INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

The gram-negative bacterium Yersinia pseudotuberculosis is widely spread in nature and is responsible for sporadic infection in many animal species (10). Humans are commonly infected after ingestion of food or water contaminated with excreta of infected animals. Y. pseudotuberculosis causes acute ileitis and mesenteric lymphadenitis, sometimes complicated by septicemia (10, 26), but is also responsible for the occurrence of postinfection complications such as reactive arthritis and erythema nodosum (10, 35, 45, 46). This microorganism has been suggested as one of the causative agents of Kawasaki syndrome, an acute, self-limited vasculitis affecting predominantly infants and young children (4, 25, 39). A few years ago, Y. pseudotuberculosis strains producing a mitogen activity were isolated from a mass outbreak in Japan (48) and from a patient with Kawasaki-like symptoms (1, 51). The substance, purified from bacterial lysates and exhibiting a mitogenic activity on human peripheral blood mononuclear cells (PBMC), was first designated YPM, for Y. pseudotuberculosis-derived mitogen (30), and then YPMa after the discovery of a variant (36). YPMa was characterized as a 14.5-kDa superantigenic toxin activating human T lymphocytes bearing T-cell receptors exhibiting the V3, V9, V13.1, and V13.2 variable regions (1, 48). The geographic distribution of the 456-bp superantigen-encoding gene ypmA is rather heterogeneous, being present in most Y. pseudotuberculosis strains from the Far East but only in about 20% of European clinical isolates (13, 52).

A recent study showed that 61% of patients acutely infected with Y. pseudotuberculosis, especially those with systemic complications, had elevated anti-YPM immunoglobulin G level in blood, thereby demonstrating the production of YPMa in vivo (2). Furthermore, V3-bearing T cells were increased in patients during the acute phase of the disease (2). Additionally, Miyoshi-Akiyama et al. (32) found that purified YPMa was able to induce lethal shock in a murine experimental model, demonstrating the toxicity of the Y. pseudotuberculosis superantigenic toxin in vivo. The toxin was also found to alter in vitro epithelial function by reducing active ion transport and increasing epithelial permeability (16). Altogether, these data suggest a role of YPMa in the pathogenesis of Y. pseudotuberculosis infections, but experimental evidence necessary to confirm this hypothesis is lacking.

In this study, we constructed a superantigen-deficient mutant of Y. pseudotuberculosis and tested its virulence in a mouse experimental model of infection. Rodents have been extensively used as the animal model to study Yersinia infections since they develop a disease resembling yersiniosis in humans (22). We found that inactivation of ypmA reduced the virulence of Y. pseudotuberculosis after intravenous (i.v.) challenge but not after intragastric (i.g.) inoculation, demonstrating an exacerbated toxicity of YPMa-producing Y. pseudotuberculosis in systemic infection.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains, growth conditions, and plasmids. Bacterial strains and plasmids used in this study are listed in Table 1. Y. pseudotuberculosis AH was kindly provided by N. Takeda (Department of Pediatrics, Kurashiki Central Hospital, Okayama, Japan). Escherichia coli DH5 was used as the host for the pUC derivatives, and E. coli SY327pir and SM10pir were hosts for the suicide vector pCVD442. Y. pseudotuberculosis and E. coli strains were grown at 28 and 37°C, respectively, in Luria-Bertani (LB) broth or agar except where noted. Mating experiments were plated on M9 minimum medium agar (NaH₂PO₄, 33 mM; KH₂PO₄, 22 mM; NaCl, 8.5 mM; NH₄Cl, 18 mM; MgSO₄, 2 mM; CaCl₂, 0.1 mM; thiamine, 0.3 µM; glucose, 5.5 mM; agar, 14 g/liter). Kanamycin and vancomycin were used at 50 µg/ml, and ampicillin was used at 100 µg/ml.

