Previous Article | Next Article 
Infection and Immunity, April 2000, p. 2187-2195, Vol. 68, No. 4
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Antibody-Mediated Elimination of the Obligate
Intracellular Bacterial Pathogen Ehrlichia chaffeensis
during Active Infection
Gary M.
Winslow,1,2,*
Eric
Yager,2
Konstantin
Shilo,1,
Erin
Volk,2
Andrew
Reilly,1 and
Frederick
K.
Chu1
Wadsworth Center, New York State Department
of Health, Albany, New York 12201-2002,1 and
Department of Biomedical Sciences, School of Public Health,
University at Albany, Albany, New York
12201-05092
Received 21 May 1999/Returned for modification 14 October
1999/Accepted 3 January 2000
 |
ABSTRACT |
It is generally accepted that cellular, but not humoral immunity,
plays an important role in host defense against intracellular bacteria.
However, studies of some of these pathogens have provided evidence that
antibodies can provide immunity if present during the initiation of
infection. Here, we examined immunity against infection by
Ehrlichia chaffeensis, an obligate intracellular bacterium
that causes human monocytic ehrlichiosis. Studies with mice have
demonstrated that immunocompetent strains are resistant to persistent
infection but that SCID mice become persistently and fatally infected.
Transfer of immune serum or antibodies obtained from immunocompetent
C57BL/6 mice to C57BL/6 scid mice provided significant
although transient protection from infection. Bacterial clearance was
observed when administration occurred at the time of inoculation or
well after infection was established. The effect was dose dependent,
occurred within 2 days, and persisted for as long as 2 weeks. Weekly
serum administration prolonged the survival of susceptible mice.
Although cellular immunity is required for complete bacterial
clearance, the data show that antibodies can play a significant role in
the elimination of this obligate intracellular bacterium during active
infection and thus challenge the paradigm that humoral responses are
unimportant for immunity to such organisms.
 |
INTRODUCTION |
Cellular immune responses have long
been considered to be a hallmark of immunity to intracellular bacterial
pathogens (reviewed in references 17 and
32). Classical studies of well-characterized intracellular bacterial pathogens such as Listeria
monocytogenes and Mycobacterium tuberculosis have
provided clear evidence for a critical role for cellular immunity in
host defense (19, 22, 26). Indeed, it has often been
difficult to demonstrate a significant role for humoral immunity during
intracellular bacterial infection, although exceptions exist (12,
28). The failure in many studies to observe a role for antibodies
has led to general acceptance of the tenet that antibodies play little
or no role in host defense during intracellular bacterial infection,
although antibodies are well known to exert neutralizing effects during
virus infections. Moreover, when interpreted as part of the Th1/Th2
paradigm, humoral immune responses have often been considered to be
antagonistic to protective cellular responses during intracellular
bacterial infections (3). However, accumulating evidence
from both older and more recent studies indicates that humoral immunity
may be important for immunity to a number of intracellular bacterial and fungal parasites (reviewed in reference 6).
These data suggest that both cellular and humoral immune responses can
contribute to immunity to intracellular bacterial pathogens.
To further address the role of cellular and humoral immunity during
intracellular bacterial infection, we have examined the immunological
basis of resistance and susceptibility to infection by Ehrlichia
chaffeensis, an obligate intracellular bacterium that infects
cells of the monocyte/macrophage lineage. E. chaffeensis is
the etiologic agent of human monocytic ehrlichiosis (HME), an emerging
tick-borne disease that resembles toxic shock syndrome (13).
The bacterium is transmitted by the tick Amblyomma
americanum, commonly found in the southeastern and mid-Atlantic
regions of the United States. HME is characterized by a number of
nonspecific symptoms including malaise and myalgia, as well as specific
hematological abnormalities such as leukopenia and thrombocytopenia
(36). Little is known of the host factors that influence
susceptibility and resistance to HME, although some studies have
suggested that humoral immune responses might play an important role
during infections by related ehrlichiae (18, 33).
Inbred mice have been shown to be susceptible to experimental infection
by E. chaffeensis (35, 38). Our previous studies showed that immunocompetent mice (e.g., BALB/c and C57BL/6) developed only transient infection and inflammation and cleared the ehrlichiae within about 2 weeks (38). However, immunocompromised SCID
mice, which lack T and B lymphocytes, developed persistent infection and disease and became moribund within 3 weeks postinfection. To
determine if a B-cell-derived antibody provided protection from
infection, immune serum from C57BL/6 mice was transferred to
susceptible SCID mice prior to or during active infection. A
significant protective effect was observed after passive transfer of
immune serum, and the active component was determined to be the
antibody. The transferred antibodies caused bacterial elimination and
ameliorated disease, even when administered to mice well after infection had been established. Furthermore, mice deficient for
/
T cells or both
/
and
/
T cells, although persistently infected, remained healthy, presumably due to the presence of B cells.
Thus, although both cellular and humoral immune responses are involved
in host defense, antibodies, in the absence of lymphocytes, can
contribute to the elimination of this intracellular pathogen during an
active infection. These data therefore support a model for immunity to
intracellular bacteria that includes roles for both cellular and
humoral immune responses.
 |
MATERIALS AND METHODS |
Animals.
All mice were obtained from the Jackson
Laboratories, Bar Harbor, Maine, or were bred in the Animal Care
Facility at the Wadsworth Center under microisolator conditions in
accordance with institutional guidelines for animal welfare. All
strains in the study were carried on the C57BL/6 genetic background.
Bacteria and inoculations.
The Arkansas isolate of
E. chaffeensis was used for the infections described in this
study (4). The bacteria were cultured in the canine
histiocyte cell line DH82, as described previously (38).
Six- to 12-week-old sex-matched mice were inoculated with E. chaffeensis-infected DH82 cells (106 to 2 × 106 cells/animal; >90% infected) or with a homogenate of
infected splenocytes obtained from a C57BL/6 scid mouse by
peritoneal injection. Quantitative PCR (QPCR) analyses later estimated
that at the time of inoculation the infected DH82 cells harbored 250 to
500 bacteria per cell, although the number of viable organisms may have
been lower (G. M. Winslow and M. Reilly, unpublished data).
Tissues were excised from infected mice at various times after
infection and were stored at
70° prior to DNA extraction and QPCR analyses.
Quantitation of bacteria in mouse tissue.
DNA was prepared
from mouse tissue and analyzed by semiquantitative PCR or QPCR for the
16S ribosomal DNA rDNA of E. chaffeensis. Semiquantitative
PCR was performed as described previously (38) and relied on
a comparison of the relative intensities of ethidium bromide-stained
PCR products in agarose gels. PCR products were scored visually and
assigned an infectivity index based on a scale of 1 to 6, where a score
of 1 indicated products at the limit of detection and a score of 6 indicated products at saturation. This method was highly sensitive and
was used routinely for bacterial quantitation, although loss of
linearity of the assay has been observed at high levels of bacterial
infection. Test samples were normalized by comparison to E. chaffeensis DNA standards. In some cases, densitometry was used to
provide further quantitation of the PCR products. The gels were
photographed, and the band intensities were quantitated using a
scanning densitometer (Scanalytics, Billerica, Mass.). To provide
more-accurate bacterial quantitation, representative data from most
experiments were analyzed by QPCR. In all cases, the QPCR analyses
reflected the results obtained using the semiquantitative assay. The
QPCR or densitometry data from representative animals are presented in
the figures. The semiquantitative PCR data from selected experiments
are presented in the accompanying tables. Data from the
semiquantitative analyses of mice from replicate experiments were
analyzed for statistical significance. P values were
computed from Wilcoxon's ranked-sum statistic, which permits testing
small data sets without utilizing distributional assumptions (37).
