the iron-regulated outer membrane receptor FauA in alcaligin siderophore-mediated iron uptake in Bordetella species.
J. Bacteriol.
181:5958-66 |
| 15. | Bruske, A. K., M. Anton, and K. J. Heller. 1993. Cloning and sequencing of the Klebsiella pneumoniae tonB gene and characterization of Escherichia coli-K. pneumoniae TonB hybrid proteins. Gene 131:9-16[CrossRef][Medline]. |
| 16. |
Bruske, A. K., and K. J. Heller.
1993.
Molecular characterization of the Enterobacter aerogenes tonB gene: identification of a novel type of TonB box suppressor mutant.
J. Bacteriol.
175:6158-6168 |
| 17. |
Connell, T. D.,
A. Dickenson,
A. J. Martone,
K. T. Militello,
M. J. Filiatraut,
M. L. Hayman, and J. Pitula.
1998.
Iron starvation of Bordetella avium stimulates expression of five outer membrane proteins and regulates a gene involved in acquiring iron from serum.
Infect. Immun.
66:3597-3605 |
| 18. |
Corpet, F.
1988.
Multiple sequence alignment with hierarchical clustering.
Nucleic Acids Res.
16:10881-10890 |
| 19. |
Elkins, C.,
P. A. Totten,
B. Olsen, and C. E. Thomas.
1998.
Role of the Haemophilus ducreyi Ton system in internalization of heme from hemoglobin.
Infect. Immun.
66:151-160 |
| 20. | Fellay, R., J. Frey, and H. Krisch. 1987. Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of gram-negative bacteria. Gene 52:147-154[CrossRef][Medline]. |
| 21. |
Fleischmann, R. D.,
M. D. Adams,
O. White,
R. A. Clayton,
E. F. Kirkness,
A. R. Kerlavage,
C. J. Bult,
J. F. Tomb,
B. A. Dougherty,
J. M. Merrick, et al.
1995.
Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.
Science
269:496-512 |
| 22. | Gaisser, S., and V. Braun. 1991. The tonB gene of Serratia marcescens: sequence, activity and partial complementation of Escherichia coli tonB mutants. Mol. Microbiol. 5:2777-2787[CrossRef][Medline]. |
| 23. | Graham, M. R., and R. Y. Lo. 1997. Cloning and characterization of the exbB-exbD-tonB locus of Pasteurella haemolytica A1. Gene 186:201-205[CrossRef][Medline]. |
| 24. | Gray-Owen, S. D., S. Loosmore, and A. B. Schryvers. 1995. Identification and characterization of genes encoding the human transferrin-binding proteins from Haemophilus influenzae. Infect. Immun. 63:1201-1210[Abstract]. |
| 25. | Hannavy, K., G. C. Barr, C. J. Dorman, J. Adamson, L. R. Mazengera, M. P. Gallagher, J. S. Evans, B. A. Levine, I. P. Trayer, and C. F. Higgins. 1990. TonB protein of Salmonella typhimurium. A model for signal transduction between membranes. J. Mol. Biol. 216:897-910[CrossRef][Medline]. |
| 26. | Heller, K. J., R. J. Kadner, and K. Gunther. 1988. Suppression of the btuB451 mutation by mutations in the tonB gene suggests a direct interaction between TonB and TonB-dependent receptor proteins in the outer membrane of Escherichia coli. Gene 64:147-153[CrossRef][Medline]. |
| 27. |
Henderson, D. P., and S. M. Payne.
1994.
Vibrio cholerae iron transport systems: roles of heme and siderophore iron transport in virulence and identification of a gene associated with multiple iron transport systems.
Infect. Immun.
62:5120-5125 |
| 28. | Jarosik, G. P., and E. J. Hansen. 1995. Cloning and sequencing of the Haemophilus influenzae exbB and exbD genes. Gene 152:89-92[CrossRef][Medline]. |
| 29. |
Jarosik, G. P.,
J. D. Sanders,
L. D. Cope,
U. Muller-Eberhard, and E. J. Hansen.
1994.
A functional tonB gene is required for both utilization of heme and virulence expression by Haemophilus influenzae type b.
Infect. Immun.
62:2470-2477 |
| 30. | Kadner, R. J. 1990. Vitamin B12 transport in Escherichia coli: energy coupling between membranes. Mol. Microbiol. 4:2027-2033[Medline]. |
| 31. | Karlsson, M., K. Hannavy, and C. F. Higgins. 1993. A sequence-specific function for the N-terminal signal-like sequence of the TonB protein. Mol. Microbiol. 8:379-388[CrossRef][Medline]. |
| 32. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[CrossRef][Medline]. |
| 33. |
Larsen, R. A.,
D. Foster-Hartnett,
M. A. McIntosh, and K. Postle.
1997.
