Previous Article | Next Article 
Infection and Immunity, May 2000, p. 2808-2818, Vol. 68, No. 5
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The Cytotoxic Enterotoxin of Aeromonas
hydrophila Induces Proinflammatory Cytokine Production and
Activates Arachidonic Acid Metabolism in Macrophages
A. K.
Chopra,*
X.-J.
Xu,
D.
Ribardo,
M.
Gonzalez,
K.
Kuhl,
J. W.
Peterson, and
C. W.
Houston
Department of Microbiology and Immunology,
University of Texas Medical Branch, Galveston, Texas 77555-1070
Received 17 December 1999/Returned for modification 18 January
2000/Accepted 17 February 2000
 |
ABSTRACT |
An aerolysin-related cytotoxic enterotoxin (Act) of Aeromonas
hydrophila possesses multiple biological activities, which
include its ability to lyse red blood cells, destroy tissue culture
cell lines, evoke a fluid secretory response in ligated intestinal loop
models, and induce lethality in mice. The role of Act in the virulence
of the organism has been demonstrated. In this study, we evaluated the
potential of Act to induce production of proinflammatory cytokines
associated with Act-induced tissue injury and Act's capacity to
activate in macrophages arachidonic acid (AA) metabolism that leads to
production of eicosanoids (e.g., prostaglandin E2 [PGE2]). Our data indicated that Act stimulated the
production of tumor necrosis factor alpha and upregulated the
expression of genes encoding interleukin-1
(IL-1
) and IL-6 in the
murine macrophage cell line RAW264.7. Act also activated transcription of the gene encoding inducible nitric oxide synthase. Act evoked the
production of PGE2 coupled to the cyclooxygenase-2 (COX-2) pathway. AA is a substrate for PGE2, and Act produced AA
from phospholipids by inducing group V secretory phospholipase
A2. We also demonstrated that Act increased cyclic AMP
(cAMP) production in macrophages. cAMP, along with PGE2,
could potentiate fluid secretion in animal models because of
infiltration and activation of macrophages resulting from Act-induced
tissue injury. After Act treatment of RAW cells, we detected an
increased translocation of NF-
B and cAMP-responsive element binding
protein (CREB) to the nucleus using gel shift assays. Act also
upregulated production of antiapoptotic protein Bcl-2 in macrophages,
suggesting a protective role for Bcl-2 against cell death induced by
proinflammatory cytokines. The increased expression of genes encoding
the proinflammatory cytokines, COX-2, and Bcl-2 appeared correlated
with the activation of NF-
B and CREB. This is the first report of
the detailed mechanisms of action of Act from A. hydrophila.
 |
INTRODUCTION |
Aeromonas spp. recently
have been placed in the family Aeromonadaceae. They cause
both intestinal and nonintestinal infections in humans (12),
and, unlike gastroenteritis, which generally occurs in young children,
these nonintestinal infections are often fatal and involve adults
(36). Aeromonas spp. have been cultured from both
freshwater and salt water and from many foods. These bacteria have
emerged as important human pathogens and are being isolated in an
increased incidence from patients with traveler's diarrhea (3,
11, 28, 29, 41, 44, 70). Aeromonas spp. produce an
array of virulence factors, and the pathogenesis of
Aeromonas infections is therefore complex and multifactorial (2). These virulence factors include hemolysins, cytotoxins, enterotoxins, proteases, lipases/phospholipases, leucocidin, endotoxin, fimbriae or adhesins, and the capacity to form an S-layer (17, 45,
47). Aeromonas hydrophila has been shown to be
invasive for HEp-2 cell monolayers, and the bacterial cells adhere to
human erythrocytes (6, 26). Two distinct families of type IV
pili (bundle-forming pili [Bfp] and Tap) in Aeromonas spp.
are associated with gastroenteritis (9). Taken together, the
ability of these bacteria to invade host cells and disseminate to
virtually any organ via the blood and their capacity to produce
multiple virulence factors contribute to the pathogenesis of
Aeromonas infection. The ability of some strains of A. hydrophila to resist complement-mediated lysis could result in
bacteremia and other invasive diseases associated with
Aeromonas infections (46, 48).
Both cytotonic and cytotoxic enterotoxins have been discovered in
culture filtrates of Aeromonas isolates (5, 13, 15, 32,
43, 55, 56, 58, 66). We demonstrated that these enterotoxins from
diarrheal isolate SSU of A. hydrophila were able to cause
intestinal fluid loss in a rat/rabbit model (20, 58, 69).
The cytotoxic enterotoxin (Act) is a single-chain, 52-kDa polypeptide
that has various biological activities, including hemolysis,
cytotoxicity, enterotoxicity, and lethality (18, 23). The
cytotoxic enterotoxin gene (act) has been hyperexpressed, and the recombinant Act has been purified to homogeneity. The 50%
lethal dose of Act for mice was 27.5 ng (23). Act exhibited significant homology with aerolysin isolated from Aeromonas
bestiarum (originally classified as A. hydrophila)
(18, 33, 35); however, these molecules were distinguishable
from each other by the following criteria: (i) differential
neutralization of Act using Act- and aerolysin-specific monoclonal
antibodies (19; unpublished data); (ii) different
essential amino acid residues in Act and aerolysin which contribute to
hemolytic activity (24); and (iii) inability of Act to bind
to glycophorin, the aerolysin receptor (25). We have shown
that cholesterol, but not myristylated cholesterol, abrogated Act's
hemolytic activity, and this finding implicated the 3'-OH group of
cholesterol as possibly important for toxin interaction with this
membrane constituent (23). Despite these distinguishing
features, Act and aerolysin have both been shown to be activated by
binding to the target cell membrane, with subsequent oligomerization
and pore formation (16, 23, 50).
Most studies on aerolysin were targeted to measuring hemolytic activity
(50); however, site-directed mutagenesis of a single chain
of Act indicated the possibility of different loci associated with
various biological activities (24). We identified an Act peptide (amino acid residues 245 to 274) that competed with native Act
in binding to Chinese hamster ovary (CHO) cells. Further, polyclonal
antibodies to this peptide significantly neutralized Act's biological
activity (24). Act's role in the overall virulence of the
organism has been established by developing transposon mutants of
A. hydrophila SSU and by generating act isogenic
mutants via homologous recombination (69). When isogenic
mutants were injected intraperitoneally into mice, the 50% lethal dose
was found to be 108 compared to 3 × 105
for the wild-type Aeromonas. Reintegration of the native
act gene in place of the truncated toxin gene in isogenic
mutants resulted in complete restoration of Act's biological activity and virulence in mice. Animals that were injected with a sublethal dose
of wild-type Aeromonas or its revertant, but not the
isogenic mutant, had circulating, toxin-specific neutralizing
antibodies (14, 69). Act-induced fluid secretion in the rat
and rabbit ligated small intestinal loop was accompanied by
inflammation with infiltration of mononuclear cells in the lumen of the
intestine. However, whether there is a correlation between the extent
of inflammation induced by Act and fluid secretion at various toxin doses is unknown and is presently under investigation. Act impaired the
phagocytic ability of mouse phagocytes, both in vivo and in vitro, and
gamma interferon (IFN-
) pretreatment blocked this toxic effect.
Act's direct inhibition of phagocyte activity may be a pathological
mechanism associated with some Aeromonas-mediated infections
(38). Further, Act significantly stimulated the chemotactic activity of human leukocytes in a dose-dependent fashion. This stimulatory effect was inhibited by various concentrations of pertussis
toxin (PT), suggesting that human leukocytes possessed Act receptors
possibly coupled to PT-sensitive G-proteins (37). Recent
studies of Krause et al. (42) showed that aerolysin, like
Act, activated PT-sensitive G-proteins in granulocytes.
In this study, we examined the mechanism of action of Act by using
murine macrophages to determine whether Act upregulated the expression
of proinflammatory cytokine genes and the inducible nitric oxide
synthase (iNOS) gene and activated arachidonic acid (AA) metabolism in
these cells. The latter mechanism results in production of eicosanoids
(e.g., prostaglandin E2 [PGE2]) that activate
adenylate cyclase and produce cyclic AMP (cAMP). The latter can also be
produced through direct activation of a G-protein-coupled adenylate
cyclase enzyme in cells. The fluid secretory response observed in
animals with Act therefore could be a result of an Act-induced
inflammatory response and the ability of Act to increase PGE2 and cAMP levels. Finally, we identified transcription
factors activated in Act-treated macrophages to understand
intracellular signaling in host cells leading to upregulation of genes
encoding various cytokines, cyclooxygenase-2 (COX-2), and antiapoptotic protein Bcl-2.
 |
MATERIALS AND METHODS |
Cell culture.