The development of the QPCR assay will be described in detail
elsewhere. Briefly, an internal standard PCR probe was generated for
quantitation by deletion of nucleotides between the MluI (5' ACGCGT 3') and PpuMI (5' GGGGACCC 3')
restriction endonuclease sites in the 16S rDNA of E. chaffeensis, concomitant with insertion of a double-stranded DNA
fragment generated using the following complementary oligonucleotides
from plasmid pBR327 (16): 5' CGCGTACGTTCCTCTACCGCGGGTTGTCAGGG 3' (sense strand) and 5'
GTCCCCTGACAACCCGCGGTAGAGGAACGTA 3' (antisense strand). The
double-stranded DNA fragment contained ends compatible with those
generated by restriction endonuclease digestion of the plasmid
containing the 16S rDNA. The inserted DNA was joined to the vector with
T4 DNA ligase, and the resulting plasmid was used to transform
Escherichia coli XL-1 Blue cells (Stratagene, Inc., La
Jolla, Calif.). The plasmid was sequenced to verify that the correct
construct was recovered. The wild-type (pCR16S) and mutant (pCR16S
)
plasmid DNAs were purified using the miniprep method (Wizard; Promega
Corp., Madison, Wis.), and the DNA was further purified by
microfiltration using a Centricon 100 filter apparatus (Millipore,
Inc., New Bedford, Mass.). DNA concentrations were determined by spectroscopy.
PCR analyses were performed as described previously (
10)
using the oligonucleotides 5' CAATTGCTTATAACCTTTTGGT 3' and
5'
CCCTATTAGGAGGGATACGACCTT 3', which bind to the 5' and 3'
regions
of the
E. chaffeensis 16S rDNA, respectively. To
allow microtiter
plate capture, the latter primer was synthesized with
a 5' biotin
nucleotide derivative (5'-biotin phosphoramidite; Glen
Research,
Sterling, Va.) following the protocols supplied by the
manufacturer.
Methods used to prepare the tissue DNA for analysis and
the PCR
conditions have been described previously (
38). Each
QPCR mixture
contained DNA isolated from infected tissues (100 to 500 ng/reaction)
and included in addition predetermined quantities of the
internal
standard DNA (pCR16S

; 500 to 1,500 copies). The PCRs were
performed
under noncompetitive conditions, such that amplification of
the
bacterial DNA was largely unaffected by the presence of the
internal
standard
DNA.
Quantitation was performed by binding the biotinylated PCR products to
streptavidin-coated microtiter wells (Roche Molecular
Biochemicals,
Indianapolis, Ind.) in 1× SSC (0.015 M sodium citrate
[pH 7.0] plus
0.15 M NaCl) containing 0.5% Tween 20 for at least
1 h. The wells
were washed with 1× SSC, the DNA was denatured
by incubation with 0.1 N NaOH for 10 min and washed, and the bound
DNA was hybridized with
digoxigenilated oligonucleotide probes
(10 pM in hybridization buffer
containing 1× SSC, 20 mM HEPES
[pH 7.0], 2 mM EGTA, and 0.1% Tween
20). The hybridization probes
specifically bound PCR products generated
from either the bacterial
DNA or the internal standard DNA. The
digoxigenilated hybridization
probes were generated using terminal
deoxynucleotide transferase
and digoxigenin-dUTP in accordance with
protocols described by
the supplier (Roche Molecular Biochemicals).
After the microtiter
plate was washed to remove unbound
oligonucleotides, the bound
digoxigenilated oligonucleotides were
detected using alkaline
phosphatase-conjugated antidigoxigenin
antibodies (Roche Molecular
Biochemicals) and
p-nitrophenyl
phosphate as the substrate (Sigma
Chemicals, St. Louis, Mo.). Optical
densities were determined
at 405 nm using an MR5000 plate reader
(Dynatech Laboratories,
Chantilly, Va.). To quantitate the masses of
the bound products,
the optical densities were compared with those of
DNA standards
generated from wild-type and deletion mutant template
DNAs by
PCR. The copy number of the bacterial DNA was determined by
comparison
with the internal standard, and the number of copies of
ehrlichia
DNA per gram of tissue was determined. Liver tissue contained
on average 7.3 mg of cellular DNA per g of tissue. The QPCR assay
could
detect as few as 5 × 10
5 organisms per g of liver
tissue. Sensitivity of the assay was
apparently limited by
contaminating host cell DNA and the enzyme-linked
immunosorbent assay
(ELISA) reagents used for
quantitation.
Administration of immune serum and antibodies.
E.
chaffeensis-infected DH82 cells (106 to 2 × 106) were administered intraperitoneally to C57BL/6 mice on
day 0, the mice were boosted with the same inoculum on day 14, and
serum was harvested 5 days later. Serum was aliquoted and stored at
20°C. A typical in vivo administration was performed using 0.1 ml
of serum.
Immunofluorescence assay for E. chaffeensis.
Assays
were performed using E. chaffeensis-infected DH82 cells
which were attached to microscope slides. The slides were fixed in
methanol, blocked in 10% normal goat serum, and incubated with serial
dilutions of mouse antisera. Serum samples and secondary antibodies
were diluted in phosphate-buffered saline (PBS) containing 2% fetal
calf serum. Primary antibodies were detected using fluorescein isothiocyanate-conjugated goat anti-mouse immunoglobulin (Ig) (heavy
and light chain specific; Fisher Scientific, Springfield, N.J.). Slides
were observed under immunofluorescence using a Zeiss Axioplan
microscope. The titration end point was determined to be the lowest
serum dilution that allowed detection of bacteria.
Western analysis.
E. chaffeensis antigens for Western
analyses were obtained from infected DH82 cells. Infected cells were
harvested by centrifugation and lysed by homogenization using a
disposable tissue grinder (Sage Products, Inc., Crystal Lake, Ill.).
The crude lysate was centrifuged at 600 × g for 5 min,
and the low-speed supernatant was then passed through a
5-µM-pore-size syringe filter (Micron Separations Inc., Westborough,
Mass.) to remove debris. The filtrate was centrifuged at 15,000 rpm for
5 min in a microcentrifuge, and the pellet was stored at
70°C. The
pellets were resuspended in sample buffer containing 2% sodium dodecyl
sulfate (SDS) and 2%
-mercaptoethanol, electrophoresed in an 8 to
20% acrylamide gradient SDS-polyacrylamide gel electrophoresis gel,
and blotted to polyvinyl difluoride blotting membranes. The membranes
were blocked with 1% nonfat dry milk in PBS, and probed with human or
mouse antiserum at a 100-fold dilution in blocking solution. Bound
antibodies were detected using horseradish peroxidase-conjugated goat
anti-human Ig and goat anti-mouse Ig secondary reagents, and the blots
were developed using chemiluminescence (ECL Plus; Amersham-Pharmacia
Biotech, Piscataway, N.J.). The human E. chaffeensis immune
serum was obtained from an infected patient and was provided by S. Wong, Wadsworth Center, New York State Department of Health.
Antibody purification.
Serum fractionation was performed by
precipitation with 40% ammonium sulfate, followed by centrifugation
and resuspension in PBS. Protein A- and protein G-Sepharose
(Amersham-Pharmacia Biotech) chromatography was performed using
standard methods. An ELISA assay of the purified Igs revealed that IgM
and all IgG mouse antibody subclasses were present after purification.
One hundred micrograms of affinity-purified antibodies and 200 µg of
salt-fractionated antibodies were used for in vivo injections.
 |
RESULTS |
Adoptive transfer of immune serum abrogated infection.
It has
been demonstrated previously that immunocompetent C57BL/6 mice cleared
E. chaffeensis infection within about 2 weeks but that
immunodeficient C57BL/6 scid mice became persistently infected and moribund within 3 weeks postinfection (38). The infected SCID mice exhibited a number of abnormalities, including liver
inflammation and necrosis, splenomegaly, and thrombocytopenia (38). To determine the basis of immunological resistance to infection, serum was obtained from immunocompetent C57BL/6 mice after E. chaffeensis infection and was transferred to
susceptible C57BL/6 scid mice coincident with E. chaffeensis infection or 3 days postinfection, at a time when the
infection was active. Tissues from the infected mice were subjected to
visual observation and histological analysis, as described previously
(38) and were analyzed for the presence of bacteria by QPCR.