Southern hybridization. Genomic DNA was extracted from bacterial cells as previously described (27) and digested by restriction endonucleases as recommended by the manufacturers (Life Technologies, Cergy Pontoise, France; Boehringer Mannheim France, Meylan, France). Restricted DNA fragments were separated by electrophoresis through a 0.8% agarose gel in Tris-borate-EDTA buffer and then transferred onto a nylon membrane (Hybond-N+; 0.45-µm pore size; Amersham Life Science, Buckinghamshire, England). Probes were generated by PCR amplification in the presence of digoxigenin-11-dUTP (Boehringer Mannheim France) and were purified on Spin-X columns (Corning Costar Corporation, Acton, Mass.). Hybridizations were carried out at 68°C in 5× SSC (0.75 M sodium chloride, 0.075 M sodium citrate [pH 7.0])-0.02% sodium dodecyl sulfate (SDS)-0.1% N-lauroyl sarcosine, 1% blocking reagent (Boehringer Mannheim France). After hybridization, filters were washed twice at room temperature for 15 min in 2× SSC-0.1% SDS and then twice at 68°C for 15 min in 0.1× SSC-0.1% SDS. Chemiluminescent detection of the digoxigenin-labeled probes was performed as instructed by the manufacturer (Boehringer Mannheim France). Nylon membranes were exposed with BioMax film (Eastman Kodak Company, Rochester, N.Y.) at room temperature.

Plasmid constructions. DNA hybridization of endonuclease-restricted genomic DNA from Y. pseudotuberculosis AH with a 418-bp ypmA-specific probe generated with sup1 (5'acacttttctctggagtagcg3') and sup2 (5'acaggacatttcgtca3') primers (Fig. 1) revealed the presence of ypmA on a 6.5-kb HindIII DNA fragment. This fragment was cloned into pUC18, and the recombinant plasmid was designated pCCY10 (Fig. 1). DNA sequencing of this HindIII fragment (i) confirmed the presence of the variant ypmA (24, 31) (accession no. D38523 and D38638) and (ii) defined the flanking regions of ypmA (data not shown). Plasmid pCCY12 consists of the 1.5-kb XbaI/BamHI fragment from pCCY10 inserted into pUC18 and was used for trans complementation of the ypmA mutant (Fig. 1). Plasmid pCCY17.1 corresponds to the 3.5-kb KpnI fragment from pCCY10 cloned into pUC18. To eliminate the PstI restriction site from the polylinker, pCCY17.1 was digested with HindIII and religated to itself to give pCCY17.1 which was used for the construction of the ypmA-deficient mutant (Fig. 1).

View larger version (15K): [in this window] [in a new window]   FIG. 1.   Restriction maps of pCCY10, pCCY12, pCCY17.1, and pCS20. B, BamHI; E, EcoRI; H, HindIII; K, KpnI; N, NarI; P, PstI; X, XbaI. Solid black box, pUC18 vector; open arrow, ypmA; hatched arrow, aph(3')-IIIa.

Inactivation of ypmA. The ypmA gene was deleted by overlap extension using PCR (18, 23). Sup16 (5'gcggcaagctttgaagggttgtcacaattgcacct3') and sup18 (5'acggactgcattggctgcagatttttcataactcaacctataaatat3') primers yielded by PCR a 782-bp fragment encompassing the upstream and 5' regions of ypmA, whereas sup19 (5'ctgcagccaatgcagtccgttgtcctgtgtgaaaaatatttaatggctc3') and sup17 (5'aagtgggatccaggaggttcac3') produced a 324-bp fragment covering the 3' end of ypmA and its downstream region (Fig. 2A). Sup16 and sup17 contain the HindIII and BamHI restriction sites, respectively. Primers sup18 and sup19 were generated to obtain a 20-bp overlapping sequence containing a PstI restriction site located six nucleotides downstream of the guanine residue of the start codon of ypmA and 23 nucleotides upstream from the thymine residue of the stop codon of ypmA, respectively. Amplimers produced with sup16-sup18 and sup17-sup19 were purified, combined, annealed by their 20-bp overlapped region, and 3' extended following the complementary strand. The resulting fusion was finally amplified with sup16 and sup17 primers to give a 1,086-bp fragment corresponding to a 434-bp deletion within ypmA with a PstI restriction site at the site of the deletion. Conditions for PCRs have been previously described (11, 18). The resulting fragment was digested with HindIII and BamHI and cloned into HindIII/BamHI-digested pCCY17.1. The plasmid was designated pCS10. The kanamycin resistance-encoding gene [aph(3')-IIIa] (47) was purified after digestion of pUC1318-KmII with PstI and then cloned into the unique PstI restriction site of pCS10 to give pCS20 (Fig. 1).