The murine macrophage cell line RAW264.7 was
purchased from the American Type Culture Collection (Manassas, Va.).
The cells were cultured at 37°C and 5% CO2 in
Dulbecco's minimal essential medium (Gibco BRL, Gaithersburg, Md.)
containing 4.5 g of glucose/liter, 10% fetal bovine serum, 2 mM
L-glutamine, and antibiotics penicillin (100 U/ml) and
streptomycin (0.1 mg/ml). For each experiment, 5 × 105 cells/ml were plated in 35-mm-diameter dishes and
allowed to attach for 60 min. The medium was removed, and fresh medium
containing the appropriate stimulant was added. After each time point,
the supernatant was collected and Trizol reagent (Gibco BRL) was added to the cells (1 ml per 10 cm2 of cells) to extract RNA and
proteins as described by the manufacturer.
Northern analysis.
Total RNA (10 to 20 µg) was separated
in a 3% formaldehyde gel (7) and transferred to a nylon
membrane. Membranes were prehybridized (15 min) and hybridized using
Quickhyb (Stratagene, La Jolla, Calif.). The radioactive counts for the
various probes used were all 106 cpm/ml, and the probes
were applied to membranes in Quickhyb solution for 2 h at 68°C.
After incubation, membranes were washed twice for 20 min in 2× SSC
(1× SSC is 0.15 M sodium chloride plus 0.015 M sodium citrate), pH 7.0 (7)-0.1% sodium dodecyl sulfate (SDS) and twice for 20 min
in 1× SSC-0.1% SDS at 68°C. When group V secretory phospholipase
A2 (sPLA2) was used as a probe, membranes were
hybridized for 1 h at 66°C, followed by two washes in 2× SSC-0.05% SDS for 15 min, with the first wash at room temperature and
the second at 40°C. Membranes were then washed twice with 0.1×
SSC-0.1% SDS for 15 min at room temperature (8), dried, and exposed to X-ray film for 1 to 3 days. The membranes were subsequently stripped in 2× SSC-50% formamide at 68°C for 2 h and rehybridized with a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Clontech Laboratories Inc., Palo Alto, Calif.) probe as an
internal control. The RNA load in each lane was normalized by
densitometric scanning (Gel doc 2000 system; Bio-Rad, Hercules, Calif.)
of the blots to calculate fold increases in mRNA levels. The probes
were labeled with [
-32P]dCTP (ICN; Costa Mesa, Calif.)
using a random priming kit (Gibco BRL), and the unincorporated dCTP was
removed using a Sephadex G-25 spin column (5'
3' Inc., Boulder,
Colo.). Murine tumor necrosis factor alpha (TNF-
) cDNA was generated
by reverse transcriptase PCR (RT-PCR) as described below using specific
TNF-
RT-PCR amplimers (Clontech) and total RNA from RAW cells. A
354-bp cDNA was cloned into TA cloning vector pCR2.1 (Invitrogen,
Carlsbad, Calif.). The recombinant plasmid was digested with the
EcoRI restriction enzyme to obtain a 354-bp cDNA fragment.
Murine interleukin-1
(IL-1
) cDNA (Genentech, Inc., San Francisco,
Calif.) was digested with EcoRI and HindIII
restriction enzymes, and a 1.3-kb fragment generated was used as a
probe. The DNA fragments were isolated from 0.8% agarose gels
(7) and purified using GeneClean kit II (Bio 101, Inc.,
Vista, Calif.). A cox-2 cDNA probe used for Northern
analysis was purchased from Cayman Biochemical Co., Ann Arbor, Mich.).
The reagents for RNA work were prepared in diethyl pyrocarbonate
(DEPC)-treated water.
Western blot analysis.
Western blot analysis was performed
by established procedures (59). Briefly, equal amounts of
total protein were loaded and separated on SDS-12% polyacrylamide
gels and then transferred to nitrocellulose membranes. Membranes were
blocked with 3% gelatin and washed in 1× Tween
(0.05%)-Tris-buffered saline (TTBS) twice for 10 min each. Primary
antibodies (1 to 15 µg/ml) in a 1% gelatin solution (prepared in 1×
TTBS) were applied and allowed to incubate for 2 h at room
temperature. After washing, appropriate secondary antibodies were
diluted 1:30,000 for horseradish peroxidase (HRP) or 1:10,000 for
alkaline phosphatase (AP) in 1% gelatin and applied to the membranes.
Subsequently, membranes were washed and an appropriate substrate was
applied, according to the manufacturer's instructions for color
development, using AP substrate (Bio-Rad) or an enhanced chemiluminescence substrate kit (Pierce, Rockford, Ill.). Polyclonal COX-2, inducible nitric oxide synthase (iNOS), and Bcl-2 antibodies were purchased from Santa Cruz Biochemical Co., Santa Cruz, Calif.
RT-PCR to detect various cytokines.
The first-strand cDNA
synthesis kit (Clontech) was used to synthesize cDNA from total RNA of
RAW cells as described by the manufacturer. Briefly, to 1 µg of total
RNA was added oligo(dT)18 primer (20 µM) in a total
volume of 12.5 µl made up with DEPC-treated water. The RNA and primer
were heated at 70°C for 2 min and then quenched on ice immediately.
Subsequently, the following reagents were added: 4.0 µl of 5×
reaction buffer (Clontech), 1.0 µl of deoxynucleoside triphosphate
(dNTP) mixture (10 mM each), 0.5 µl of recombinant RNase inhibitor
(40 U/µl), and 1.0 µl of recombinant Moloney murine leukemia virus
RT (200 U/µl). The mixture was incubated at 42°C for 1 h, and
the cDNA synthesis was stopped by heating the reaction mixture at
94°C for 5 min, which also destroyed any remaining DNase activity.
The reaction mixture was then diluted to a final volume of 100 µl
with DEPC-treated water.
The cDNA fragment was amplified by PCR, and the following reagents were
added to 5 µl of cDNA sample: 5 µl of 10× PCR buffer (Promega,
Madison, Wis.), 36.6 µl of sterile water, 1 µl of dNTP mixture (10 mM each), 0.4 µl of AmpliTaq DNA polymerase (5 U/µl), 2 µl of
premixed human GAPDH amplimer (10 µM [each] primer; for internal
control), and 1 µl each of the tested 5' and 3' primers (20 µM) for
mouse IL-1
(fragment size, 563 bp) and mouse IL-6 (fragment size,
638 bp). The amplimers were obtained from Clontech. The PCR was then
completed by temperature cycling (30 to 35 cycles of 94°C for 45 s, 60°C for 45 s, and 72°C for 2 min and a final extension at
72°C for 7 min). The PCR product was run on a 1% agarose gel and
subjected to densitometric scanning, and the fold increase in the level
of a particular cytokine cDNA was normalized to the GAPDH product. Each
experiment included a negative control in which RNA was omitted from
the RT mixture and cDNA was omitted from the PCR.
The group V sPLA
2 fragment for Northern blot analysis was
generated by first performing reverse transcription using RNA from
RAW
cells, as described above, followed by PCR using the following
primers:
5'CAGGGGGCTTGCTAGAACTCAA3' (5' primer) and
5'AAGAGGGTTGTAAGTCCAGAGG3'
(3' primer) as described by
Balboa et al. (
8). A sample probe
was obtained from E. A. Dennis, University of California at San
Diego, La Jolla. Reaction
conditions used for PCR were 95°C for
20 s, 60°C for 30 s, and 72°C for 30 s for 35 cycles, followed
by a final
extension at 72°C for 7
min.
ELISA.
The purified anticytokine capture antibodies
(Pharmingen, San Diego, Calif.) were diluted to 1 to 4 µg/ml in
binding solution (0.1 M Na2HPO4, pH 9.0). The
diluted antibodies then were added to the wells of an enzyme
immunoassay high-binding microtiter plate (Corning Costar, Corning,
N.Y.) and incubated overnight at 4°C. Next, the capture antibodies
were removed, and any nonspecific binding was blocked by adding 200 µl of blocking buffer (1% bovine serum albumin in phosphate buffered
saline [PBS]) to each well. The plate was incubated at room
temperature for 1 to 2 h. After incubation, wells were washed
three times with PBS-Tween (0.05%) buffer. A 100-µl aliquot of
samples or standards was added, and the plate was incubated overnight
at 4°C. After incubation, plates were washed four times with
PBS-Tween. Detection antibodies (biotinylated anticytokine; Pharmingen)
were diluted to 0.5 to 2 µg/ml in blocking buffer-Tween and added to
the wells. The plate was incubated for 1 h at room temperature.
After the plate was washed four times with PBS-Tween, an enzyme
conjugate (streptavidin-conjugated HRP) was diluted to an optimal
concentration in blocking buffer-Tween and added to the wells. The
plate was incubated at room temperature for 30 min and then washed five
times with PBS-Tween. Next, ABTS [2,2'-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid)] substrate solution (150 mg of ABTS in 0.1 M anhydrous citric acid, adjusted to pH
4.35 with sodium hydroxide) was vortexed, and 100 µl of 3%
H2O2 was added to each 11 ml of substrate
solution. A 100-µl aliquot was dispensed in each well, and the plate
was incubated (5 to 80 min) for color development. The color reaction
was stopped by adding 50 µl of stopping solution (20% SDS-50%
dimethyl formamide). Finally, the optical density was read with a
microtiter enzyme-linked immunosorbent assay (ELISA) plate reader
(Molecular Devices Corp., Sunnyvale, Calif.) at 405 nm.
Gel shift assay.
Labeling of the consensus oligonucleotide
was performed by assembling the following reaction mixture: 2 µl of
NF-
B/CREB/AP-1/AP-2/SP-1 (promoter-specific factor required for
transcription of the simian virus 40 early and late promoters)/OCT-1
(octamer transcription factors)/TFIID (general transcription factors)
consensus oligonucleotide (1.75 pmol/µl; Promega), 1 µl of T4