Previous studies demonstrated that many tissues become colonized in
SCID mice, but liver tissue was chosen for the analyses because it was
a principal site of bacterial colonization.
Adoptive transfer of C57BL/6 immune serum, but not normal serum,
provided a marked protection of C57BL/6
scid mice from
infection
(Fig.
1a, Table
1). In several experiments, no
significant changes
in bacterial loads were observed after transfer of
buffer or normal
C57BL/6 serum. A reduction in the number of bacteria
in liver
tissue was observed for as long as 2 weeks following immune
serum
administration. Of particular importance was the observation of
a
reduction in bacterial numbers because this indicated that humoral
immunity could provide protection after infection had been established.
The limit of detection of the QPCR assay was approximately 5 ×
10
5 bacteria per g of liver tissue, so it was not possible
to determine
if complete bacterial clearance occurred using the QPCR
assay.
Bacterial colonization was restored within 3 weeks of antibody
administration (Fig.
1a), however, indicating that serum administration
was not completely effective in the liver or that the liver was
colonized by bacteria from tissues unaffected by the serum treatment.
The transfer of immune serum also protected mice from disease,
as
determined by the lack of visible liver lesions that have been
characteristically observed in SCID mice within 10 to 17 days
postinfection (data not shown). In addition, histological analyses
of
liver sections performed as early as 48 h and as late as 2
weeks
following serum transfer demonstrated inflammatory infiltration
and
coagulative necrosis in control mice but not in the mice that
received
the immune serum.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Administration of immune serum protected mice from
ehrlichia infection. (a) Transient bacterial elimination in susceptible
SCID mice. C57BL/6 scid mice were infected intraperitoneally
with 106 to 2 × 106 E. chaffeensis-infected DH82 cells (day 0), followed by subcutaneous
injection of 0.1 ml of PBS, normal C57BL/6 serum, or immune serum on
day 0 or of immune serum on day 3 postinfection, as indicated. Liver
tissue was harvested on the indicated days postinfection and was
analyzed for the presence of E. chaffeensis by QPCR for
E. chaffeensis 16S rDNA, as described in Materials and
Methods. Immune serum was obtained from C57BL/6 mice that had been
inoculated with E. chaffeensis-infected DH82 cells. Similar
observations of the immune serum protection were made in at least three
independent experiments using a semiquantitative PCR assay (Table 1).
The lower bacterial titers observed on day 17 postinfection, compared
to those on days 10 and 24, were not observed in other experiments (see
also Fig. 4b) and most likely represent experimental variability. In
all cases, the immune serum group was significantly different from
controls. *, bacteria were not detected in the assays. Ec, E. chaffeensis. (b) Bacterial elimination in immunocompetent C57BL/6
mice. The mice were infected as described for panel a, and PBS or
immune serum was administered via the peritoneum on day 3 postinfection. Tissues were harvested at the time of serum
administration and 1 or 4 days later, and representative mice from each
group were analyzed by QPCR. The experiment was performed in
triplicate, and semiquantitative PCR analysis, which is more sensitive
than QPCR, also failed to detect bacteria in spleen or liver tissue of
any of the mice that received immune serum (not shown). P
values obtained from the semiquantitative analyses were 0.09 and 0.001 for mice analyzed on day 4 and day 7, respectively. n.d., not
determined.
|
|
Although the effect of immune serum administration was readily apparent
in immunocompromised SCID mice, it was not known if
the protective
effect also occurred in immunocompetent mice. Immunocompetent
C57BL/6
mice typically develop transient infection after bacterial
inoculation
and clear the bacteria to undetectable levels within
10 to 17 days
postinfection (
38). To determine if immune serum
could
mediate bacterial clearance in these mice, serum was administered
3 days postinfection, after bacterial infection had been established.
The
effect of serum administration was analyzed 1 to 3 days after
serum
administration. Immune serum eliminated the bacteria from
the livers of
the C57BL/6 mice in less than 3 days (Fig.
1b),
compared to the 1 to 2 weeks required for clearance in control
C57BL/6 mice,
indicating that immune serum was also effective
in immunocompetent
mice.
The protective effects of immune serum are specific for E. chaffeensis.
E. chaffeensis is routinely cultured in vitro
in the canine histiocyte cell line DH82, and the mice used for both
experimentation and production of antisera were inoculated using the
ehrlichia-infected DH82 cells. It has been previously demonstrated that
E. chaffeensis can infect and multiply in mouse tissues
(38), so it was unlikely that the observed effect of the
immune serum could be attributed to the DH82 cells which harbor the
bacteria at the time of infection. However, to eliminate the
possibility that anti-DH82 antibodies might be responsible for the
observed bacterial clearance, two experiments were performed. It has
been demonstrated previously that infection could occur upon transfer
of infected mouse splenocytes obtained from SCID mice to uninfected
SCID recipients (38). Immune serum administration
effectively eliminated bacteria when performed after inoculation of
mice with infected mouse splenocytes (Fig.
2a), indicating that
the effect of the serum was not dependent on the cells used to culture
the ehrlichiae. Furthermore, transfer of immune serum obtained from
mice immunized with uninfected DH82 cells had no effect on bacterial
proliferation or disease in SCID mice that had been inoculated with
E. chaffeensis-infected DH82 cells (Fig. 2b). Thus, the
effect of the immune serum administration was due to its antibacterial
activity.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
Bacterial clearance was E. chaffeensis
specific and was mediated by antibodies. (a) C57BL/6 scid
mice were infected by transfer of E. chaffeensis-infected
splenocytes obtained from a SCID mouse 17 days postinfection. Immune
serum was obtained from C57BL/6 mice that had been inoculated with
E. chaffeensis-infected DH82 cells and was administered at
the time of bacterial infection. Bacterial loads were determined by
QPCR. *, bacteria were not detected in the infected mice. Each
histogram bar represents a single mouse. Ec, E. chaffeensis.
(b) Mice were infected as described for Fig. 1 and were administered on
day 10 postinfection normal mouse serum or serum obtained from C57BL/6
mice that had been inoculated with either uninfected DH82 cells (immune
serum-uninfected) or with E. chaffeensis-infected DH82 cells
(immune serum-infected). Liver tissue was harvested on day 14 for QPCR
analyses. QPCR analyses of representative individual mice are shown.
The observations were confirmed in a separate experiment (not shown)
where 16 mice (in three groups) were analyzed over a period of 24 days.
The semiquantitative data from both experiments where serum was
administered on day 14 postinfection were normalized and combined (a
total of four mice for each group), and the means and standard
deviations were as follows: normal serum, 5.0 ± 0.82; serum from
mice inoculated with uninfected cells, 4.3 ± 1.1; immune serum,
1.8 ± 1.8. (c) C57BL/6 scid mice were infected on day
0 with E. chaffeensis-infected DH82 cells, followed by
intraperitoneal administration of 0.1 ml of PBS or C57BL/6 immune
serum, 200 µg of ammonium sulfate-fractionated immune serum (SAS), or
100 µg of protein A affinity-purified antibodies 3 days
postinfection. The presence of E. chaffeensis antibodies in each of
the preparations was confirmed by immunofluorescence assay. Mice were
harvested 5 and 10 days postinfection, and liver tissue from
representative individual mice was analyzed by QPCR. Semiquantitative
analyses of a total of 16 mice from two experiments revealed
significant differences between the buffer- and antibody-treated mice
(mean ± standard deviation): PBS, 3.8 ± 0.83; immune serum,
1.0 ± 1.2; protein A-purified antibodies, 0.5 ± 0.87;
ammonium sulfate-purified antibodies, 1.3 ± 1.3. *, bacteria
were not detected in the QPCR assays.
|
|
To demonstrate that the effect of the immune serum was due to serum
antibodies, Igs from immune serum were fractionated by
precipitation
with 40% ammonium sulfate and were further purified
by protein A
affinity chromatography. The purified antibodies
were tested for their
ability to mediate clearance of
E. chaffeensis in vivo. The
purified antibodies mediated bacterial clearance
in SCID mice, which
indicated that the activity in the serum was
due to antibodies (Fig.