View larger version (16K): [in this window] [in a new window]   FIG. 2.   Construction of the Y. pseudotuberculosis superantigen-deficient mutant. (A) HindIII restriction map of ypmA and ypmA::aph(3')-IIIa regions. ypmA and aph(3')-IIIa are represented as open and hatched arrows, respectively. H, HindIII; P, PstI. (B) Southern blot of HindIII-digested DNA from wild-type Y. pseudotuberculosis AH and superantigen-deficient mutant H194 hybridized with probe 1 (451 bp), corresponding to the upstream region of ypmA, and probe 2 (673 bp), detecting the kanamycin resistance gene. For better clarity, the image was manipulated by Adobe Photoshop 5.0 software.

Construction of the superantigen-deficient Y. pseudotuberculosis. The 4.2-kb NarI/XbaI fragment from pCS20 was purified, and its cohesive ends were filled with the Klenow fragment of DNA polymerase I as instructed by the manufacturer (Life Technologies). The resulting fragment was cloned into the suicide plasmid pCVD442 (17) digested with SmaI and transformed into E. coli SY327pir. The construct was designated pCCY20 and was then transformed into E. coli SM10pir for mating experiments.

In vitro lymphocyte proliferation assay. Lymphocyte proliferation tests were performed on human peripheral blood mononuclear cells (PBMC) as previously described (34). Briefly, PBMC were separated from healthy-donor whole blood by Ficoll-gradient centrifugation, and 10⁶ cells were cultivated in Eagle medium supplemented with gentamicin (8 µg/ml), L-glutamine (2 mM), and inactivated calf serum (20%) in the presence of an overnight culture supernatant from Y. pseudotuberculosis. Incubation was carried out for 72 h at 37°C in a humidified atmosphere containing 5% CO₂. Eighteen hours before the end of the culture, 1µCi of [³H]thymidine was added to the cells. The radioactivity was counted after lysis of the lymphocytes, and results were expressed as stimulation index, which represents the ratio of counts per minute from lymphocytes incubated with bacterial supernatant versus counts per minute from lymphocytes cultivated in the absence of mitogen.

Mouse experimental infection. Six-week-old female outbred OF1 mice (Iffa Credo, L'Arbresle, France) were challenged either i.v. (0.3 ml of bacterial suspension in sterile phosphate-buffered saline [PBS]) or i.g. by using a gastric tube (0.2 ml of bacterial suspension in sterile distilled water). Bacterial inocula were prepared from overnight cultures in LB at 28°C. Cultures were centrifuged, and the bacterial pellets were washed once and resuspended in distilled water or PBS. Animals were kept in positive-pressure cabinets during experimentation, and mortality was monitored daily for 21 days after challenge. For each experimental infection, the presence of the virulence plasmid pYV was confirmed by PCR on bacterial thermolysates using YopH1 (5'catcgtcaggtatctcga3') and YopH2 (5'caatcagttgcgcagtac3') primers which are internal to yopH, a gene coding for a tyrosine phosphatase and located on pYV (6, 8, 14).

Histological studies. At days 2, 4, and 7 after i.v. challenge and at days 2, 4, 7, 11, and 21 after i.g. inoculation, one mouse from each group of animals was randomly chosen for histological examination. Specimens were fixed in 10% buffered formalin (spleen, heart, lungs, intestine, MLNs) or Bouin's fixative (liver) and embedded in paraffin. Sections were cut at 4-µm thickness from paraffin blocks and stained with hematoxylin and eosin for light microscopy.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Construction and characterization of the Y. pseudotuberculosis ypmA mutant. A superantigen-deficient strain was constructed from YPMa-producing Y. pseudotuberculosis AH. After cloning of ypmA and its flanking regions, a 434-bp internal deletion in ypmA was generated and replaced by a kanamycin resistance gene [aph(3')-IIIa] (Fig. 2A). The construct was then introduced into the suicide vector pCVD442 to give pCCY20, which contains the sacB gene, a counterselectable marker allowing a positive selection for the second recombination event. Kanamycin- and ampicillin-resistant Y. pseudotuberculosis merodiploides were obtained by mating E. coli SM10pir(pCCY20) with wild-type Y. pseudotuberculosis. One colony was selected and grown in the presence of kanamycin and plated on LB agar containing 10% sucrose and kanamycin. From 100 sucrose- and kanamycin-resistant clones, all were sensitive to ampicillin and one was randomly chosen for further characterization. The recombinant strain was phenotypically identical to the wild-type strain with regard to colony morphology on agar, in vitro growth rate at 28 and 37°C, and metabolic properties. The mutant strain was also genetically characterized. The oligonucleotide pairs kan1-sup16 and kan2-sup17 (Fig. 2A) both amplified by PCR a 1.6-kb fragment from DNA of the ypmA mutant strain, confirming the position of the kanamycin resistance gene (data not shown). DNA hybridization with probes 1 and 2 of HindIII-digested genomic DNA from AH and the mutant strain confirmed the single copy of the kanamycin resistance gene and its position in the genome (Fig. 2B). This isolate corresponding to a superantigen-deficient mutant from Y. pseudotuberculosis AH was designated H194. Complementation in trans of strain H194 with plasmid pCCY12, a pUC derivative containing the intact ypmA gene, restored the in vitro mitogen activity on PBMC (Fig. 3).