Regions of Escherichia coli TonB and FepA proteins essential for in vivo physical interactions.
J. Bacteriol.
179:3213-3221 |
| 34. |
Larsen, R. A.,
P. S. Myers,
J. T. Skare,
C. L. Seachord,
R. P. Darveau, and K. Postle.
1996.
Identification of TonB homologs in the family Enterobacteriaceae and evidence for conservation of TonB-dependent energy transduction complexes.
J. Bacteriol.
178:1363-1373 |
| 35. | Larsen, R. A., M. G. Thomas, and K. Postle. 1999. Protonmotive force, ExbB and ligand-bound FepA drive conformational changes in TonB. Mol. Microbiol. 31:1809-1824[CrossRef][Medline]. |
| 36. | Larsen, R. A., G. E. Wood, and K. Postle. 1993. The conserved proline-rich motif is not essential for energy transduction by Escherichia coli TonB protein. Mol. Microbiol. 10:943-953[CrossRef][Medline]. |
| 37. | Lee, B. C. 1995. Quelling the red menace: haem capture by bacteria. Mol. Microbiol. 18:383-390[CrossRef][Medline]. |
| 38. |
Litwin, C. M., and B. L. Byrne.
1998.
Cloning and characterization of an outer membrane protein of Vibrio vulnificus required for heme utilization: regulation of expression and determination of the gene sequence.
Infect. Immun.
66:3134-3141 |
| 39. | Locht, C. 1999. Molecular aspects of Bordetella pertussis pathogenesis. Int. Microbiol. 2:137-144[Medline]. |
| 40. |
Menozzi, F. D.,
C. Gantiez, and C. Locht.
1991.
Identification and purification of transferrin- and lactoferrin-binding proteins of Bordetella pertussis and Bordetella bronchiseptica.
Infect. Immun.
59:3982-3988 |
| 41. |
Menozzi, F. D.,
R. Mutombo,
G. Renauld,
C. Gantiez,
J. H. Hannah,
E. Leininger,
M. J. Brennan, and C. Locht.
1994.
Heparin-inhibitable lectin activity of the filamentous hemagglutinin adhesin of Bordetella pertussis.
Infect. Immun.
62:769-778 |
| 42. | Miller, J. H. 1992. A short course in bacterial genetics. A laboratory manual and handbook for Escherichia coli and related bacteria. Cold Spring Harbor Laboratory Press, Plainview, N.Y. |
| 43. | Moeck, G. S., and J. W. Coulton. 1998. TonB-dependent iron acquisition: mechanisms of siderophore-mediated active transport. Mol. Microbiol. 28:675-681[CrossRef][Medline]. |
| 44. | Neilands, J. B., and K. Nakamura. 1991. Detection, determination, isolation, characterization and regulation of microbial iron chelates, p. 1-15. In G. Winkelmann (ed.), Handbook of microbial iron chelates. CRC Press, Boca Raton, Fla. |
| 45. | Nordmann, P., B. François, F. D. Menozzi, M. C. Commare, and A. Barois. 1992. Whooping cough associated with Bordetella parapertussis in a human immunodeficiency virus-infected child. Pediatr. Infect. Dis. J. 11:248[Medline]. |
| 46. | Occhino, D. A., E. E. Wyckoff, D. P. Henderson, T. J. Wrona, and S. M. Payne. 1998. Vibrio cholerae iron transport: haem transport genes are linked to one of two sets of tonB, exbB, exbD genes. Mol. Microbiol. 29:1493-1507[CrossRef][Medline]. |
| 47. |
Ochsner, U. A., and M. L. Vasil.
1996.
Gene repression by the ferric uptake regulator in Pseudomonas aeruginosa: cycle selection of iron-regulated genes.
Proc. Natl. Acad. Sci. USA
93:4409-4414 |
| 48. |
Poole, K.,
Q. Zhao,
S. Neshat,
D. E. Heinrichs, and C. R. Dean.
1996.
The Pseudomonas aeruginosa tonB gene encodes a novel TonB protein.
Microbiology
142:1449-1458 |
| 49. |
Postle, K.
1990.
Aerobic regulation of the Escherichia coli tonB gene by changes in iron availability and the fur locus.
J. Bacteriol.
172:2287-2293 |
| 50. | Postle, K. 1993. TonB protein and energy transduction between membranes. J. Bioenerg. Biomembr. 25:591-601[Medline]. |
| 51. |
Pradel, E.,
N. Guiso, and C. Locht.
1998.
