INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Human cysticercosis is a disease caused by the larval stage of the cestode parasite Taenia solium. Humans acquire the larvae by ingestion of eggs released from the adult tapeworm. Human cysticercosis is common in Mexico and underdeveloped countries and is increasing in prevalence in North America (5, 10, 11). Infection of the central nervous system leads to neurocysticercosis. An excellent model system for the study of this disease is infection of BALB/c mice with another taeniid parasite, Taenia crassiceps. The rodent is the natural intermediate host for this parasite, and the definitive host is a canine. The cysts multiply in the peritoneal cavity of the mouse by budding asexually in a seemingly uncontrolled manner, making the BALB/c mice extremely susceptible to infection. Analysis of the immune response that ensues during infection has shown that it is a mixed Th1/Th2 phenotype (15) that is ineffective in controlling parasite growth.

To better determine immune responses that have the capacity to kill cestode larvae, a model system in which T. crassiceps larvae are immunologically killed in vivo was developed by a method similar to one reported earlier (12). In our work, it was found that a primary subcutaneous (SQ) infection of T. crassiceps larvae induces killing of larvae during a secondary intraperitoneal (i.p.) infection. In the present study, we report the conditions for inducing larval destruction, the effect of host responses to larvae SQ and i.p. as observed by scanning electron microscopy (EM), and the cell populations and cytokine production present i.p. as determined by enzyme-linked immunosorbent assay (ELISA) and reverse transcription-PCR (RT-PCR). SQ followed by i.p. infection provides an in vivo model system in which the complete killing of larval T. crassiceps, and the immune mechanisms required for this killing can be examined.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Mice and infections. Six-week-old female BALB/cJ mice were purchased from The Jackson Laboratory (Bar Harbor, Maine). The ORF strain of T. crassiceps was used for infections (6). Parasites were obtained from the peritoneal cavity of BALB/cJ mice that were infected for 3 to 4 months and were washed three times with an equal volume of phosphate-buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 8.1 mM Na₂HPO₄, 1.47 mM KH₂PO₄ [pH 7.2]) under sterile conditions. Mice were infected by injection of 10 small (<2-mm) larvae in 0.5 ml of PBS either i.p. or SQ, using a 20-gauge needle. Unless specified otherwise, mice designated as having SQ infections will be those infected SQ for 30 to 60 days. Mice infected for 30 to 60 days SQ followed by i.p. infection are also referred to as challenged mice.

Preparation of larvae and EM. Larvae were removed from the peritoneal cavity of mice by peritoneal lavage with 10 ml of PBS, fixed in 10% formalin for at least 24 h, and then kept at 4°C until use. The specimens were then covered in 0.1 M Sorenson's physiological solution containing 2% glutaraldehyde (0.2 M Sorenson's buffer [4 ml] [6.41 g of NaH₂PO₄, 41.3 g of Na₂HPO₄ · 7H₂O, pH 7.2, distilled water to 1.0 liter], 8% glutaraldehyde [2 ml], water [2 ml]) and left overnight at 0°C. They were then rinsed with four changes (30 min each) of 0.1 M Sorenson's buffer, covered with 2% OsO₄ in Sorenson's buffer for 1 h, and taken through a dehydration series (50% through 100% ethanol). The specimens were dried in a Pelco CPD-2 critical point dryer (Ted Pella, Inc., Redding, Calif.), coated with gold in a Pelco SC-4 sputter coater (Ted Pella, Inc.), and visualized using an Amray (Bedford, Mass.) model 1810 scanning electron microscope, all according to the manufacturer's instructions. Photographs were taken with positive/negative film (Polaroid Corp., Cambridge, Mass.).

Peritoneal and spleen cell preparations. Cells were cultured in RPMI 1640 with L-glutamine (Mediatech, Herndon, Va.) supplemented with heat-inactivated fetal bovine serum (Atlanta Biologicals, Norcross, Ga.) and antibiotics (5 U of penicillin, 5 µg of streptomycin, and 10 µg of neomycin per ml; Sigma Chemical Co., St. Louis, Mo.). This medium is referred to as RPMI-C.