polynucleotide kinase 10× buffer (Promega), 1 µl of
[
-32P]ATP (3,000 Ci/mmol at 10 mCi/ml; ICN), 5 µl of
nuclease-free water, and 1 µl of T4 polynucleotide kinase (5 to 10 U/µl; Promega). The reaction mixture was incubated at 37°C for 10 min, and the reaction was stopped by adding 1 µl of 0.5 M EDTA.
Finally, the volume of the reaction mixture was made up to 100 µl
using 1× Tris-EDTA buffer (7) before the mixture was passed
through the Sephadex G-25 spin column to remove unincorporated labeled ATP. Next, DNA binding reaction mixtures were assembled. For this assay, we utilized a negative control having no HeLa cell nuclear extract and a positive control consisting of HeLa cell nuclear extract,
a specific competitor such as unlabeled transcription factor consensus
oligonucleotides, and nuclear extracts from specific time points after
Act treatment of RAW cells. The nuclear extracts were prepared as
described by the manufacturer (Promega). The reaction mixtures were
incubated at room temperature for 5 to 10 min. Then, 50,000 to 200,000 cpm of 32P-labeled transcription factor consensus
oligonucleotide was added to the reaction mixtures, and the mixtures
were incubated at room temperature for 20 min. For supershift assays, 2 µl of p50, p65, or CREB antibodies (200 µg/0.1 ml; Santa Cruz
Biotechnology) was added to the reaction mixture prior to the addition
of labeled NF-
B and CREB consensus oligonucleotides. Subsequently, 1 µl of gel loading 10× buffer (Promega) was added to each reaction mixture and samples (5 to 10 µg) were loaded on a nondenaturing 4%
polyacrylamide gel. The gel was prerun in 0.5× Tris-borate-EDTA buffer
for 30 min at 70 mA before loading the samples. After completion of the
run, the gel was transferred to Whatman 3 MM paper, dried at 80°C for
2 h, and exposed to X-ray film for 1 h to overnight with an
intensifying screen.
cAMP measurement.
cAMP was measured by manufacturer's
protocols (PerSeptive Biosystems, Framingham, Mass.). Briefly, 100 µl
of sample, standard, or medium alone, in duplicate, was pipetted into a
96-well plate precoated with goat anti-rabbit antibody. A 100-µl
aliquot of cAMP antibody was applied and allowed to incubate for 2 h at 4°C. After this incubation, 100 µl of cAMP conjugated to AP
was added to the wells and allowed to incubate for 1 h at 4°C.
After incubation, wells were washed six times with wash buffer
(Tris-buffered saline-0.01% thimerosal) and an aliquot (300 µl) of
para-nitrophenyl phosphate substrate solution was added to
each of the wells. After incubation for 2 h at 37°C, the
reaction was stopped by the addition of 50 µl of stop solution (0.2 N
NaOH) to each of the wells, followed by absorbance readings taken at
405 nm.
PGE2 assay.
PGE2 was measured by the
manufacturer's protocol (Amersham Pharmacia). Briefly, 50 µl of
sample, standard, or medium alone, in duplicate, was pipetted into a
96-well plate precoated with goat anti-mouse antibody. A 50-µl
aliquot of PGE2 antibody and 50 µl of PGE2
conjugated to AP were added to the wells and allowed to incubate for
1 h at room temperature. After incubation, wells were washed six
times with wash buffer (0.01 M PBS-0.05% Tween) and a 150-µl
aliquot of 3,3',5,5'-tetramethylbenzidine-hydrogen peroxide (in 20%
dimethyl formamide) substrate solution was applied to each of the
wells. After incubation for 30 min at room temperature, the plate was
read at 650 nm in an ELISA reader.
PLA2 assay.
[3H]AA-labeled
Escherichia coli (DuPont NEN Research Products, Boston,
Mass.) was used as the substrate for measuring PLA2 activity (61, 62). Briefly, the reaction mixture consisted of the following: 10 µl of 2-mg/ml bee venom PLA2 (Sigma,
St. Louis, Mo.; positive control), water (negative control), or culture supernatant of RAW cells treated with Act for various periods of time;
20 µl of water; 10 µl of assay buffer (500 mM Tris-HCl [pH 8.0],
500 mM NaCl, 5 mg of bovine serum albumin/ml, 50% glycerol, 1 mM
CaCl2); and 10 µl of [3H]-labeled E. coli cells. The samples were mixed and incubated at 37°C for 15 min. Subsequently, the reaction was stopped by adding three times the
volume (150 µl) of cold PBS. The samples were vortexed and
centrifuged at 10,000 × g for 10 min at 4°C, and an
aliquot of the supernatant (50 µl) was mixed with 4 ml of
scintillation fluid and counted using a
-counter.
Purification of Act.
For these studies, we expressed the
act gene from broad-host-range tac promoter-based
vector pMMB66 (American Type Culture Collection) in Aeromonas
salmonicida. The act gene was induced with 1 mM
isopropyl-
-D-thiogalactopyranoside (IPTG)
(23). The coding region of the act gene was
cloned into a pMMB66EH vector at the EcoRI and
HindIII sites using the following 5' and 3' primers: 5'CGGAATTCATGCAAAAACTAAAAATAACTGGCTTG3' and
5'ATAAGCTTTTATTGATTGGCTGCTGGCGTCACGCT3'. The
underlined bases represent 5' EcoRI and 3'
HindIII sites. The recombinant plasmid first was
transformed into E. coli HB101 carrying helper plasmid
pRK2013, which conferred kanamycin resistance. Subsequently, the
recombinant pMMB66 plasmid was transformed into a spontaneous
rifampin-resistant mutant of A. salmonicida via conjugation
(69). This Aeromonas strain did not harbor the
gene for Act, and the rifampin resistance marker allowed
differentiation of Aeromonas from E. coli after
conjugation. The transconjugants were screened on Luria-Bertani (LB)
agar plates containing rifampin (40 µg/ml), kanamycin (25 µg/ml),
and ampicillin (100 µg/ml). A. salmonicida
(pMMB66act) was grown in LB medium with appropriate antibiotics at 26°C. At an optical density of 0.4, the culture was
induced with 1 mM IPTG for 2 h. The culture filtrate was subjected to ammonium sulfate precipitation (60% saturation), followed by sequential chromatography on a Resource Q column (Amersham Pharmacia), a phenyl-Sepharose column, and a hydroxyapatite column (Bio-Rad) using
Akta Purifier 10 (Amersham Pharmacia) (23). Approximately 1 mg of the pure toxin was obtained from 2 liters of the culture with
40% total recovery. Silver staining and NH2-terminal amino acid sequence analysis confirmed the purity of Act.
LPS contamination of Act preparation.
The Limulus
amebocyte lysate assay (QCL-1000 kit; BioWhitaker, Walkersville, Md.)
was used to determine the level of lipopolysaccharide (LPS)
contamination in the purified Act. In addition, the effect of polymyxin
B sulfate (which inactivates LPS) on Act's ability to induce
production of various cytokines also was determined. Purified Act was
incubated with polymyxin B sulfate (Sigma) at a concentration of 10 µg/ml for 30 min on ice before use. This concentration of polymyxin
was sufficient to abrogate upregulation of proinflammatory cytokine
genes by LPS (20 ng/ml) in RAW cells.
Statistical analysis.
The data were analyzed by a multiple
group comparison test (Scheffe), which allowed all groups to be
compared with each other, and hence is the most stringent statistical
method available.
 |
RESULTS |
Act induced production of proinflammatory cytokines in
macrophages.
When murine macrophages (RAW264.7) were treated with
purified Act, the abundance of TNF-
mRNA increased within 30 min,
based on Northern analysis. An approximately 200-fold increase in the TNF-
mRNA level was noted when macrophages were treated with Act for
2 h and was followed by a decline in the TNF-
mRNA levels that
remained constant between 4 and 24 h (Fig.
1A). The concentration of Act selected
for these experiments was 6 ng/ml, which did not kill macrophages.
After 24 h of toxin treatment, the cell viability was 98 to 99%
as measured by trypan blue exclusion. An increase in the TNF-
antigen level also was detected at 30 min, and the level gradually
increased for up to 24 h (14,000 pg/ml) based on an ELISA (Fig.
1B). Likewise, an increase in the IL-1
mRNA level was apparent
within 30 min to 2 h of Act exposure to the cells; however, a
maximum increase (130-fold) in the abundance of the IL-1
mRNA was
noted after 4 h of Act treatment (Fig.
2). A dramatic reduction in the mRNA
level of IL-1
was noted after 8 and 24 h of Act treatment of
cells. To confirm the Northern blot analysis data on IL-1
induction,
we performed RT-PCR analysis on total RNA from cells treated with Act.
An increase in the cDNA coding for IL-1
, which was 563 bp in size,
was noted within 30 min to 2 h (data not shown), and these data
matched the Northern blot data (Fig. 2). Specific primers for GAPDH
were used in the same RT-PCR (used for IL-1
) as a positive control
to demonstrate that an equal amount of cDNA was used in the PCR. A
dramatic increase (25-fold over control) in cDNA for IL-6 (638 bp) was
noted at 2 h by RT-PCR when macrophages were treated with Act
(Fig. 3A), although an apparent increase
in the IL-6 cDNA was noted within 30 min. Based on an ELISA, the IL-6
antigen level exhibited an increase at 2 h, which became maximal
at 8 h (1,400 pg/ml) (Fig. 3B). Act-treated RAW cells also
exhibited an increased abundance of iNOS mRNA as determined by Northern
blot analysis. The mRNA for iNOS was first detected at 4 h and
continued to increase for up to 24 h (Fig.
4).