2c). ELISA analyses revealed that the
affinity-purified antibody
preparation contained antibodies of
all mouse isotypes (data not
shown), so it was not possible to
draw any conclusions regarding the
efficacies of particular antibody
classes and subclasses during
bacteria
clearance.
Antibody production in C57BL/6 mice.
Serum from normal mice
was ineffective at bacterial clearance, so it was likely that the
effect of the serum obtained from immunized mice was due to the
presence of anti-E. chaffeensis antibodies. To demonstrate
that the C57BL/6 mice generated antiehrlichia antibodies, serum
from infected C57BL/6 mice was examined by immunofluorescence assay and
Western blotting. Anti-E. chaffeensis antibodies were detected in serum from C57BL/6 mice within 7 days following inoculation and for as long as 48 days postinfection, indicating that a potent humoral response was made in the C57BL/6 mice (Fig.
3a).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
E. chaffeensis antibody responses in C57BL/6
mice. (a) C57BL/6 mice were inoculated with 2 × 106
infected DH82 cells, serum was harvested on the indicated days
postinfection, and E. chaffeensis antibody titers were
determined by immunofluorescence assay using a secondary antibody
specific for mouse Ig. Each data point represents the serum titer of
one mouse. (b) Western analysis of murine and human E. chaffeensis antisera. Bacterial antigens were obtained from
uninfected (u) or E. chaffeensis-infected (i) DH82 cells.
The samples were Western blotted and probed with mouse or human
antisera, followed by a species-specific horseradish
peroxidase-conjugated secondary antibody and chemiluminescence
development. *, E. chaffeensis molecules that were
detected by both the mouse and human antibodies. Molecular mass
standards, in kilodaltons, are at the left of the gel.
|
|
To identify candidate bacterial antigens that were possible targets of
the protective mouse antibodies, Western blots of
E. chaffeensis antigens obtained from infected DH82 cells were probed
with C57BL/6 immune serum. Several
E. chaffeensis antigens
were
detected by the mouse antibodies, including proteins of 22, 27,
28, 54, 73, and 88 kDa (Fig.
3b). The antigens were in many cases
identical to those detected using serum from an infected human
(Fig.
3b). The 28-kDa antigen was immunodominant in several sera
from mice
and humans and is probably the previously described
E. chaffeensis outer membrane protein (OMP) (
30,
39).
The effect of antibodies administered during an established
infection.
The onset of liver disease is typically observed in
SCID mice within 10 days postinfection, and the mice are usually
moribund within 3 weeks (38). In Fig. 1 it was demonstrated
that serum administration on day 3 postinfection was effective at
bacterial clearance. To determine if administration of immune serum
could mediate bacterial clearance in SCID mice later than 3 days after infection, serum was administered 10 and 17 days postinfection and
bacterial loads in the liver were quantitated 1 and 2 weeks later.
Bacterial clearance was observed when serum was administered either 10 or 17 days postinfection, and the effect persisted for as long as 2 weeks (Fig. 4a; Table
2). Histological analyses 1 week after
serum administration revealed that the mice that received the immune
serum did not exhibit necrotic liver lesions and tissue inflammation
(data not shown).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 4.
Clearance of bacteria during active infection. (a)
C57BL/6 scid mice received PBS on day 10 or immune serum on
day 10 or day 17 postinfection and were analyzed by QPCR 1 and 2 weeks
later. Ec, E. chaffeensis. (b) SCID mice received PBS or
serum on day 10 postinfection and were analyzed 1, 3, 7, and 10 days
later. (c) SCID mice were administered serum on day 17 postinfection
and were analyzed 1 and 3 days later. The control mice shown in panels
b and c are identical. (d) Infected SCID mice received 0.1 ml of PBS or
dilutions of immune serum on day 3 postinfection and were analyzed 7 or
14 days later. The values in the key to the bars are the reciprocal
titers of the immune serum that was administered, as determined by
immunofluorescence assay. In all experiments, mice were analyzed only
where indicated by the histograms. *, bacteria were not detected. The
data obtained by semiquantitative analyses of the experiments shown in
panels a to c, as well as data from an additional experiment, are shown
in Table 2.
|
|
To determine the time required to observe bacterial clearance after
serum administration, SCID mice were infected, immune
serum was
administered 10 or 17 days postinfection, and the mice
were analyzed at
various intervals thereafter. Bacterial numbers
were reduced to low or
undetectable levels in the liver within
2 days of serum administration
(Fig.
4b and c; Table
2). The
data demonstrated that antibodies
mediated rapid clearance of
bacteria from infected tissues well after
infection and disease
had been
established.
To determine the effective serum dosage, graded amounts of immune serum
were administered to SCID mice 3 days postinfection
and liver tissue
was analyzed 7 and 14 days later. Administration
of serum (0.1 ml) with
an effective reciprocal titer of 100 or
higher on day 3 postinfection
resulted in the clearance of bacteria
from the liver (Fig.
4d). The
effects of the serum titration were
also evident when tissue was
analyzed 17 days postinfection, at
which time bacterial recovery was
dose dependent (Fig.
4d).
Repeated serum administration prolonged survival.
A variety of
explanations could account for the transient nature of the serum
protection. To determine if repeated serum administration could provide
prolonged immunity, immune serum was injected at weekly intervals
beginning 10 days postinfection and mice were analyzed 2 to 4 days
after each serum administration. Untreated SCID mice were moribund
within 3 to 4 weeks, but the treated mice exhibited reduced bacterial
loads and were free of disease when serum administration was continued
at weekly intervals, up to 52 days postinfection (Fig.
5). Cessation of serum treatment resulted in the recovery of bacterial numbers and the onset of liver disease within 7 to 14 days (data not shown). Therefore, antibodies provided extended immunity when they were administered at weekly intervals, although they did not support complete bacterial clearance.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5.
Repeated serum administration results in prolonged
immunity. Infected C57BL/6 scid mice received PBS or weekly
injections of serum beginning 10 days postinfection. Liver tissue was
harvested at 2- and 4-day intervals following each serum administration
(shaded histograms) or 28 days after infection of a mouse that received
no serum (black histogram). The bacterial loads were determined using
semiquantitative PCR. The data indicate the integrated optical
densities of ethidium bromide-stained PCR products in agarose gels, as
determined by densitometry. Semiquantitative PCR was utilized because
bacterial loads in the mice that received the antibodies were below the
limit of detection using QPCR. Two additional mice that did not receive
serum died and were not analyzed. *, PCR products were not detectable
in agarose gels. Based on the assumption that the 2 SCID mice that did
not survive exhibited levels of bacterial infection similar to that of
the surviving mouse, a statistical comparison of 10 treated mice that
exhibited low bacterial loads with 3 untreated mice indicated a
P value of 0.004 by Fisher's exact test (14). In
two additional experiments 13 mice that received two or more injections
of immune serum all survived longer than 31 days postinfection (not
shown).
|
|
The involvement of T cells in controlling infection.
The
failure of immune serum to completely eliminate bacteria in SCID mice
suggested that other mechanisms were responsible for the apparently
complete clearance observed in immunocompetent mice. To determine the
requirement for T cells in bacterial clearance, T-cell receptor
-chain-deficient mice, which lack 
T cells, were infected with
E. chaffeensis (23, 24). 
T cells were required for complete bacterial clearance, because in their absence persistent bacterial infection was observed for as long as 24 days
postinfection (Fig. 6). However, unlike
infection of SCID mice, where bacterial growth was uncontrolled and led
to morbidity, infection in the 
-T-cell-deficient mice was
maintained at relatively low levels. Protection from infection was not
due to the presence of 
T cells in the 
-T-cell-deficient
mice, because mice doubly deficient for both 
and 
T cells
also exhibited only low or undetectable infection (Fig. 6). The
T-cell-deficient mice did not exhibit any signs of disease at any time
during the postinfection period and in other experiments survived as
long as 72 days. Therefore, T cells were required for complete
bacterial clearance, but in their absence other cells, most likely B
cells, were able to provide significant immunity against infection.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 6.