Flow cytometry. PECs were examined for the percentages of CD4⁺, CD8⁺, CD5⁺, B220⁺, and F4/80⁺ cells. Phycoerythrin-labeled anti-CD4 (H129.19) and anti-CD8 (53.67) antibodies were used for fluorescent labeling. Nonspecific binding was blocked with FcBlock, and the isotype control was phycoerythrin-labeled rat immunoglobulin G2a. All of these reagents were purchased from PharMingen (San Diego, Calif.) except for the F4/80 antibody, which was purchased from Biosource International (Camarillo, Calif.). One million cells were washed in 1 ml of staining buffer (PBS, 1% bovine serum albumin, 0.1% NaN₃ [pH 7.5]) and then stained with 1 µg of the appropriate antibody in 100 µl of staining buffer (30 min, 4°C). Incubation of the unlabeled antibody against the F4/80 macrophage marker was followed by incubation with 1 µg of a fluorescein isothiocyanate-labeled anti-rat antibody in 100 µl of staining buffer (30 min, 4°C). The stained cells were fixed in 500 µl of Ortho Permeafix (Ortho Diagnostics Inc., Raritan, N.J.) and analyzed by flow cytometry (Coulter Epics XL) at the Wake Forest University School of Medicine. Analysis was completed using WinList (Verity Software House, Inc., Topsham, Maine).

Preparation of soluble larval antigen preparation (SLAP). Larvae were removed from the peritoneal cavity from mice that were infected for at least 4 months. The larvae were washed three times with an equal volume of ice-cold PBS, and then all excess PBS was removed. Packed larvae were then sonicated until no large particles were apparent. To keep the solution cold, sonication was paused every 30 s and the solution was placed on ice. The preparation was then homogenized with a smooth pestle tissue grinder to disrupt any remaining aggregates. Insoluble materials were removed by centrifugation (20,000 × g, 1 h, 4°C). Supernatants were filter sterilized, and the protein concentration was determined by the Bradford method (Bio-Rad, Hercules, Calif.). The solution was brought to a final protein concentration of 1 µg/ml with sterile PBS and then stored at 20°C until use.

Spleen cell proliferation and stimulation for cytokine production. Spleen cells were plated in RPMI-C in flat-bottom, polystyrene 96-well plates (Corning Glass Works, Corning, N.Y.) at 5 × 10⁵ cells/well in triplicate and were stimulated with indicated concentrations of concanavalin A (ConA; Sigma, St. Louis, Mo.) or SLAP in a final volume of 250 µl/well. After 60 h of incubation, 1 µCi of [³H]thymidine (ICN Pharmaceuticals, Irvine, Calif.) diluted in 10 µl of RPMI-C was added to each well. Thymidine incorporation was measured by liquid scintillation spectroscopy (LS-1801; Beckman Instruments Inc., Fullerton, Calif.).

Cytokine ELISAs. Capture and detection antibodies were purchased from PharMingen, and ELISAs were run according to the manufacturer's protocol. The concentrations of gamma interferon (IFN-), interleukin-4 (IL-4), and IL-10 in each sample were determined in triplicate, and the mean of each sample was calculated. Sensitivities of the ELISA for IFN-, IL-10, and IL-4 were 10, 2, and 2 pg/ml, respectively.

RT-PCR. RNA was extracted from 10⁷ PECs as previously described (2). RNA was analyzed spectrophotometrically (Beckman DU-64) by measuring concentration at 260 nm and testing for purity using the A₂₆₀/A₂₈₀ ratio. All RNA samples had an A₂₆₀/A₂₈₀ ratio of between 1.5 and 2.0. Two micrograms of RNA was reverse transcribed in 40-µl reactions using Moloney murine leukemia virus reverse transcriptase (Amersham Life Science, Inc., Cleveland, Ohio) at 200 U/µl and oligo(dT)_12-18 (Pharmacia, Piscataway, N.J.) at 1 µg/ml. cDNAs were precipitated and resuspended in deionized water, and then cytokine-specific cDNAs were amplified by PCR using the following conditions and primers: 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 0.11 mM each deoxynucleoside triphosphate, 2.3 pmol of each cytokine-specific primer (1) or -actin-specific primer (3' primer, 5'CTCTTTGATGTCACGCACGATTTTC3'; 5' primer, 5'GACGAGGCGCAGAGCAAGAGAGG3') per µl, 1.15 mM MgCl₂, and 1.3 U of AmpliTaq DNA polymerase (Perkin-Elmer, Branchburg, N.J.) in a 50-µl reaction in Thermolyne oil-free tubes (Barnstead Thermolyne Corp., Dubuque, Iowa). Cycle conditions were as follows: premelting at 95°C for 2 min, annealing at 52°C for 1 min, elongation at 72°C for 1 min, and denaturation at 95°C for 50 s (35 cycles [25 cycles for -actin]), final anneal at 52°C for 2 min, and final elongation at 72°C for 2 min. PCR products were run on a 1.5% agarose gel in Tris acetate buffer containing ethidium bromide. Gels were imaged and analyzed on an AlphaImager 2000 (Alpha Innotech Corporation, San Leandro, Calif.) using spot densitometry. Ratios of the cytokine PCR product to the corresponding -actin PCR product were compared.