View larger version (28K): [in this window] [in a new window]   FIG. 3.   trans complementation of superantigen-deficient Y. pseudotuberculosis H194. pUC18 and plasmid pCCY12 containing the intact ypmA gene were introduced into superantigen-deficient Y. pseudotuberculosis H194 by electroporation. T-cell proliferation induced by overnight culture supernatants was measured by [3H]thymidine incorporation (34). Each column represents the average of three values ± SD. The nonparametric Mann-Whitney test was used for statistical evaluation of the results, the stimulation index from the wild-type strain being used as the reference. P = 0.05 was the limit of significance. NS, nonsignificant.

Virulence of the ypmA mutant after i.g. challenge. To evaluate the effect of ypmA inactivation on virulence, OF1 mice were challenged with wild-type Y. pseudotuberculosis AH or with superantigen-deficient mutant H194 by the oral route, which is the natural mode of infection for Y. pseudotuberculosis. After inoculation with serial 10-fold dilutions of the wild type and H194, the 50% lethal dose (LD₅₀) after 21 days was estimated at 10⁹ for both strains, indicating a moderate virulence with regards to other Y. pseudotuberculosis strains (15, 33, 37, 42). The kinetics of animal killing over the 3 weeks were found to be similar for both wild-type and mutant strains (data not shown). These data showed that the presence of ypmA does not enhance the virulence of Y. pseudotuberculosis after i.g. challenge.

Virulence of ypmA mutant after i.v. challenge. To further investigate the role of ypmA, we tested the virulence of wild-type and ypmA-deficient Y. pseudotuberculosis in systemic infection. OF1 mice were challenged i.v. with 10-fold serial dilution of inocula ranging from 10^3.3 to 10^6.3 bacteria, and the survival rate was monitored daily (Fig. 4). When mice were infected with the highest inoculum (10^6.3 bacteria), both strains were highly virulent since there were no survivors after day 8. Interestingly, the animals infected with a lower inoculum of H194 survived at a higher rate than mice infected with the wild-type strain. When challenged with 10^3.3 bacteria, mice infected with the ypmA mutant survived much longer (10 days) than the wild-type-infected animals; however, the survival rate reached 50% at day 21 for both strains (Fig. 4D), indicating that the systemic LD₅₀s after 3 weeks were similar for the H194 mutant and wild-type Y. pseudotuberculosis. This kinetics of killing was reproduced in three separate experiments.

View larger version (19K): [in this window] [in a new window]   FIG. 4.   Virulence of wild-type and superantigen-deficient Y. pseudotuberculosis in mice. Wild-type Y. pseudotuberculosis () and its ypmA isogenic mutant H194 () were injected i.v. into OF1 mice. Groups of seven animals were challenged with 106.3 (A), 105.3 (B), 104.3 (C), or 103.3 (D) bacteria, and mortality was monitored over a 3-week period.

View larger version (11K): [in this window] [in a new window]   FIG. 5.   Bacterial counts in spleen, liver, and lungs from mice infected i.v. with wild-type or YPMa-deficient Y. pseudotuberculosis H194. Groups of five OF1 mice were given 103.4 bacteria i.v., and animals were sacrificed at days 2, 4, and 7 after challenge. Each dot represents the number of CFU recovered per organ of one mouse infected with wild-type Y. pseudotuberculosis () or with the YPMa-deficient mutant (). Detection limit was 102 CFU per organ. Horizontal bars indicate the mean CFU per organ.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