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 1.
Act induces TNF- production in murine macrophages as
determined by Northern blot analysis (A) and ELISA (B). (A) RAW cells
were treated with 6 ng of Act/ml for the indicated times, and the
supernatant was collected. The cells were dissolved in Trizol reagent
for RNA isolation, and 20 µg of total RNA was loaded onto the 3%
formaldehyde gel. After transfer to a nylon membrane, the blot was
probed with a murine TNF- probe, as described in Materials and
Methods. The blot was stripped and reprobed with GAPDH as an internal
control to normalize the load of RNA in each lane of the gel. The blot
was subjected to densitometric scanning, and the fold abundance of
TNF- mRNA was plotted. (B) The supernatant from Act-treated RAW
cells at different time points was examined by ELISA for the presence
of the TNF antigen. Six independent experiments were performed, and
arithmetic means with standard errors were plotted. Asterisks,
statistically significant differences compared to 0-h control at the
P < 0.05 level using Scheffe's test.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
Act induces IL-1 production in murine macrophages as
determined by Northern blot analysis. RAW cells were treated with 6 ng
of Act/ml for the indicated times, and the cells were dissolved in
Trizol reagent for RNA isolation. An aliquot (20 µg) of total RNA was
loaded onto the 3% formaldehyde gel. After transfer to a nylon
membrane, the blot was probed with a murine IL-1 probe as described
in Materials and Methods. The blot was stripped and reprobed with GAPDH
as an internal control to normalize the RNA load in each lane of the
gel. The blot was subjected to densitometric scanning, and the fold
abundance of IL-1 mRNA was plotted. Six independent experiments were
performed, and arithmetic means with standard errors were plotted.
Asterisks, statistical significance at the level of P < 0.05 using Scheffe's test.
|
|