Detection of nitric oxide. Nitric oxide production by PECs was detected using the Greiss reaction as previously described (7). Briefly, 50 µl of 1% sulfanilimide solution and 50 µl of 1% naphthylethylenediamine dihydrochloride were added to 50-µl samples in a 96-well plate. Absorbance was measured at 550 nm.

Nitric oxide inhibition. BALB/cJ mice were injected SQ with 10 T. crassiceps larvae and then 30 to 60 days later injected i.p. with 10 larvae. Immediately thereafter, one half of the mice were injected i.p. with aminoguanidine (50 µg/kg of body weight in 500 µl of sterile PBS), and this injection was continued twice daily using the same concentration of aminoguanidine. Control mice received injections of PBS (500 µl). After 7 days, the mice were killed by cervical dislocation, larvae were counted, and serum and PECs were obtained as described.

Statistical analyses. Data were analyzed for statistical significance using Student's t test. Unless otherwise stated, data are presented as means ± standard deviation and were considered significantly different when P was <0.05.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Primary SQ infection prevents secondary i.p. infection. To determine if a primary infection of larvae would prevent the establishment of a secondary infection, mice were infected SQ for 100 days and then i.p. for 30 days. Mice that received an initial SQ injection of larvae destroyed all larvae (n = 3) in the peritoneal cavity, whereas mice receiving larvae only i.p. had progressing infections (27.0 ± 8.5; n = 3).

View larger version (14K): [in this window] [in a new window]   FIG. 1.   (A) Numbers of larvae in mice 7 days after i.p. infection. Mice (n = 21) were injected SQ and then 30 to 60 days later were injected i.p. Control mice (n = 11) received only the i.p. infection. Mice were killed 7 days after i.p. infection, and total larvae (white bars) and viable larvae (solid bars) in the peritoneal cavity were counted. (B) Numbers of larvae in mice 14 days after i.p. infection. Mice (n = 3) were injected SQ and then 30 to 60 days later were injected i.p. Control mice (n = 3) received only the i.p. injection. Mice were killed 14 days after i.p. infection, and total numbers of larvae (white bars) and viable larvae (cross-hatched bars) in the peritoneal cavity were counted. *, significant difference between values within the group of total larvae or viable larvae.

Condition of larvae recovered from the peritoneal cavity. Larvae removed from both the SQ and i.p. locations were prepared for scanning EM. Figures 2A and B show scanning electron micrographs of larvae removed from mice infected i.p. alone for 7 days. Figure 2A is representative of larvae removed from the peritoneal cavity. Due to the dehydration and critical point drying process, some damage to the tegument of the larvae occurred. Otherwise, the larvae were intact and undamaged when removed from the peritoneal cavity. Figure 2B shows the surface of a larva under greater magnification; the microtrichs are plainly visible.

View larger version (106K): [in this window] [in a new window]   FIG. 2.   Scanning EM of larvae removed from the peritoneal cavity. (A and B) Larvae removed from mice infected 7 day i.p. only. The tegument is visible, and the larvae appear undamaged by the host immune system. (C and D) Larvae removed from mice infected SQ followed by i.p. infection for 7 days. Tegument is encased in host cells with underlying matrix. Original magnifications: A and C, ×60; B and D, ×650.

View larger version (144K): [in this window] [in a new window]   FIG. 3.   Scanning EM of surface of viable and nonviable larvae. Viable and nonviable larvae were separated after removal from the peritoneal cavity of mice infected SQ followed by i.p. infection for 7 days. (A and B) Viable larvae; (C and D) nonviable larvae. Note the less dense layer of cells and thick matrix of fibrous material that is present on the nonviable larvae. Magnifications range between ×300 and ×500.

Composition of PECs. PECs from mice infected i.p. for 7 days and mice infected SQ followed by infection i.p. were stained for the presence of CD4⁺ T cells, CD8⁺ T cells, B220⁺ cells, CD5⁺ cells, and macrophages. Flow cytometry did not reveal any significant differences in the composition of PECs between the two groups of mice (data not shown).