Identification of AlcR, an AraC-type regulator of alcaligin siderophore synthesis in Bordetella bronchiseptica and Bordetella pertussis.
J. Bacteriol.
180:871-880 |
| 52. | Quandt, J., and M. F. Hynes. 1993. Versatile suicide vectors which allow direct selection for gene replacement in gram-negative bacteria. Gene 127:15-21[CrossRef][Medline]. |
| 53. |
Ren, Z.,
H. Jin,
D. J. Morton, and T. L. Stull.
1998.
hgpB, a gene encoding a second Haemophilus influenzae hemoglobin- and hemoglobin-haptoglobin-binding protein.
Infect. Immun.
66:4733-4741 |
| 54. |
Roof, S. K.,
J. D. Allard,
K. P. Bertrand, and K. Postle.
1991.
Analysis of Escherichia coli TonB membrane topology by use of PhoA fusions.
J. Bacteriol.
173:5554-5557 |
| 55. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 56. | Schwyn, B., and J. B. Neilands. 1987. Universal chemical assay for the detection and determination of siderophores. Anal. Biochem. 160:47-56[CrossRef][Medline]. |
| 57. | Simon, R., U. Priefer, and A. Pühler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Bio/Technology 1:784-790[CrossRef]. |
| 58. | Stojiljkovic, I., A. J. Baumler, and K. Hantke. 1994. Fur regulon in gram-negative bacteria. Identification and characterization of new iron-regulated Escherichia coli genes by a Fur titration assay. J. Mol. Biol. 236:531-545[CrossRef][Medline]. |
| 59. |
Stojiljkovic, I., and N. Srinivasan.
1997.
Neisseria meningitidis tonB, exbB, and exbD genes: Ton-dependent utilization of protein-bound iron in Neisseriae.
J. Bacteriol.
179:805-812 |
| 60. |
Thomas, C. E.,
B. Olsen, and C. Elkins.
1998.
Cloning and characterization of tdhA, a locus encoding a TonB-dependent heme receptor from Haemophilus ducreyi.
Infect. Immun.
66:4254-4262 |
| 61. | Tomb, J. F., O. White, A. R. Kerlavage, R. A. Clayton, G. G. Sutton, R. D. Fleischmann, K. A. Ketchum, H. P. Klenk, S. Gill, B. A. Dougherty, K. Nelson, J. Quackenbush, L. Zhou, E. F. Kirkness, S. Peterson, B. Loftus, D. Richardson, R. Dodson, H. G. Khalak, A. Glodek, K. McKenney, L. M. Fitzegerald, N. Lee, M. D. Adams, et al. 1997. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388:539-547[CrossRef][Medline]. |
| 62. | Torres, A. G., and S. M. Payne. 1997. Haem iron-transport system in enterohaemorrhagic Escherichia coli O157:H7. Mol. Microbiol. 23:825-833[CrossRef][Medline]. |
| 63. | Traub, I., S. Gaisser, and V. Braun. 1993. Activity domains of the TonB protein. Mol. Microbiol. 8:409-423[CrossRef][Medline]. |
| 64. | Tsolis, R. M., A. J. Baumler, F. Heffron, and I. Stojiljkovic. 1996. Contribution of TonB- and Feo-mediated iron uptake to growth of Salmonella typhimurium in the mouse. Infect. Immun. 64:4549-4556[Abstract]. |
| 65. | Weinberg, E. D. 1995. Acquisition of iron and other nutrients in vivo, p. 81-95. In J. A. Roth, C. A. Bolin, K. A. Brogden, F. C. Minion, and M. J. Wannemuehler (ed.), Virulence mechanisms of bacterial pathogens. American Society for Microbiology, Washington, DC. |
| 66. |
Wiggerich, H. G.,
B. Klauke,
R. Koplin,
U. B. Priefer, and A. Puhler.
1997.
Unusual structure of the tonB-exb DNA region of Xanthomonas campestris pv. campestris: tonB, exbB, and exbD1 are essential for ferric iron uptake, but exbD2 is not.
J. Bacteriol.
179:7103-7110 |
| 67. |
Zhao, Q.,
X. Z. Li,
A. Mistry,
R. Srikumar,
L. Zhang,
O. Lomovskaya, and K. Poole.
1998.
Influence of the TonB energy-coupling protein on efflux-mediated multidrug resistance in Pseudomonas aeruginosa.
Antimicrob. Agents Chemother.
42:2225-2231 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»