Persistent infection in T-cell-deficient mice. T-cell
receptor -chain-deficient (TCRb), TCR /TCR -chain deficient
(TCRb/d), and C57BL/6 scid (SCID) mice were infected with
E. chaffeensis, and bacterial colonization was monitored by
semiquantitative PCR on the indicated days postinfection. PCR analyses
of C57BL/6 scid mice are shown as a basis for comparison.
Normalized data from three experiments are shown and represent the
averages of semiquantitative PCR analyses of three to four mice from
each of the gene-targeted strains. Error bars indicate standard
deviations. Data from the analyses of the SCID mice were obtained from
a single animal on the indicated days. Semiquantitative PCR was
utilized because it was not possible to detect the bacteria in the
T-cell-deficient mice by QPCR. The T-cell-deficient mice were
maintained on the C57BL/6 genetic background (strains C57BL/6
tcrb and C57BL/6 tcrb/tcrd). No sign of disease
was noted in any of the T-cell-deficient mice. *, PCR products were
not detectable in agarose gels.
|
|
 |
DISCUSSION |
Immunity to E. chaffeensis.
The data presented in this
study demonstrate that both cellular and humoral mechanisms contribute
to resistance to E. chaffeensis infection in the mouse. A
role for T cells was not surprising, because cellular immune responses
have long been considered to be essential for the elimination of
intracellular bacteria (32). However, the finding that
antibodies, in the absence of T and B cells, could cause elimination of
an obligate intracellular bacterium was unexpected, because humoral
immunity has generally been considered to be relatively ineffective
against many intracellular bacteria. A role for humoral immune
responses at the onset of intracellular infection has been suggested
from studies of other ehrlichiae. Passive transfer of antibodies
against Ehrlichia risticii protected mice from disease
(18), and administration of immune sera partially protected
C3H/HeN mice from infection with the agent of human granulocytic
ehrlichiosis (aoHGE) (33). These studies demonstrated the
efficacy of serum when administered prior to bacterial infection, so
one possible interpretation was that serum antibodies directly
neutralized the bacteria or blocked bacterial invasion of phagocytes.
In the data presented here, antibodies were shown to exert their
effects well after infection had been established in tissues,
demonstrating a physiological role for antibodies after the initiation
of an active infection.
Laboratory mice can be experimentally infected with
E. chaffeensis after intraperitoneal, subcutaneous, and intradermal
inoculation
using infected cells or cell-free ehrlichiae
(
38; E. Yager and
G. M. Winslow, unpublished
data). These routes of administration
clearly differ from the normal
route of tick transmission, but
it has not yet been determined whether
or how different routes
of administration affect antibody responses or
bacterial clearance.
In our studies, immune serum administration was
effective long
after infection had been established in many tissues, so
it is
unlikely that the protective effects observed were entirely an
artifact of experimental inoculation. This conclusion is supported
by
observations that mice were protected from infection by the
aoHGE when
bacteria were administered by either needle or tick
inoculation
(
33).
The protective effect of a single administration of immune serum
persisted for as long as 14 days postadministration. The
transient
nature of the protection was likely due to the depletion
of the
transferred antibodies. This conclusion is supported by
the analysis of
mice that received repeated administration of
immune serum, where it
was shown that protection could be maintained
for as long as 45 days
postinfection and, presumably, indefinitely.
Although bacteria were
often not detected in liver tissue by QPCR
after serum administration,
bacterial clearance was incomplete,
because the bacteria were able to
eventually recolonize the liver
and cause disease. The recovery of
bacteria may have originated
from low levels of persistent bacteria in
the tissue or may have
resulted from bacterial emigration from tissues
that may have
been inaccessible to the
antibodies.
The observation that antibodies alone failed to eliminate the bacteria
in SCID mice suggested that cellular immunity was required
for the
apparently complete clearance observed in immunocompetent
C57BL/6 mice.
T-cell-deficient mice developed a low-level chronic
infection,
indicating that T cells were required for complete
clearance. T cells
might be necessary to induce macrophage ehrlichiacidal
activities, to
directly kill infected cells, or to provide help
to B cells for
antibody production. T-cell-deficient mice were
susceptible to only
low-level infection and did not exhibit disease,
so it is possible that
the partial protection observed was due
to T-cell-independent B-cell
responses, although other differences
between SCID and T-cell-deficient
mice might also affect resistance.
In an immunocompetent mouse, the
T-cell-independent antibody responses
might act to control the disease
during the early stages of infection,
prior to the development of a
full T-cell
response.
E. chaffeensis antigens recognized by the mouse.
Western analyses indicated that several E. chaffeensis
antigens that may be targets of the protective antibodies were
recognized by the mouse. These included proteins of 22, 27, 28, 54, 73, and 88 kDa. The 28-kDa protein, which was highly immunodominant in several different mouse sera, is likely one of a family of E. chaffeensis OMPs that have been described previously (27,
30). Immunization of immunocompetent mice with the p28 OMP (also
known as ORF5) protected immunocompetent mice from infection
(27), suggesting that cellular or humoral responses to this
protein may be important during host defense. The p28 OMPs identified in several E. chaffeensis isolates were genetically diverse
(39), suggesting that antigenic variation in the OMP may
provide a mechanism for immune system evasion.
Humans are well known to make strong antibody responses to
E. chaffeensis (
8,
31). In this study, most of the
antigens
recognized by the mouse were also recognized using serum from
an infected human and the human antibody specificities observed
were
largely reminiscent of those in previously published reports
(
8,
9). Because similar humoral responses have been observed,
it is
likely that the underlying mechanisms of antibody-mediated
immunity in
mice and humans are quite
similar.
Mechanisms of humoral immunity to E. chaffeensis.
Because antibodies have not generally been considered to have an
important role during host defense against intracellular bacteria, it
will be important to identify the mechanisms whereby antibodies are
able to clear E. chaffeensis from infected tissues. Antibodies might, for example, act to facilitate the cytolysis of
organisms via the classical pathway of complement deposition and/or by
opsonization. However, this explanation would require that the
ehrlichiae be exposed to the extracellular milieu, perhaps during
intercellular migration. Although E. chaffeensis is known to
be an obligate intracellular bacterium, and thus requires host cells
for replication, it is possible that during their life cycle the
bacteria are found outside of cells, where they would be susceptible to
antibodies. Antibody-mediated bacterial clearance was observed to occur
within 2 days of antibody administration, so this explanation would
require that most resident bacteria be exposed extracellularly during
this relatively brief period. The closely related ehrlichia, the aoHGE,
is granulocytotropic, a tropism that would likely require these
ehrlichia to migrate rapidly among these short-lived cells. Such a
life-style might also be characteristic of E. chaffeensis. The particular sensitivity of the ehrlichiae to antibodies, which presumably act extracellularly, also suggests that there are aspects of
the life-styles of these obligate intracellular pathogens that have
previously gone unappreciated.
The failure of antibodies to mediate complete bacterial clearance
suggests that resident intracellular bacteria may be resistant
to
antibody-mediated clearance. Complete bacterial clearance has
been
shown to require T cells. However, antibodies might also
contribute to
intracellular elimination, perhaps by mediating
the cytolysis of
infected macrophages or of bacteria within infected
macrophages
(
15). Preliminary studies have indicated that natural
killer
cell-mediated antibody-dependent cell cytotoxicity was
not involved in
antibody-mediated immunity, because serum-mediated
clearance occurred
in SCID mice after antibody-mediated natural
killer cell depletion
(G. M. Winslow and E. Yager, unpublished
data). It is also
possible that antibodies or immune complexes
trigger ehrlichiacidal
activities in infected macrophages. In
support of this hypothesis, in
vitro studies have indicated that
immune complexes of
E. chaffeensis induced inflammatory cytokine
production in a human
macrophage cell line (
20). Administration
of Fab fragments
of serum antibodies proved not to be effective
at bacterial clearance
(E. Volk and G. M. Winslow, unpublished
data), but the
interpretation of the experiments was complicated
by possible
differences in the half-lives of the fragmented antibodies.