Proliferation of spleen cells. To estimate the immune response of splenocytes to ConA and to larval antigens in culture, splenocytes (5 × 10⁵/well) were stimulated with different concentrations of ConA or SLAP. When stimulated with ConA, splenocytes from SQ-infected mice proliferated significantly less than all other splenocytes from all other groups of mice (Fig. 4A). Proliferation of splenocytes from mice infected for 7 days i.p., mice infected for 30 to 60 days i.p., and mice infected SQ followed by infection i.p. did not show significant differences at a ConA concentration of 5 µg/ml or less. At 10 µg of ConA per ml, splenocytes from mice infected for 7 days i.p. and mice infected SQ followed by i.p. infection showed significantly less proliferation than both normal mice and mice infected for 30 to 60 days i.p. along. Interestingly, splenocytes from mice infected SQ alone proliferated significantly less in response to all concentrations of ConA than spleen cells from other groups of mice, infected or uninfected (Fig. 4A).

View larger version (22K): [in this window] [in a new window]   FIG. 4.   Splenocytes were stimulated in culture with indicated concentrations of ConA (A) or SLAP (B). Mean [3H]thymidine incorporation is presented. Data at one particular concentration of mitogen are significantly different if bars do not share the same asterisk (*) or individual group of asterisks (**, ***).

Cytokine production in PECs. PECs were cultured for 24 h in RPMI-C alone, with ConA (5.0 µg/ml), or with SLAP (10 µg/ml), and cytokine production was measured by ELISA. Unstimulated or SLAP-stimulated PECs from mice infected SQ followed by i.p. infection produced significantly less IFN- compared to mice infected i.p. alone for 30 to 60 days (Fig. 5A and C). IFN- production by PECs from mice infected SQ followed by i.p. infection was not significantly different from the production by PECs of mice infected i.p. alone for 7 days in ConA-stimulated cultures but was significantly lower in unstimulated and SLAP-stimulated cultures (Fig. 5).

View larger version (15K): [in this window] [in a new window]   FIG. 5.   PEC production of IFN-. PECs were incubated with RPMI-C only, ConA (5.0 µg/ml), or SLAP (10 µg/ml). Supernatants were harvested 24 h later, and IFN- production was measured by ELISA. Cytokine data are significantly different if bars do not share the same asterisk (*) or group of asterisks (**, ***).

View larger version (17K): [in this window] [in a new window]   FIG. 6.   PEC production of IL-4. PECs were incubated with RPMI-C only, ConA (5.0 µg/ml), or SLAP (10 µg/ml). Supernatants were harvested 24 h later, and IL-4 production was measured by ELISA. Cytokine data are significantly different if bars do not share the same asterisk (*) or group of asterisks (**, ***).

View larger version (14K): [in this window] [in a new window]   FIG. 7.   PEC production of IL-10. PECs were incubated with RPMI-C only, ConA (5.0 µg/ml), or SLAP (10 µg/ml). Supernatants were harvested 24 h later, and IL-10 production was measured by ELISA. Cytokine data are significantly different if bars do not share the same asterisk (*) or group of asterisks (**, ***).

RT-PCR of cytokine-specific mRNA from PECs. RNA was harvested from PECs ex vivo, and levels of mRNA for IFN-, IL-4, IL-10, and IL-2 were determined as ratios against -actin. RT-PCR confirmed results from ELISAs that IFN-, IL-4, and IL-10 production were all downregulated in PECs from mice infected SQ followed by i.p. infection compared to mice infected i.p. alone for 30 to 60 days and mice infected i.p. alone for 7 days (data not shown). Production of IL-2 was not measured by ELISA, but RT-PCR indicated that IL-2 was upregulated in mice infected SQ followed by i.p. infection compared to mice infected i.p. alone for 30 to 60 days and in mice infected i.p. alone for 7 days (data not shown).

Serum cytokine levels. IFN- levels were significantly higher in mice infected SQ followed by i.p. infection than in uninfected controls, mice infected i.p. alone for 7 days, and mice infected only SQ. However, compared to mice infected i.p. alone for 30 to 60 days, IFN- in mice infected SQ followed by i.p. infection was significantly lower (Fig. 8A). Levels of IL-4 in the serum of mice infected SQ followed by i.p. infection was significantly higher than in uninfected mice, mice infected i.p. alone for 7 days, and mice infected only SQ but were significantly lower than in mice infected i.p. alone for 30 to 60 days (Fig. 8B). Serum levels of IL-10 in mice infected SQ followed by i.p. infection were significantly higher than in all other groups of mice tested (Fig. 8C).