View larger version (3610K):
[in this window]
[in a new window]
|
FIG. 3.
Act induces production of IL-6 in murine macrophages as
determined by RT-PCR (A) and ELISA (B). (A) RAW cells were treated with
6 ng of Act/ml for the indicated times, and the cells were dissolved in
Trizol reagent for RNA isolation. Reverse transcription was performed
on total RNA (1 µg) as described in Materials and Methods.
Subsequently, PCR was conducted on cDNA using specific primers to IL-6
and GAPDH (G3PDH) in the same reaction mixture before examining the
cDNA fragments on a 0.8% agarose gel. (B) ELISA of the supernatant
from Act-treated RAW cells at different time points for the presence of
the IL-6 antigen. Three independent experiments were performed, and
arithmetic means with standard errors were plotted. Asterisks,
statistical significance at the level of P < 0.05 using Scheffe's test.
|
|

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 4.
Act induces the transcription of iNOS. RAW cells were
treated with 6 ng of Act/ml for the indicated times and were dissolved
in Trizol reagent for RNA isolation. An aliquot (20 µg) of total RNA
was loaded onto the 3% formaldehyde gel. After transfer to a nylon
membrane, the blot was probed with iNOS cDNA as described in Materials
and Methods. The blot was stripped and reprobed with GAPDH (G3PDH) as
an internal control to normalize the RNA load in each lane of the gel.
The blot was subjected to densitometric scanning, and the fold
abundance of iNOS mRNA was plotted. Three independent experiments were
performed, and typical Northern blot data are shown.
|
|
The amount of LPS detected in the purified Act preparation was 0.01 ng/ml in 600 µg of Act/ml, as determined by the
Limulus amebocyte lysate assay. Since the toxin was diluted to a concentration
of 6 ng/ml in these experiments, the amount of LPS was negligible
and
thus did not contribute to these increases in proinflammatory
cytokines. In a parallel set of experiments, we determined that
at
least 20 ng of LPS/ml was needed to cause similar increases
in the
TNF-

and IL-1

levels (data not shown), as shown for Act.
LPS at a
concentration of 0.0001 pg/ml present in 6 ng of Act/ml
did not
increase cytokine levels in RAW cells. Further, treatment
of Act with
polymyxin B sulfate, an antibiotic which binds LPS
and inhibits its
biological effects, did not alter Act's ability
to induce TNF-

and
IL-1

production. On the contrary, the levels
of these
proinflammatory cytokines were significantly decreased
(90 to 95%) in
polymyxin B-treated LPS preparations at a tested
concentration of 20 ng/ml (data not shown). Polymyxin B at this
concentration was not toxic
to the
cells.
Act induces production of prostaglandins in macrophages.
We
noted that the levels of PGE2 in the supernatants of
Act-treated macrophages (RAW264.7) were elevated at 4 h, becoming maximal (325 pg/ml) at 24 h, as determined by ELISA (Fig.
5). This increase in PGE2
level was coupled to the induction of COX-2 enzyme, which produced
prostaglandins from AA via the COX pathway. Based on Northern blot
analysis, the abundance of cox-2 mRNA was approximately
40-fold higher at 4 h than that of controls and gradually
decreased at 8 and 24 h (Fig. 6).
The level of COX-2 antigen significantly increased at 8 h,
becoming maximal at 24 h, based on Western blot analysis using
COX-2-specific antibodies (Fig. 6). To demonstrate that the increase in
PGE2 level indeed was coupled to the induction of COX-2
enzyme, we used specific COX-2 inhibitors NS398 and Celebrex at a
concentration of 0.5 µM. As is evident from Fig.
7, when added 1 h prior to Act,
these two inhibitors abrogated PGE2 production (98%) at
the tested time point of 24 h. Cells treated with inhibitor alone
did not alter basal PGE2 levels and served as a negative
control. A significant increase in the level of PGE2 was
detected in cells treated with Act alone and served as a positive
control.