Another
hypothesis is that antibodies might directly affect bacterial
viability
within intracellular compartments (
2). Some studies
have
suggested that antibodies can neutralize viruses inside infected
cells
(
21), so a role for intracellular antibodies during
intracellular
bacterial infection is possible. Further studies will be
required
to distinguish between these
mechanisms.
Humoral immunity and intracellular pathogens.
The particular
sensitivity of E. chaffeensis to antibodies may reflect
features unique to the ehrlichiae. However, a growing body of old and
new evidence suggests that antibodies can contribute to immunity to
several other intracellular bacterial as well as fungal pathogens
(6). Antibodies that provide protection against infection by
intracellular pathogens such as Salmonella spp. (12, 28), M. tuberculosis (34), Legionella
pneumophila (5), Brucella abortus (11,
29), Rickettsia typhi (15) and
Cryptococcus neoformans (7, 25) have been
identified. Unlike what was done in the present study, however,
antibody efficacy was generally evaluated by experimental
administration of antibodies prior to infection with these agents, so
it was not possible to judge the role of antibodies after the
infections were initiated. Nevertheless, the data challenge the notion
that immunity to intracellular pathogens is solely the domain of
cellular immune responses. Humoral responses might previously have gone
unappreciated during intracellular infections, in part due to the
choice of experimental organism, host genetics, and experimental
design. In other cases, a contribution for humoral immunity during
intracellular infection might have been overlooked when the activities
of protective antibodies were masked by nonprotective antibodies
(40).
The findings that antibodies can contribute to host defense have
important implications for the design of vaccines and therapies
to
eliminate intracellular bacterial pathogens, i.e., it may be
desirable
to elicit both cellular and humoral immune responses
to obtain maximum
efficacy. Indeed, the efficacy of a
Salmonella enterica
serovar Typhi capsular polysaccharide vaccine presumably
owes its
effectiveness to the ability to elicit humoral immune
responses
(
1).
 |
ACKNOWLEDGMENTS |
We thank Frank Abbruscato, Melissa Reilly, and Michelle Tackley
for excellent technical assistance, and Donal Murphy for critical review of the manuscript, and Arturo Casadevall and Harry Taber for
helpful discussion. We recognize the contribution of the Wadsworth Center's Immunology and Molecular Biology Core facilities and the
Department of Anatomical Pathology.
This work was supported in part by U.S. Public Health Service grant
CA69710-02 and by Centers for Disease Control and Prevention grant
U50/CCU213698-01-1.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Wadsworth
Center, 120 New Scotland Ave., Albany, NY 12208. Phone: (518) 473-2795. Fax: (518) 486-4395. E-mail: gary.winslow{at}wadsworth.org.
Present address: Department of Pathology, Case Western Reserve
University, MetroHealth Medical Center, Cleveland, OH 44109.
Editor:
T. R. Kozel
 |
REFERENCES |
| 1.
|
Acharya, I. L.,
C. U. Lowe,
R. Thapa,
V. L. Gurubacharya,
M. B. Shrestha,
M. Cadoz,
D. Schulz,
J. Armand,
D. A. Bryla,
M. P. H. Birger Trollfors,
T. Cramton,
R. Schneerson, and J. B. Robbins.
1987.
Prevention of typhoid fever in Nepal with the Vi capsular polysaccharide of Salmonella typhi.
N. Engl. J. Med.
317:1101-1104[Abstract].
|
| 2.
|
Alarcón-Segovia, D.,
A. Ruiz-Argüelles, and L. Llorente.
1996.
Broken dogma: penetration of autoantibodies into living cells.
Immunol. Today
17:163-164[Medline].
|
| 3.
|
Allen, J. E., and R. M. Maizels.
1997.
Th1-Th2: reliable paradigm or dangerous dogma?
Immunol. Today
18:387-392[CrossRef][Medline].
|
| 4.
|
Anderson, B. E.,
J. E. Dawson,
D. C. Jones, and K. H. Wilson.
1991.
Ehrlichia chaffeensis, a new species associated with human ehrlichiosis.
J. Clin. Microbiol.
29:2838-2842[Abstract/Free Full Text].
|
| 5.
|
Brieland, J. K.,
L. A. Heath,
G. B. Huffnagle,
D. G. Remick,
M. S. McClain,
M. C. Hurley,
R. K. Kunkel,
J. C. Fantone, and C. Engleberg.
1996.
Humoral immunity and regulation of intrapulmonary growth of Legionella pneumophila in the immunocompetent host.
J. Immunol.
157:5002-5008[Abstract].
|
| 6.
|
Casadevall, A.
1998.
Antibody-mediated protection against intracellular pathogens.
Trends Microbiol.
6:102-107[CrossRef][Medline].
|
| 7.
|
Casadevall, A.
1995.
Antibody immunity and invasive fungal infections.
Infect. Immun.
63:4211-4218[Medline].
|
| 8.
|
Chen, S.-M.,
L. C. Cullman, and D. H. Walker.
1997.
Western immunoblotting analysis of the antibody responses of patients with human monocytotropic ehrlichiosis to different strains of Ehrlichia chaffeensis and Ehrlichia canis.
Clin. Infect. Dis.
4:731-735.
|
| 9.
|
Chen, S.-M.,
J. S. Dumler,
H.-M. Feng, and D. H. Walker.
1994.
Identification of the antigenic constituents of Ehrlichia chaffeensis.
Am. J. Trop. Med. Hyg.
50:52-58.
|
| 10.
|
Chu, F. K.
1998.
Rapid and sensitive PCR-based detection and differentiation of etiologic agents of human granulocytic and monocytotropic ehrlichioses.
Mol. Cell. Probes
12:93-99[CrossRef][Medline].
|
| 11.
|
Cloeckaert, A.,
I. Jacques,
P. De Wergifosse,
G. Dubray, and J. N. Limet.
1992.
Protection against Brucella melitensis or Brucella abortus in mice with immunoglobulin G (IgG), IgA, and IgM monoclonal antibodies specific for a common epitope shared by the Brucella A and M smooth lipopolysaccharides.
Infect. Immun.
60:312-315[Abstract/Free Full Text].
|
| 12.
|
Eisenstein, T. K.,
L. M. Killar, and B. M. Sultzer.
1984.
Immunity to infection with Salmonella typhimurium: mouse-strain differences in vaccine- and serum-mediated protection.
J. Infect. Dis.
150:425-435[Medline].
|
| 13.
|
Fichtenbaum, C. J.,
L. R. Peterson, and G. J. Weil.
1993.
Ehrlichiosis presenting as a life-threatening illness with features of toxic shock syndrome.
Am. J. Med.
95:351-357[CrossRef][Medline].
|
| 14.
|
Fisher, R. A.
1935.
The logic of inductive reference.
J. R. Stat. Soc.
98:39-54[CrossRef].
|
| 15.
|
Gambrill, M. R., and C. L. J. Wisseman.
1973.
Mechanisms of immunity in typhus infections. III. Influence of human immune serum and complement on the fate of Rickettsia mooseri within human macrophages.
Infect. Immun.
8:631-640[Abstract/Free Full Text].
|
| 16.
|
Guenthner, P. C., and C. E. Hart.
1998.
Quantitative, competitive PCR assay for HIV-1 infection using a microplate-based detection system.
BioTechniques
24:810-816[Medline].
|
| 17.
|
Kaufmann, S. H. E.
1993.
Immunity to intracellular bacteria.
Adv. Immunol.
11:129-163.
|
| 18.
|
Kaylor, P. S.,
T. B. Crawford,
T. F. McElwain, and G. H. Palmer.
1991.
Passive transfer of antibody to Ehrlichia risticii protects mice from ehrlichiosis.
Infect. Immun.