View larger version (20K): [in this window] [in a new window]   FIG. 8.   Serum cytokine levels. Serum samples were diluted 1/5 in RPMI-C, and then levels of IFN- (A), IL-4 (B), and IL-10 (C) were measured by ELISA. Values are significantly different if bars do not share the same asterisk (*) or group of asterisk (**, ***).

Production of nitric oxide by PECs. In challenged mice, nitric oxide production by PECs in response to ConA stimulation was measured on day 7 of i.p. infection alone or on day 7 in challenge infections. The NO level was higher in challenged mice than in mice infected i.p. alone for 7 days (Fig. 9B). However, when cells were unstimulated or stimulated with SLAP, NO production by PECs from challenged mice was not different from that in mice infected i.p. alone for 7 days (Fig. 9A and C). NO production by PECs from mice infected for 30 to 60 days i.p. only was significantly higher than that of mice infected for 7 days i.p. only and of challenged mice in unstimulated, ConA-stimulated, and SLAP-stimulated conditions (Fig. 9).

View larger version (17K): [in this window] [in a new window]   FIG. 9.   Nitric oxide production by PECs in response to RPMI-C only, ConA (5 µg/ml), or SLAP (10 µg/ml). Values are significantly different if bars do not share the same asterisk (*) or group of asterisks (**, ***).

Effect of nitric oxide inhibitors on the killing of larvae. Mice infected SQ followed by i.p. infection were treated with aminoguanidine, a nitric oxide inhibitor, to determine if nitric oxide played a role in the killing of larvae. Mice received twice-daily i.p. injections of 50 µg of aminoguanidine/kg of body weight in PBS or twice-daily injections of PBS alone beginning the day larvae were injected i.p. Treatment with the nitric oxide inhibitor did not significantly affect the total number of larvae recovered (treated, 9 ± 6; controls, 3.7 ± 0.58) or the numbers of viable larvae (treated, 2.3 ± 3.2; controls, 0.66 ± 1.2) that were recovered from the peritoneal cavity after 7 days of i.p. infection.

Primary i.p. infection prevents secondary SQ infection. It was necessary to determine if the effect of primary infection and secondary challenge of larvae was similar if the sites of first injection were reversed. Groups of mice were injected i.p. for 30 days followed by SQ injection and with SQ only for 7 days. In these experiments, the secondary SQ larvae were killed (0.5 ± 1.0; n = 6), and the primary i.p. larvae (123 ± 16; n = 3) were apparently unharmed (for SQ-only controls, the values were 6 ± 1.0 [n = 3]). This demonstrated that the ability to immunologically reject larvae apparently is not limited to the i.p. site of infection and that killing occurs to those larvae in the challenge infection.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Previous studies have shown that a primary SQ infection of T. crassiceps larvae can induce killing of a challenge infection of larvae (12-14). In none of these studies, however, was the killing response as immediate or effective as observed in our experiments (12). The differences in the results between our studies and the experiments of Siebert and Good (12) may be due to the fact that they used only 3 larvae per injection in both SQ and i.p. infections, whereas we used 10 larvae per injection. The larger dose of larvae SQ may have induced a stronger, more rapid, and more effective killing response in our experiments. In the experiments by Siebert and Good (12), however, there were also fewer larvae (3 versus 10) to be killed, yet they did not observe complete rejection of larvae.

The killing response observed in the present study was coincident with adherence of a sheath of host cells to the tegument of the larvae. Characteristics of the sheath of cells and fibrous material that surrounded larvae appeared different between viable and nonviable larvae. Viable larvae had a very dense layer of cells around them, whereas dead larvae had fewer cells and a dense, fibrous matrix surrounding them (Fig. 3). This difference may reveal different phases of the host cell attack against the larvae. Continued adherence of host cells to the surface of larvae may cease once larvae have died. Because there are fewer cells on the larval surface, the dense matrix that has been deposited on the larval surface may be more visible by scanning EM. Also, the density of the matrix may increase as the destructive activities progress; i.e., a denser matrix would indicate a more advanced stage of the killing response and would be more apparent on the tegument. The source and characterization of this matrix material are under investigation.