View larger version (8K):
[in this window]
[in a new window]
|
FIG. 5.
Act (6 ng/ml) induces production of PGE2.
Macrophage cells were treated with Act for various times, and the
supernatant was collected. The PGE2 levels in the
supernatant were determined by enzyme immunoassay as described in
Materials and Methods. Asterisks, statistically significant differences
at P < 0.05 compared to 0-h control from four
independent experiments.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 6.
Act induces COX-2 production. (N. blot). RAW cells were
treated with 6 ng of Act/ml for the indicated times and were dissolved
in Trizol reagent for RNA isolation. An aliquot (20 µg) of total RNA
was loaded onto the 3% formaldehyde gel. After transfer to a nylon
membrane, the blot was probed with cox-2 cDNA. The blot was
stripped and reprobed with GAPDH as an internal control to normalize
the RNA load in each lane of the gel. The blot was subjected to
densitometric scanning, and the fold abundance of cox-2 mRNA
(arithmetic means with standard errors) were plotted. Three independent
experiments were performed. Asterisks, statistical significance at the
P < 0.05 level using Scheffe's test. (W. blot).
Proteins (50 µg) from RAW cells treated with Act for various times
were loaded onto an SDS-12% polyacrylamide gel and subjected to
Western blot analysis using affinity-purified goat polyclonal
antibodies to a peptide (amino acid residues 27 to 46) representing the
amino-terminal end of rat COX-2. These antibodies react with rat,
mouse, and human COX-2. The secondary antibodies (rabbit anti-goat
antibody diluted 1:30,000) conjugated with HRP were used, and the blot
was developed with enhanced chemiluminescence substrate.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 7.
Act-induced PGE2 production is inhibited by
COX-2-specific inhibitors. COX-2 inhibitors NS398 and Celebrex were
added at a 0.5 µM concentration 1 h before adding Act (6 ng/ml)
to RAW cells. The PGE2 level in the supernatant was
monitored after 24 h. Three independent experiments were
performed, and arithmetic means with standard errors were plotted.
Asterisks, statistical significance at P < 0.05 compared to control using Scheffe's test.
|
|
We then evaluated the role of PLA
2, which might be coupled
to COX-2-induced PGE
2 production in Act-treated RAW cells.
Based
on Northern blot analysis, it was noted that Act increased the
level of group V secretory PLA
2 mRNA, which became maximal
at
24 h (data not shown). These data were consistent with the
increase
in PLA
2 activity in Act-treated RAW cells (Fig.
8A). An increase
in PLA
2
activity was noted at 10 min, and activity continued to
increase up to
24 h. Pretreatment of RAW cells with sPLA
2 inhibitor
LY311727 (25 µM) for 1 h before Act addition reduced the
PGE
2 production by 70%, which clearly indicated a role for
group V
sPLA
2 in Act-induced PGE
2 production
(Fig.
8B).


View larger version (1411K):
[in this window]
[in a new window]
|
FIG. 8.
(A) Act (6 ng/ml) increases PLA2 activity in
macrophages. The supernatants from Act-treated RAW cells were tested
for PLA2 activity using [3H]AA-labeled
E. coli cells as described in Materials and Methods.
Averages from four experiments were plotted with standard errors. (B)
An inhibitor of sPLA2 reduces PGE2 levels in
macrophages. Group II and V sPLA2 inhibitor LY311727 (25 µM) was added at 1 h before adding Act to RAW cells. The
PGE2 level in the supernatant was monitored after 24 h. Three independent experiments were performed, and arithmetic means
with standard errors were plotted. Asterisks, statistical significance
(P < 0.05) compared to 0-h control using Scheffe's
test.
|
|
Act induces cAMP production in macrophages.
We tested whether
Act would increase cAMP levels in RAW cells. As is evident in Fig.
9, cAMP levels were increased marginally in culture supernatants of Act-treated cells starting at 30 min and
levels increased for up to 24 h. However, cAMP levels increased to
a greater extent when the cells were treated with Act in a medium
containing 0.05 mM isobutylmethylxanthine (a phosphodiesterase inhibitor), which prevented cAMP degradation. These data indicated that
the fluid secretory responses observed in animal models with Act could
in part be attributed to production of PGE2 and cAMP as a
result of infiltration and activation of macrophages. Indeed, rat
ligated intestinal loops injected with 200 ng of Act contained four- to
fivefold-elevated PGE2 levels in the fluid. The level of
PGE2 detected in PBS-treated loops was 408 ± 21 pg/mg
of protein, which increased to 2,019 ± 58 pg/mg of protein in
loops challenged with Act. We were unable to measure accurately the
cAMP in the mucosal tissue and fluid because of extensive tissue damage
and marked cAMP degradation.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 9.
Act (6 ng/ml) increases cAMP production in macrophages.
The supernatants from Act-treated RAW cells were tested for increased
levels of cAMP using ELISA (see Materials and Methods). The experiment
was performed in the absence (hatched bar) or presence (solid bar) of
isobutylmethylxanthine (0.05 mM), which is a phosphodiesterase
inhibitor. Averages from three independent experiments with standard
deviations were plotted. Asterisks, statistically significant
difference (P < 0.05) compared to the 0-h control.
|
|
Act causes activation of NF-
B and CREB transcription factors in
macrophages.
It is evident from Fig.
10A that Act caused an increase in
nuclear translocation of a protein capable of binding a radiolabeled NF-
B binding sequence, as determined by gel shift assay. An increase in the amount of p50 homodimer of NF-
B was evident at 2 h
(three- to fivefold over basal level; Fig. 10A, lane 6) and remained
constant up to 8 h and decreased at the 24-h time point (Fig. 10A,
lanes 3 to 9). In fact the presence of a heterodimer of p50 and p65 could be visualized within 30 min (Fig. 10A, lane 5). Addition of an
unlabeled NF-
B oligonucleotide consensus primer to the nuclear
extracts before adding the 32P-labeled NF-
B
oligonucleotide blocked the binding of the latter to the NF-
B
transcription factor, indicating the specificity of the primer binding
(Fig. 10A, lanes 11 and 12). Nuclear extract from HeLa cells was used
as a positive control (Fig. 10A, lanes 2 and 10). The reaction mixture
without the HeLa cell nuclear extract was used as a negative control in
these experiments, and no radioactive band was detected (Fig. 10A, lane
1). Use of p50 antibodies caused the p50 homodimer to supershift in
Act-treated cells (Fig. 10A, lane 13), further indicating the
specificity of the oligonucleotide used. Lane 13 was exposed for a
longer period of time to clearly demonstrate the supershifting of the
p50 homodimer. Further, the p50-p65 heterodimer band disappeared using
p50 antibodies (Fig. 10A, lane 13); however, the intensity of the
p50-p65 supershift band was very weak (Fig. 10A, lane 13). We believe
that the higher-molecular-weight band in Act-treated nuclear extract,
which reacted with the labeled NF-
B consensus oligonucleotide,
represented the p50-p65 heterodimer, since the size of this band was
similar to that seen in HeLa cell nuclear extract, which was used as a
positive control in this experiment (Fig. 10A, lane 2). We clearly
demonstrated supershifting of both the p50 homodimer and the p50-p65
heterodimer using p50 antibodies in HeLa cell nuclear extract which
contained abundant amounts of the p50 homodimer and the p50-p65
heterodimer (Fig. 10A, lane 15). Similarly, antibodies to p65 caused
supershifting of the p50-p65 heterodimer in HeLa cell nuclear extract
(Fig. 10A, lane 14).

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 10.
Act (6 ng/ml) activates NF- B and CREB transcription
factors in RAW cells as determined by gel shift and supershift assays.
Nuclear extracts (10 µg) from Act-treated RAW cells were mixed with
consensus primers for NF- B and CREB, subjected to a nondenaturing
4% polyacrylamide gel electrophoresis (see Materials and Methods), and
autoradiographed. (A) Nuclear extracts from HeLa and Act-treated RAW
cells at the time points indicated below were examined for NF- B.
Lane 1, no HeLa cell extract (negative control); lane 2, with HeLa cell
extract (positive control); lanes 3 to 9, nuclear extract from
Act-treated RAW cells at 0, 10, and 30 min and at 2, 4, 8, and 24 h, respectively; lane 10, nuclear extract from HeLa cells mixed with a
cold consensus primer before adding the radioactive primer; lane 11, nuclear extract from Act-treated RAW cells mixed with a cold consensus
primer before adding the radioactive primer (0 h); lane 12, 24-h
sample; lane 13, supershift assay using antibodies to p50 with
Act-treated RAW cells; lanes 14 and 15, supershift assays with HeLa
cell nuclear extract using antibodies to p65 (lane 14) and p50 (lane
15). Free [32P]dCTP runs at the bottom of the gel. (B)
Nuclear extracts from HeLa and Act-treated RAW cells at the time points
indicated below were examined for CREB. Lane 1, no HeLa cell extract
(negative control); lanes 2 to 8, nuclear extract from Act-treated RAW
cells at 0, 10, and 30 min and at 2, 4, 8, and 24 h, respectively;
lane 9, nuclear extract from HeLa cells mixed with a cold consensus
primer before adding the radioactive primer; lane 10, nuclear extract
from Act-treated RAW cells mixed with a cold consensus primer before
adding the radioactive primer (0 h); lane 11, 24-h sample; lane 12, antibodies to CREB were added before radiolabeled CREB-specific primer.
Three to five independent experiments were performed, and data from a
typical experiment are shown.
|
|
In a similar experiment, a cAMP-responsive element (CRE) binding
protein (CREB)-specific consensus primer was used in the
gel shift
assay. We noted that proteins from nuclear extracts
from Act-treated
RAW cells bound to the
32P-labeled CREB-specific primer
(Fig.
10B, lanes 2 to 8). The increase
in CREB was apparent at 2 h. Once again, a reaction mixture without
HeLa cell nuclear extract
served as a negative control (Fig.
10B,
lane 1). The specificity of
labeled CREB oligonucleotide to bind
to CREB protein was confirmed by
competition with a non-radioactively
labeled CREB oligonucleotide (Fig.
10B, lanes 9 to 11). Likewise,
the intensity of the CREB-specific band
at the 24-h time point
after Act treatment decreased dramatically when
CREB antibodies
were used (Fig.
10B, lane 12). The detection of weaker
supershift
bands could be due to the binding of NF-