59:2058-2062[Abstract/Free Full Text].
|
| 19.
|
Lane, F. C., and E. R. Unanue.
1972.
Requirement of thymus (T) lymphocytes for resistance to listeriosis.
J. Exp. Med.
135:1104-1112[Abstract].
|
| 20.
|
Lee, E., and Y. Rikihisa.
1997.
Anti-Ehrlichia chaffeensis antibody complexed with E. chaffeensis induces potent proinflammatory cytokine mRNA expression in human monocytes through sustained reduction of I B- and activation of NF- B.
Infect. Immun.
65:2890-2897[Abstract].
|
| 21.
|
Levine, B.,
J. M. Hardwick,
B. D. Trapp,
T. O. Crawford,
R. C. Bollinger, and D. E. Griffin.
1991.
Antibody-mediated clearance of alphavirus infection from neurons.
Science
254:856-860[Abstract/Free Full Text].
|
| 22.
|
Miki, K., and G. B. Mackaness.
1964.
The passive transfer of acquired resistance to Listeria monocytogenes.
J. Exp. Med.
120:93-103[Abstract].
|
| 23.
|
Mombaerts, P.,
J. Arnoldi,
F. Russ,
S. Tonegawa, and S. H. E. Kaufmann.
1993.
Different roles of  and  T cells in immunity against an intracellular bacterial pathogen.
Nature
365:53-56[CrossRef][Medline].
|
| 24.
|
Mombaerts, P.,
A. R. Clarke,
M. A. Rudnicki,
J. Iacomini,
S. Itohara,
J. J. Lafaille,
L. Wang,
Y. Ichikawa,
R. Jaenisch,
M. L. Hooper, and S. Tonewaga.
1992.
Mutations in T-cell antigen receptor genes and block thymocyte development at different stages.
Nature
360:225-231[CrossRef][Medline].
|
| 25.
|
Mukherjee, J.,
M. D. Scharff, and A. Casadevall.
1992.
Protective murine monoclonal antibodies to Cryptococcus neoformans.
Infect. Immun.
60:4534-4541[Abstract/Free Full Text].
|
| 26.
|
North, R. J.
1974.
T-cell dependence of macrophage activation and mobilization during infection with Mycobacterium tuberculosis.
Infect. Immun.
10:66-71[Abstract/Free Full Text].
|
| 27.
|
Ohashi, N.,
N. Zhi,
Y. Zhang, and Y. Rikihisa.
1998.
Immunodominant major outer membrane proteins of E. chaffeensis are encoded by a polymorphic multigene family.
Infect. Immun.
66:132-139[Abstract/Free Full Text].
|
| 28.
|
Ornellas, E. P.,
R. J. Roantree, and J. P. Steward.
1970.
The specificity and importance of humoral antibody in the protection of mice against intraperitoneal challenge with complement-sensitive and complement-resistant Salmonella.
J. Infect. Dis.
121:113-123[Medline].
|
| 29.
|
Plommet, M., and A.-M. Plommet.
1983.
Immune serum-mediated effects on brucellosis evolution in mice.
Infect. Immun.
41:97-105[Abstract/Free Full Text].
|
| 30.
|
Reddy, G. R.,
C. R. Sulsona,
A. F. Barbet,
S. M. Mahan,
M. J. Burridge, and A. R. Alleman.
1998.
Molecular characterization of a 28 kDa surface antigen gene family of the tribe ehrlichiae.
Biochem. Biophys. Res. Commun.
247:636-643[CrossRef][Medline].
|
| 31.
|
Rikihisa, Y.,
S. A. Ewing, and J. C. Fox.
1994.
Western immunoblot analysis of Ehrlichia chaffeensis, E. canis, or E. ewingi infections in dogs and humans.
J. Clin. Microbiol.
32:2107-2112[Abstract/Free Full Text].
|
| 32.
|
Schaible, U. E.,
H. L. Collins, and S. H. E. Kaufmann.
1999.
Confrontation between intracellular bacteria and the immune system.
Adv. Immunol.
71:267-377[Medline].
|
| 33.
|
Sun, W.,
J. W. Ijdo,
S. R. Telford III,
E. Hodzic,
Y. Zhang,
S. W. Barthold, and E. Fikrig.
1997.
Immunization against the agent of human granulocytic ehrlichiosis in a murine model.
J. Clin. Investig.
100:3014-3018[Medline].
|
| 34.
|
Teitelbaum, R.,
A. Glatman-Freedman,
B. Chen,
J. B. Robbins,
E. Unanue,
A. Casadevall, and B. R. Bloom.
1998.
A mAb recognizing a surface antigen of Mycobacterium tuberculosis enhances host survival.
Proc. Natl. Acad. Sci. USA
95:15688-15693[Abstract/Free Full Text].
|
| 35.
|
Telford, S. R., III, and J. E. Dawson.
1996.
Persistent infection of C3H/HeJ mice by Ehrlichia chaffeensis.
Vet. Microbiol.
52:103-112[CrossRef][Medline].
|
| 36.
|
Walker, D. H., and J. S. Dumler.
1997.
Human monocytic and granulocytic ehrlichioses.
Arch. Pathol. Lab. Med.
121:785-791[Medline].
|
| 37.
|
Wilcoxon, F.
1945.
Individual comparisons by ranking methods.
Biometrics
1:80-83[CrossRef].
|
| 38.
|
Winslow, G.,
E. Yager,
K. Shilo,
D. N. Collins, and F. K. Chu.
1998.
Infection of the laboratory mouse with the intracellular pathogen Ehrlichia chaffeensis.
Infect. Immun.
66:3892-3899[Abstract/Free Full Text].
|
| 39.
|
Yu, X. J.,
J. McBride, and D. H. Walker.
1999.
Genetic diversity of the 28-kilodalton outer membrane protein gene in human isolates of Ehrlichia chaffeensis.
J. Clin. Microbiol.
37:1137-1143[Abstract/Free Full Text].
|
| 40.
|
Yuan, R.,
A. Casadevall,
G. Spira, and M. D. Scharff.
1995.
Isotype switching from IgG3 to IgG1 converts a nonprotective murine antibody to Cryptococcus neoformans to a protective antibody.
J. Immunol.
154:1810-1816[Abstract].
|
Infection and Immunity, April 2000, p. 2187-2195, Vol. 68, No. 4
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Luo, T., Zhang, X., McBride, J. W.
(2009). Major Species-Specific Antibody Epitopes of the Ehrlichia chaffeensis p120 and E. canis p140 Orthologs in Surface-Exposed Tandem Repeat Regions. CVI
16: 982-990
[Abstract]
[Full Text]
-
Huntley, J. F., Conley, P. G., Rasko, D. A., Hagman, K. E., Apicella, M. A., Norgard, M. V.
(2008). Native Outer Membrane Proteins Protect Mice against Pulmonary Challenge with Virulent Type A Francisella tularensis. Infect. Immun.
76: 3664-3671
[Abstract]
[Full Text]
-
Luo, T., Zhang, X., Wakeel, A., Popov, V. L., McBride, J. W.
(2008). A Variable-Length PCR Target Protein of Ehrlichia chaffeensis Contains Major Species-Specific Antibody Epitopes in Acidic Serine-Rich Tandem Repeats. Infect. Immun.
76: 1572-1580
[Abstract]
[Full Text]
-
Zhang, G., Russell-Lodrigue, K. E., Andoh, M., Zhang, Y., Hendrix, L. R., Samuel, J. E.
(2007). Mechanisms of Vaccine-Induced Protective Immunity against Coxiella burnetii Infection in BALB/c Mice. J. Immunol.
179: 8372-8380
[Abstract]
[Full Text]
-
Nandi, B., Hogle, K., Vitko, N., Winslow, G. M.
(2007). CD4 T-Cell Epitopes Associated with Protective Immunity Induced following Vaccination of Mice with an Ehrlichial Variable Outer Membrane Protein. Infect. Immun.
75: 5453-5459
[Abstract]
[Full Text]
-
Nethery, K. A., Doyle, C. K., Zhang, X., McBride, J. W.