Flow cytometry of PECs from mice infected i.p. alone for 7 days and from challenged mice did not indicate any significant changes in the percentages of CD4⁺ T cells, CD8⁺ T cells, B220⁺ cells, CD5⁺ cells, B220 CD5⁺ cells, or macrophages. This was unexpected, as it might be predicted that there would be an increase or a decrease in some cell populations during the killing response. It is possible that the infiltrating cell populations differed but that the crucial effector populations were bound to the larvae. Flow cytometry was not performed on the cell layers adhered to the larvae, but in the future this may reveal some interesting information.

Despite the intense killing response in the peritoneal cavity of challenged mice, the proliferation of spleen cells from these mice in response to ConA was not significantly higher than that of spleen cells from mice infected i.p. alone for 7 days, mice infected i.p. alone for 30 to 60 days, or uninfected mice (Fig. 4A). It is also notable that when stimulated with SLAP, the mice infected SQ alone and mice infected i.p. alone for 30 to 60 days showed greater proliferation than challenged mice, which was not anticipated (Fig. 4B). Also, the proliferation of the spleen cells from these mice in response to ConA and to SLAP was comparatively low. It may be that the proliferative capacity of the spleen cells is unrelated to the killing response that is induced by SQ infection, making the splenocyte blast assay a less useful measure of immunity.

IFN- was downregulated in challenged mice compared to mice infected i.p. alone for 30 to 60 days in unstimulated, ConA-stimulated, and SLAP-stimulated cultures (Fig. 5). IFN- was also downregulated compared to mice infected i.p. alone for 7 days in unstimulated and SLAP-stimulated cultures. Considering the intense inflammatory response that was occurring in the peritoneal cavity, significant production of IFN- would be anticipated. Serum levels of IFN- were high in mice infected SQ followed by i.p. infection, indicating that there was significant systemic production of IFN- (Fig. 8A); however, ELISAs and RT-PCR showed that the PECs were not producing this cytokine. The highest levels of IFN- in serum were in the mice infected i.p. alone for 30 to 60 days. IFN- production, then, is highest in mice with progressing larval infection and is lower in the serum and in production by PECs of mice that are killing the larvae. This argues against the possibility that IFN- plays the prominent role by inducing inflammation and Th1-associated responses in PECs during the killing of larvae. Other work on larval T. crassiceps infection has shown that IFN- levels in the serum consistently rise over the course of infection, indicating again that the presence of this cytokine is associated with heavy infection (15). It is also of note that the production of IFN- in response to SLAP by PECs from mice infected i.p. only for 7 days, and for 30 to 60 days i.p. alone, produce high levels of IFN-, but that PECs from challenged mice do not.

When unstimulated, stimulated with ConA, or stimulated with SLAP, PECs from mice infected for 7 days i.p. alone produced levels of IL-10 that were significantly higher than levels produced by PECs from mice infected for 30 to 60 days i.p. alone and from challenged mice. This early production of high levels of IL-10 during larval T. crassiceps infection in BALB/c mice has been demonstrated previously (15). IL-10 is known as a downregulatory cytokine (3, 4), and the early production of high levels of IL-10 may inhibit the immune response from destroying the larvae (15). These observations are consistent with the finding that in challenged mice that are killing the larvae, production of IL-10 by PECs is very low (Fig. 7A). This provides more evidence that production of IL-10 by PECs early in infection is conducive to heavy parasitism but does not coincide with serum levels of IL-10, because in challenged mice levels of IL-10 in serum were approximately six times higher than in mice infected 7 days i.p. alone.

Inhibition of NO production did not significantly affect the number or viability of parasites recovered from the peritoneal cavity of challenged mice. NO has been implicated as playing a role in immunity in a number of parasitic diseases and as being able to decrease the burden of both intracellular and extracellular parasites (9, 17). NO production by PECs from challenged mice was always lower than that of mice infected for 30 to 60 days i.p. alone. Compared to mice infected for 7 days i.p. alone, production of NO by PECs stimulated with ConA was higher in challenged mice (Fig. 9B). Despite inhibition of NO production in vivo in challenged mice, there was no significant change in the number of parasites recovered from the peritoneal cavity.

It is of interest to determine why larvae in a secondary infection are killed while the primary infection of larvae remains unaffected. By reversing the injections of the larvae to a primary i.p. infection followed by a SQ challenge, the SQ larvae were killed and the i.p. larvae were apparently unharmed. This suggests that the parasites that are killed are restricted to the secondary infection, and that the parasites in the primary infection are unharmed.