B and CREB
antibodies
to a region to which specific oligonucleotides bind, thus
preventing
efficient binding of radiolabeled oligonucleotides to
NF-

B or
CREB. Alternatively, concentration of the commercial
antibodies
or the amount of NF-

B or CREB in Act-treated cells might
not
be high enough to clearly show supershift bands. No activation
of
other transcription factors, such as AP-1, AP-2, SP-1, TFIID,
or OCT-1,
was noted, indicating that Act specifically activated
NF-

B and
CREB.
Act induces antiapoptotic protein Bcl-2 in macrophages.
Treatment of macrophages with Act caused upregulation of the
antiapoptotic protein Bcl-2, which was maximally (five- to eightfold increase over control) detected at 4 h (Fig.
11). Bcl-2 could prevent massive
apoptosis of cells resulting from the production of proinflammatory cytokines induced by Act and may represent a host defense against cell
death.

View larger version (8K):
[in this window]
[in a new window]
|
FIG. 11.
Western blot analysis showing that Act (6 ng/ml)
increases Bcl-2 levels in macrophages. An aliquot of cellular proteins
(50 µg) at different time points after Act treatment was loaded on an
SDS-12% polyacrylamide gel and subjected to Western analysis as
described in Materials and Methods. The blot was developed using an ECL
kit. Three independent experiments were performed.
|
|
 |
DISCUSSION |
Act and other extracellular enzymes produced by
Aeromonas spp. are important virulence factors involved in
the pathogenesis of Aeromonas infections (14, 52,
69). Act has multiple biological activities, ranging from its
ability to cause extensive tissue injury to its evocation of a fluid
secretory response in ligated small intestinal loops of animals. The
present study was undertaken to examine which Act-induced
proinflammatory cytokines might lead to pathogenic effects in animals.
Indeed, evidence that many bacterial toxins possess cytokine-inducing
activities is accumulating (30, 31), and therefore the host
proinflammatory cytokine response to Act may contribute to the
pathogenesis of Aeromonas infections. Further, it was
intriguing to determine a mechanism by which Act evoked
PGE2 and cAMP production, which could lead to fluid
secretion in animals. To dissect Act's mechanism of action, we opted
to use murine macrophage cell line RAW264.7. The Act concentration selected was 6 ng/ml, which did not affect the viability of these cells. Our studies also were designed to clarify intracellular signaling mechanisms involved in (i) toxin induction of cytokine gene
expression and (ii) Act-induced expression of the cox-2 gene involved in PGE2 production through activation of
transcription factors.
Our results demonstrated that Act caused increased levels of
proinflammatory cytokines, such as TNF-
, IL-1
, and IL-6, as determined by Northern blot analysis, RT-PCR, and ELISA (Fig. 1 to 3).
We demonstrated that the increased levels of these cytokines were Act
specific, as the LPS contamination in the purified preparation of Act
was negligible. Further, we noted that treatment of Act with polymyxin
B sulfate did not alter the toxin's ability to induce production of
various cytokines. We also noted that peritoneal macrophages derived
from an LPS-hyporesponsive mouse strain (C3H/HeJ) responded to Act and
produced various proinflammatory cytokines, whereas LPS at a tested
concentration of 20 ng/ml did not elevate TNF-
and IL-1
levels in
these macrophages. While our studies were in progress, Braun et al.
(10) reported that pneumolysin, a pore-forming hemolysin
produced by Streptococcus pneumoniae, also was capable of
increasing TNF-
and IL-6 levels in macrophages. Like Act,
pneumolysin binds to cholesterol and forms large oligomeric pores
(60). Shiga toxin from Shigella dysenteriae
inhibits protein synthesis and similarly increases proinflammatory
cytokine production (TNF-
, IL-1
, and IL-6) in macrophages.
However, Shiga toxin selectively targets vascular endothelial cells
(65).
Act-mediated induction of iNOS (Fig. 4) possibly occurs via
upregulation of TNF-
and IL-1
in the host cell. Nitric oxide (NO)
production by iNOS is an essential element of antimicrobial immunity
and host-induced tissue damage (10). Since
Aeromonas spp. cause invasive diseases, this report
represents the first study showing that a protein toxin in
Aeromonas is responsible for iNOS production. Recently, the
leukotoxin produced by Pasteurella haemolytica, a member of
the repeats-in-toxin family of pore-forming exotoxins, has been shown
to induce gene expression for iNOS in bovine alveolar macrophages
(34). It has been shown that the mechanism of iNOS
regulation involves IFN-
-mediated upregulation of IFN regulatory
factor 1 (IRF-1) expression. IRF-1 binds to the iNOS promoter and
activates iNOS transcription synergistically with NF-
B, induced
through TNF, IL-1, or LPS signaling (39, 68). Recent studies
of Braun et al. (10) indicated that RAW cells could
synthesize enough endogenous IFN-
within cultures to activate iNOS
expression when exposed to pneumolysin from S. pneumoniae,
which also could be the case with Act-stimulated RAW cells. In
contrast, iNOS expression by LPS and TNF is normally dependent on
IFN-
signaling and requires priming with exogenous IFN-
(10).
Act caused macrophages to release PGE2 in the supernatant,
and the production of this eicosanoid was abrogated by COX-2 inhibitors (NS398 and Celebrex) (Fig. 5 and 7). These data indicated that Act
induced production of PGE2 from AA via a COX pathway
(54). Since AA is present at a limited concentration in the
cells, we demonstrated that Act elevated cellular levels of AA by
increasing the expression of group V sPLA2, which acted on
the membrane phospholipids of eukaryotic cells (Fig. 8A). Recently, a
similar upregulation of group V sPLA2 by LPS in macrophages
was reported (8). Our data with regard to the role of group
V sPLA2 in regulating PGE2 production in
Act-treated RAW cells were substantiated further, as a specific
inhibitor of sPLA2 (both groups II and V) dramatically reduced PGE2 production in RAW cells (Fig. 8B). We have
shown that LPS stimulated the production of group II sPLA2
in murine macrophages, as determined by Western blot analysis
(unpublished data). However, Act failed to induce group II
sPLA2 production but caused increased expression of the
group V PLA2-encoding gene. Increased sPLA2 at
the surfaces of activated cells is due to gene induction and de novo
protein synthesis and not due to exocytosis of preformed protein
(8). Our earlier studies indicated that actinomycin D and
cycloheximide inhibited cholera toxin (CT)-induced fluid secretion in
rabbit ligated small intestinal loops, indicating a role for de novo
protein synthesis in the mechanism of action of CT (54).
Subsequently, we demonstrated that CT upregulated in both epithelial
cell lines and macrophages a gene encoding PLA2-activating
protein (PLAA), which exhibited homology with numerous G-protein
-subunits (51, 54). PLAA has been shown to upregulate the
expression of group II sPLA2 in murine BC3H1 cells
(21). Therefore, we tested whether Act would activate group
V sPLA2 in macrophages as well via PLAA. However, our
Northern blot analysis demonstrated that Act did not alter the
expression of the gene encoding PLAA, suggesting thereby a different
mechanism of activation of group V sPLA2 by Act, which is
under investigation. Interestingly, LPS induced the production of PLAA
in macrophages (data not shown). Our data indicated for the first time
that Act-induced PGE2 production was linked to the COX-2
pathway and is, in turn, coupled to group V sPLA2. We noted
that the kinetics of Act-induced cox-2 gene expression in
macrophages (Fig. 6) was different from that in cells exposed to LPS.
The mRNA for cox-2 was short-lived, as its level declined
after 4 h of treatment of macrophages with Act. However,
LPS-induced cox-2 mRNA was stable up to 24 h (data not
shown). Taken together, these data indicated that Act induced the
production of proinflammatory cytokines (TNF-
, IL-1
, and IL-6) as
well as iNOS in macrophages. It is therefore plausible that these
inflammatory mediators cause the extensive tissue injury seen in
ligated intestinal loops of experimental animals challenged with Act.
We also have demonstrated that Act increases TNF-
levels in
intestinal epithelial cell line IEC-6 (data not shown). TNF-
loosens
the tight junctions around epithelial cells allowing (i) influx of
inflammatory cells into the intestinal lumen and (ii) increased uptake
of Act into the lamina propria, where inflammatory cells could be
activated (49). At present, we are investigating whether the
extent of inflammation induced by Act in ligated intestinal loops
correlates with the fluid secretory response.
We also demonstrated that Act increased cAMP production in macrophages
(Fig. 9), which could occur as a result of (i) direct activation of
G-protein-coupled adenylate cyclase or (ii) indirect activation of
adenylate cyclase by PGE2 (54). It also is known that PGE2 induces adenylate cyclase, which forms cAMP from
ATP (53). Both cAMP and PGE2 production by
macrophages may in part be responsible for evoking fluid secretion in
animals by Act (53) as a result of infiltration and
activation of macrophages. Our recent data suggested that most of the
cAMP was produced through PGE2 activation of the adenylate
cyclase enzyme. We noted that treatment with Celebrex or
sPLA2 inhibitor, which dramatically reduced Act-induced
PGE2 production (Fig. 7 and 8B), significantly decreased
cAMP levels (70 to 80%) in Act-treated RAW cells. The remainder of the
cAMP might have been generated through direct activation of adenylate
cyclase enzyme. However, the adenylate cyclase activity should be
measured in Act-treated cells to draw a firm conclusion.
Our results indicated that Act caused an increase in the nuclear
translocation of proteins capable of binding NF-
B and CREB-binding sequences within the first 2 h (Fig. 10). Transcription factor NF-
B is important in a number of inflammation-related pathways (63), and binding elements for the transcriptional
regulatory factors NF-
B and CREB are present in the
enhancer/promoter regions of immunoregulatory cytokine genes, including
the TNF-
, IL-1
, and IL-6 genes. These transcription factors have
important functions in modulating the transcription of cytokine and
cox-2 genes, as well as of cellular adhesion molecules
(27, 63, 67). An inactive NF-
B heterodimer which consists
of p50 and p65 subunits is present in the cytoplasm in complex with
inhibitory protein I-
B, which binds NF-
B in the cytoplasm and
prevents its translocation to the nucleus (34). NF-
B
activation results in phosphorylation, ubiquitination, and degradation
of I-
B, leading to nuclear translocation of NF-
B and its binding
to specific enhancer/promoter sequences, resulting in expression of
target genes. Our data indicated that Act mediated the selective
upregulation of transcription in macrophages by inducing intracellular
signaling events, resulting in nuclear translocation of transcriptional
activators NF-
B and CREB (Fig. 10). Interestingly, we noted the
translocation of the p50 homodimer of NF-
B in the nucleus of RAW
cells even at 0 h, and translocation increased after Act treatment
(Fig. 10A). Recently, it has been reported that translocation of the
p50 homodimer in the nucleus may be important to prevent upregulation
of genes encoding proinflammatory cytokines in unstimulated cells
(40). Therefore, the p50 homodimer may prevent
overactivation of the proinflammatory cytokines by the p50-p65
heterodimer of NF-
B. Recently, leukotoxin produced by P. haemolytica was reported to cause translocation of nuclear NF-
B
after a 5-min exposure in bovine alveolar macrophages, as measured by
immunofluorescence using confocal microscopy (34). It was
noted further that bovine alveolar macrophages pretreated with an
inhibitor of tyrosine kinases (e.g., herbimycin A) did not cause
activation of NF-
B by leukotoxin, indicating that tyrosine phosphorylation was required for leukotoxin-induced NF-
B activation. It needs to be determined whether protein kinases play a role in
Act-mediated signaling. It is particularly important, as herbimycin A