In this study, we investigated the impact of the superantigenic toxin YPMa in the pathogenesis of Y. pseudotuberculosis. The effects of bacterial superantigens in vivo have mainly been studied by dosing animals with sometimes unphysiological amounts of purified proteins. Very few studies have used living microorganisms to investigate the role of superantigens in an experimental model (9, 38), and to our knowledge no study has demonstrated the role of a superantigenic molecule using isogenic mutants. Our experimental approach was to test the in vivo effect of YPMa in the context of other virulence factors of Yersinia (e.g., the Yop effectors [14]), using replicating Y. pseudotuberculosis rather than purified proteins. The use of living Yersinia also ensures the release of a physiological amount of superantigenic toxin over a long period of time. To construct the ypmA isogenic mutant, Y. pseudotuberculosis strain AH was used as parental strain because (i) it has a clinical relevance since it was isolated from a patient with Kawasaki syndrome, (ii) it contains the ypmA gene, which represents the most common variant found among the superantigen-producing Y. pseudotuberculosis (12, 36), and (iii) it produces in vitro a high mitogen activity compared to other superantigenic strains of Y. pseudotuberculosis (unpublished results).

Ueshiba et al. (49) observed that all Y. pseudotuberculosis isolates from systemic infections were superantigen-producing strains and that human Y. pseudotuberculosis systemic infections were characterized by symptoms (high fever, a scarlatiniform skin rash, desquamation, strawberry tongue) that resemble staphylococcal toxic shock syndrome or streptococcal scarlet fever, both systemic manifestations caused by superantigens. This comparison suggested that the superantigen of Y. pseudotuberculosis could be involved in the systemic type of infection. This hypothesis was strengthened by our experimental model which showed that the presence of YPMa aggravates the infection when Y. pseudotuberculosis follows the systemic route.

Since the toxic effect of the YPMa⁺ strain by the systemic route could not be attributed to a higher multiplication rate in animal organs, the exacerbated virulence of the wild type could be directly related to the production of YPMa. The mechanism by which YPMa induces a higher death rate is unclear but is probably multifactorial. The synergistic action of YPMa and LPS might provide a possible mechanism since superantigens are known to potentiate the toxicity of endotoxins (5, 43). A comparison of cytokine profiles and the characterization of T-cell populations recruited to the spleen after infection with the wild type or H194 should provide some insights into the role of YPMa when produced in vivo.

Intragastric infections did not reveal any superantigen-related toxicity in our experimental model: (i) the LD₅₀ and mortality kinetics were identical for both wild-type and mutant Y. pseudotuberculosis and (ii) the bacterial counts recovered from organs and tissues indicated that YPMa did not affect the bacterial translocation across the intestinal barrier. Nevertheless, the role of YPMa after oral infection cannot be completely ruled out. Indeed, bacterial counts in Peyer's patches were still high after 21 days in both wild-type- and mutant-infected mice, whereas the numbers of bacteria in spleen and MLNs were low. The consequences of a long-term persistence of Y. pseudotuberculosis in Peyer's patches are unknown. Immunopathological disorders such as reactive arthritis, erythema nodosum, or vasculitis during human yersiniosis might occur several months after the enteric infection (45, 46). Hence, experimental infections for a longer period of time should be followed for the possible appearance of reactive arthritis or vasculitis. Furthermore, one cannot eliminate the hypothesis of a down-regulation of ypmA expression in the gut, which would explain the absence of toxicity of YPM⁺ Y. pseudotuberculosis in our i.g. infection model. Indeed, bacterial gene expression are often under a strict control of environmental stimuli (O₂ level, pH, osmolarity, bacterial density, etc.) (19, 28, 44) and a variation of expression of ypmA, depending on the route of infection, should be considered to explain the difference in virulence between systemic and oral infections.

A variation of susceptibility of mice to Yersinia infection has been reported and was shown to be dependent on gamma interferon production (3, 21). Mouse strains other than outbred OF1 mice should now be tested to determine whether the toxicity of superantigen-producing Y. pseudotuberculosis is strain specific or whether it can be generalized to other mouse strains. It would also be interesting to evaluate the toxicity of YPM⁺ Y. pseudotuberculosis in relation to gamma interferon, an inflammatory cytokine frequently involved in response to superantigen.

In conclusion, we showed that YPMa is a virulence factor which exacerbates the toxicity of Y. pseudotuberculosis in systemic but not in gastric infection, even if the long-term effect of the presence of superantigen-producing Y. pseudotuberculosis in Peyer's patches remained to be evaluated. In light of this work, a reassessment of the systemic pathogenesis of Y. pseudotuberculosis, involving the superantigenic toxin YPMa, is now required to better understand human systemic yersiniosis.