(2007). Ehrlichia canis gp200 Contains Dominant Species-Specific Antibody Epitopes in Terminal Acidic Domains. Infect. Immun.
75: 4900-4908
[Abstract]
[Full Text]
-
Ismail, N., Crossley, E. C., Stevenson, H. L., Walker, D. H.
(2007). Relative Importance of T-Cell Subsets in Monocytotropic Ehrlichiosis: a Novel Effector Mechanism Involved in Ehrlichia-Induced Immunopathology in Murine Ehrlichiosis. Infect. Immun.
75: 4608-4620
[Abstract]
[Full Text]
-
Ge, Y., Rikihisa, Y.
(2007). Surface-Exposed Proteins of Ehrlichia chaffeensis. Infect. Immun.
75: 3833-3841
[Abstract]
[Full Text]
-
Huntley, J. F., Conley, P. G., Hagman, K. E., Norgard, M. V.
(2007). Characterization of Francisella tularensis Outer Membrane Proteins. J. Bacteriol.
189: 561-574
[Abstract]
[Full Text]
-
Ganta, R. R., Cheng, C., Miller, E. C., McGuire, B. L., Peddireddi, L., Sirigireddy, K. R., Chapes, S. K.
(2007). Differential Clearance and Immune Responses to Tick Cell-Derived versus Macrophage Culture-Derived Ehrlichia chaffeensis in Mice. Infect. Immun.
75: 135-145
[Abstract]
[Full Text]
-
Tjarnlund, A., Rodriguez, A., Cardona, P.-J., Guirado, E., Ivanyi, J., Singh, M., Troye-Blomberg, M., Fernandez, C.
(2006). Polymeric IgR knockout mice are more susceptible to mycobacterial infections in the respiratory tract than wild-type mice. Int Immunol
18: 807-816
[Abstract]
[Full Text]
-
Yager, E., Bitsaktsis, C., Nandi, B., McBride, J. W., Winslow, G.
(2005). Essential Role for Humoral Immunity during Ehrlichia Infection in Immunocompetent Mice. Infect. Immun.
73: 8009-8016
[Abstract]
[Full Text]
-
Lopez, J. E., Siems, W. F., Palmer, G. H., Brayton, K. A., McGuire, T. C., Norimine, J., Brown, W. C.
(2005). Identification of Novel Antigenic Proteins in a Complex Anaplasma marginale Outer Membrane Immunogen by Mass Spectrometry and Genomic Mapping. Infect. Immun.
73: 8109-8118
[Abstract]
[Full Text]
-
Tate, C. M., Mead, D. G., Luttrell, M. P., Howerth, E. W., Dugan, V. G., Munderloh, U. G., Davidson, W. R.
(2005). Experimental Infection of White-Tailed Deer with Anaplasma phagocytophilum, Etiologic Agent of Human Granulocytic Anaplasmosis. J. Clin. Microbiol.
43: 3595-3601
[Abstract]
[Full Text]
-
Rivera, J., Zaragoza, O., Casadevall, A.
(2005). Antibody-Mediated Protection against Cryptococcus neoformans Pulmonary Infection Is Dependent on B Cells. Infect. Immun.
73: 1141-1150
[Abstract]
[Full Text]
-
Casadevall, A., Pirofski, L.-a.
(2004). New Concepts in Antibody-Mediated Immunity. Infect. Immun.
72: 6191-6196
[Full Text]
-
Feng, H.-M., Whitworth, T., Olano, J. P., Popov, V. L., Walker, D. H.
(2004). Fc-Dependent Polyclonal Antibodies and Antibodies to Outer Membrane Proteins A and B, but Not to Lipopolysaccharide, Protect SCID Mice against Fatal Rickettsia conorii Infection. Infect. Immun.
72: 2222-2228
[Abstract]
[Full Text]
-
Feng, H.-M., Walker, D. H.
(2004). Mechanisms of Immunity to Ehrlichia muris: a Model of Monocytotropic Ehrlichiosis. Infect. Immun.
72: 966-971
[Abstract]
[Full Text]
-
Ganta, R. R., Cheng, C., Wilkerson, M. J., Chapes, S. K.
(2004). Delayed Clearance of Ehrlichia chaffeensis Infection in CD4+ T-Cell Knockout Mice{dagger}. Infect. Immun.
72: 159-167
[Abstract]
[Full Text]
-
Casadevall, A.
(2003). Antibody-Mediated Immunity against Intracellular Pathogens: Two-Dimensional Thinking Comes Full Circle. Infect. Immun.
71: 4225-4228
[Full Text]
-
Li, J. S.-y., Winslow, G. M.
(2003). Survival, Replication, and Antibody Susceptibility of Ehrlichia chaffeensis outside of Host Cells. Infect. Immun.
71: 4229-4237
[Abstract]
[Full Text]
-
McBride, J. W., Corstvet, R. E., Gaunt, S. D., Boudreaux, C., Guedry, T., Walker, D. H.
(2003). Kinetics of Antibody Response to Ehrlichia canis Immunoreactive Proteins. Infect. Immun.
71: 2516-2524
[Abstract]
[Full Text]
-
Paddock, C. D., Childs, J. E.
(2003). Ehrlichia chaffeensis: a Prototypical Emerging Pathogen. Clin. Microbiol. Rev.
16: 37-64
[Abstract]
[Full Text]
-
Brown, W. C., McGuire, T. C., Mwangi, W., Kegerreis, K. A., Macmillan, H., Lewin, H. A., Palmer, G. H.
(2002). Major Histocompatibility Complex Class II DR-Restricted Memory CD4+ T Lymphocytes Recognize Conserved Immunodominant Epitopes of Anaplasma marginale Major Surface Protein 1a. Infect. Immun.
70: 5521-5532
[Abstract]
[Full Text]
-
Li, J. S.-y., Chu, F., Reilly, A., Winslow, G. M.
(2002). Antibodies Highly Effective in SCID Mice During Infection by the Intracellular Bacterium Ehrlichia chaffeensis Are of Picomolar Affinity and Exhibit Preferential Epitope and Isotype Utilization. J. Immunol.
169: 1419-1425
[Abstract]
[Full Text]
-
Rivera, J., Mukherjee, J., Weiss, L. M., Casadevall, A.
(2002). Antibody Efficacy in Murine Pulmonary Cryptococcus neoformans Infection: A Role for Nitric Oxide. J. Immunol.
168: 3419-3427
[Abstract]
[Full Text]
-
Ganta, R. R., Wilkerson, M. J., Cheng, C., Rokey, A. M., Chapes, S. K.
(2002). Persistent Ehrlichia chaffeensis Infection Occurs in the Absence of Functional Major Histocompatibility Complex Class II Genes. Infect. Immun.
70: 380-388
[Abstract]
[Full Text]
-
Morrison, S. G., Morrison, R. P.
(2001). Resolution of Secondary Chlamydia trachomatis Genital Tract Infection in Immune Mice with Depletion of Both CD4+ and CD8+ T cells. Infect. Immun.
69: 2643-2649
[Abstract]
[Full Text]
-
Shu-yi Li, J., Yager, E., Reilly, M., Freeman, C., Reddy, G. R., Reilly, A. A., Chu, F. K., Winslow, G. M.
(2001). Outer Membrane Protein-Specific Monoclonal Antibodies Protect SCID Mice from Fatal Infection by the Obligate Intracellular Bacterial Pathogen Ehrlichia chaffeensis. J. Immunol.
166: 1855-1862
[Abstract]
[Full Text]
-
Brown, W. C., McGuire, T. C., Zhu, D., Lewin, H. A., Sosnow, J., Palmer, G. H.
(2001). Highly Conserved Regions of the Immunodominant Major Surface Protein 2 of the Genogroup II Ehrlichial Pathogen Anaplasma marginale Are Rich in Naturally Derived CD4+ T Lymphocyte Epitopes that Elicit Strong Recall Responses. J. Immunol.
166: 1114-1124
[Abstract]
[Full Text]