did not affect either TNF-
and IL-8 gene expression or NF-
B activation in LPS-induced bovine alveolar macrophages, indicating the
involvement of the tyrosine kinase-insensitive LPS-signaling pathway or
the involvement of another transcription factor(s) in the expression of
TNF and IL-8. Interestingly, it has been suggested that expression of
the TNF-
gene is downregulated by agents that elevate cAMP (e.g.,
PGE2, dibutyryl cAMP, CT, and 8-bromo-cAMP), with a
concomitant decrease in protein kinase A activity (64). It
is therefore possible that the reduced mRNA levels of TNF-
in
Act-treated macrophages after 2 h might be due to (i) the short
half-life of TNF-
mRNA and (ii) an increase in cAMP in cells treated
with Act (Fig. 1A and 9). A continuous increase in the TNF-
antigen
level up to 24 h may be reflected by the translation of the
existing TNF transcript in the cells (Fig. 1B).
Interestingly, NF-
B activation induced by hypoxia remained
unaffected in epithelial cells exposed to 8-bromo-cAMP, and the role of
CRE and CRE-binding proteins (CREB) in inducing TNF-
in hypoxia has
been reported (64). The CREB family of transcription factors
are leucine zipper proteins that bind to the CRE with the consensus
sequence 5'-TGACGTCA-3' (64). CREB is
phosphorylated at serine 133 by protein kinase A in response to cAMP,
and this leads to transcriptional activation of genes with promoters
containing the CRE sequence. Other signaling pathways that lead to
phosphorylation and CREB activation include calmodulin kinase, which
phosphorylates CREB in response to increased intracellular
Ca2+, and protein kinase Rsk2 (a member of the pp90
ribosomal protein S6 kinase family), which is activated by
mitogen-activated protein kinases (64). Whether Act
activates CREB through the above-mentioned signaling pathways needs to
be determined. Hsuan et al. (34) reported that elevation of
intracellular Ca2+ in leukotoxin-stimulated bovine alveolar
macrophages was essential for NF-
B activation and cytokine gene
expression, as chelation of intracellular Ca2+ blocked both
of these responses. These studies are very provocative, since NF-
B
recently was shown to induce CREB promoter activity in Sertoli and NIH
3T3 cells (22). Studies of Krause et al. (42)
indicated that aerolysin, which exhibited homology with Act, increased
intracellular Ca2+ levels in human granulocytes (HL-60).
Therefore, these toxins could plausibly require Ca2+ for
both NF-
B and CREB activation.
Act-induced expression of the gene encoding COX-2 led to increased
PGE2 production in RAW cells (Fig. 5 and 6). Recently, Wang
and Tai (67) suggested that CRE might mediate the induction of prostaglandin H synthase-2 (COX-2) expression in human
amnion-derived WISH cells. These studies correlate with our findings
that the cox-2 gene expression might be linked to the CREB
activation (Fig. 5 and 10B). We believe that both NF-
B and CREB
might be involved in the cox-2 gene expression induced by
Act, because two NF-
B binding sites have been shown to be present at
positions
265 and
490 upstream of the cox-2 gene
(4) and Act-activated NF-
B (Fig. 10A). Further, there is
one CRE site at position
101 upstream of the cox-2 gene
(4). Recent studies of Abate et al. (1) indicated
that SN50, an inhibitor of NF-
B translocation, indeed attenuated
PGE2 accumulation in culture supernatants of LPS-stimulated macrophages. It needs to be determined whether Act phosphorylates Rsk2,
resulting in activation of transcription factor CREB. Interestingly, LPS has been shown to activate AP-1 (27); however, Act did
not affect AP-1 or other transcription factor levels in RAW cells.
Our studies also indicated that Act generated antiapoptotic signals in
Act-treated macrophages (Fig. 11). Our data are consistent with the
recent findings that NF-
B protected cells against TNF-induced cell
death by inducing the expression of antiapoptotic genes
(71). Thus, the host responses are triggered by Act to
prevent cell death, which is beneficial for the bacteria. However, the
extent of host tissue injury is determined by the number of bacteria during infection and the amount of Act secreted by
Aeromonas. It is not known whether PLA2 also
triggers antiapoptotic signals (e.g., Bcl-2) in cells. It is plausible
that high levels of sPLA2 accumulated at inflammatory sites
by Act may not only regulate inflammation but also protect cells from
unnecessary death induced by proinflammatory agents as a result of
production of antiapoptotic proteins. It is also possible that
activation of CREB by Act might enhance the expression of the gene
encoding Bcl-2. In this context, it is interesting to note that
insulin-like growth factor-I induces antiapoptotic protein Bcl-2
through the nuclear transcription of CREB in PC12 cells employing a
novel signaling pathway involving MAPK 6, p38
MAPK, and MAPKAP-K3,
resulting in the induction of the bcl-2 promoter containing
the CRE binding site (57). It is therefore tempting to
speculate that Act may operate through a similar pathway, as CREB
levels are increased in macrophages treated with Act (Fig. 10B).
Further studies on signal transduction in Act-treated macrophages are
in progress.
In conclusion, Act upregulates the production of proinflammatory
cytokines and antiapoptotic protein Bcl-2 as well as activates AA
metabolism in macrophage/monocyte cells. The increased expression of
genes encoding proinflammatory cytokines, Bcl-2, and COX-2 appears
related to activation of transcription factors NF-
B and CREB.
Act-induced PGE2 production has been linked to upregulation of COX-2, which is coupled to group V sPLA2. This is the
first report of a detailed mechanism of action of Act from A. hydrophila. Further studies on Act-induced signal transduction in
macrophages would elicit pathogenic sequelae associated with
Aeromonas infections.
 |
ACKNOWLEDGMENTS |
This work was supported by Public Health Service grant AI41611
from the National Institutes of Health.
We thank Mardelle Susman for editorial comments and Lyska Morrison for
secretarial help.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, UTMB, Galveston, TX 77555-1070. Phone:
(409) 747-0578. Fax: (409) 747-6869. E-mail:
achopra{at}utmb.edu.
Editor:
J. D. Clements
 |
REFERENCES |
| 1.
|
Abate, A.,
S. Oberle, and H. Schroder.
1998.
Lipopolysaccharide-induced expression of cyclooxygenase-2 in mouse macrophages is inhibited by chloromethylketones and a direct inhibitor of NF- B translocation.
Prostaglandins Other Lipid Mediat.
56:277-290[CrossRef][Medline].
|
| 2.
|
Abbott, S. L.,
L. S. Seli,
M. Catino, Jr.,
M. A. Hartley, and J. M. Janda.
1998.
Misidentification of unusual Aeromonas species as members of the genus Vibrio: a continuing problem.
J. Clin. Microbiol.
36:1103-1104[Abstract/Free Full Text].
|
| 3.
|
Altwegg, M.,
L. G. Martinetti,
J. Luthy-Hottenstein, and M. Rohrbach.
1991.
Aeromonas-associated gastroenteritis after consumption of contaminated shrimp.
Eur. J. Clin. Microbiol. Infect. Dis.
10:44-45[Medline].
|
| 4.
|
Appleby, S. B.,
A. Ristimaki,
K. Neilson,
K. Narko, and T. Hla.
1994.
Structure of human cyclo-oxygenase-2 gene.
Biochem. J.
302:723-727.
|
| 5.
|
Asao, T.,
Y. Kinoshita,
S. Kozaki,
T. Uemura, and G. Sakaguchi.
1984.
Purification and some properties of Aeromonas hydrophila hemolysin.
Infect. Immun.
46:122-127[Abstract/Free Full Text].
|
| 6.
|
Atkinson, H. M., and T. J. Trust.
1980.
Hemagglutination properties and adherence ability of Aeromonas hydrophila.
Infect. Immun.
27:938-946[Abstract/Free Full Text].
|
| 7.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1989.
Current protocols in molecular biology.
John Wiley and Sons, Inc., New York, N.Y.
|
| 8.
|
Balboa, M. A.,
J. Balsinde,
M. V. Winstead,
J. A. Tischfield, and E. A. Dennis.
1996.
Novel group V phospholipase A2 involved in arachidonic acid mobilization in murine P388D1 macrophages.
J. Biol. Chem.
271:32381-32384[Abstract/Free Full Text].
|
| 9.
|
Barnett, T. C.,
S. M. Kirov,
M. S. Strom, and K. Sanderson.
1997.
Aeromonas spp. possess at least two distinct type IV pilus families.
Microb. Pathog.
23:241-247[CrossRef][Medline].
|
| 10.
|
Braun, J. S.,
R. Novak,
G. Gao,
P. J. Murray, and J. L. Shenep.
1999.
Pneumolysin, a protein toxin of Streptococcus pneumoniae, induces nitric oxide production from macrophages.
Infect. Immun.
67:3750-3756[Abstract/Free Full Text].
|
| 11.
|
Buchanan, R. L., and S. A. Palumbo.
1985.
Aeromonas hydrophila and Aeromonas sobria as potential food poisoning species: a review.
J. Food Safety
7:15-29.
|
| 12.
|
Carnahan, A. M., and M. Altwegg.
1996.
The genus Aeromonas, p. 1-38.
In
B. Austin, M. Altwegg, P. J. Gosling, and S. Joseph (ed.), Taxonomy. John Wiley & Sons, New York, N.Y.
|
| 13.
|
Chakraborty, T.,
B. Huhle,
H. Bergbauer, and W. Goebel.
1986.
Cloning, expression, and mapping of the Aeromonas hydrophila aerolysin gene determinant in Escherichia coli K-12.
J. Bacteriol.
167:368-374[Abstract/Free Full Text].
|
| 14.
|
Chakraborty, T.,
B. Huhle,
H. Hof,
H. Bergbauer, and W. Goebel.
1987.
Marker exchange mutagenesis of the aerolysin determinant in Aeromonas hydrophila demonstrates the role of aerolysin in A. hydrophila associated systemic infections.
Infect. Immun.
55:2274-2280[Abstract/Free Full Text].
|
| 15.
|
Chakraborty, T.,
M. A. Montenegro,
S. C. Sanyal,
R. Helmuth,
E. Bulling, and K. N. Timmis.
1984.
Cloning of enterotoxin gene from Aeromonas hydrophila provides conclusive evidence of production of a cytotonic enterotoxin.
Infect. Immun.
46:435-441[Abstract/Free Full Text].
|
| 16.
|
Chakroborty, T.,
A. Schmidt,
S. Notermans, and R. Benz.
1990.
Aerolysin of Aeromonas sobria: evidence for formation of ion-permeable channels and comparison with alpha-toxin of Staphylococcus aureus.
Infect. Immun.
58:2127-2132[Abstract/Free Full Text].
|
| 17.
|
Chopra, A. K., and C. W. Houston.
1999.
Enterotoxins in Aeromonas-associated gastroenteritis.
Microbes Infect.
1:1129-1137[CrossRef][Medline].
|
| 18.
|
Chopra, A. K.,
C. W. Houston,
J. W. Peterson, and G. F. Jin.
1993.
Cloning, expression, and sequence analysis of a cytolytic enterotoxin gene from Aeromonas hydrophila.
Can. J. Microbiol.
39:513-523[Medline].
|
| 19.
|
Chopra, A. K.,
C. W. Houston, and A. Kurosky.
1991.
Genetic variation in related cytolytic toxins produced by different species of Aeromonas.
FEMS Microbiol. Lett.
79:231-237.
|
| 20.
|
Chopra, A. K.,
J. Peterson,
X. J. Xu,
D. H. Coppenhaver, and C. W. Houston.
1996.
Molecular and biochemical characterization of a heat-labile enterotoxin from Aeromonas hydrophila.
Microb. Pathog.
21:357-377[CrossRef][Medline].
|
| 21.
|
Clark, M. A.,
L. E. Ozgur,
T. M. Conway,
J. Dispoto,
S. T. Crooke, and J. S. Bomalaski.
1991.
Cloning of a phospholipase A2-activating protein.
Proc. Natl. Acad. Sci. USA
88:5418-5422[Abstract/Free Full Text].
|
| 22.
|
Delfino, F. J., and W. H. Walker.
1999.
NF- B induces cAMP-response element-binding protein gene transcription in Sertoli cells.
J. Biol. Chem.
274:35607-35613[Abstract/Free Full Text].
|
| 23.
|
Ferguson, M. R.,
X. J. Xu,
C. W. Houston,
J. W. Peterson,
D. H. Coppenhaver,
V. L. Popov, and A. K. Chopra.
1997.
Hyperproduction, purification, and mechanism of action of the cytotoxic enterotoxin produced by Aeromonas hydrophila.
Infect. Immun.
65:4299-4308[Abstract].
|
| 24.
|
Ferguson, M. R.,
X. J. Xu,
C. W. Houston,
J. W. Peterson, and A. K. Chopra.
1995.
Amino-acid residues involved in biological functions of the cytolytic enterotoxin from Aeromonas hydrophila.
Gene
156:79-83[CrossRef][Medline].
|
| 25.
|
Gerland, W. J., and J. T. Buckley.
1988.
The cytolytic toxin aerolysin must aggregate to disrupt erythrocyte membranes, and aggregation is stimulated by human glycophorin.
Infect. Immun.
56:1249-1253[Abstract/Free Full Text].
|
| 26.
|
Grey, P. A., and S. M. Kirov.
1993.
Adherence to Hep-2 cells and enteropathogenic potential of Aeromonas spp.
Epidemiol. Infect.
110:279-287[Medline].
|
| 27.
|
Gupta, D.,
Q. Wang,
C. Vinson, and R. Dziarski.
1999.
Bacterial peptidoglycan induces CD14-dependent activation of transcription factors CREB/ATF and AP-1.
J. Biol. Chem.
274:14012-14020[Abstract/Free Full Text].
|
| 28.
|
Hanninen, M. L.,
P. Oivanen, and V. Hirvela-Koski.
1997.
Aeromonas species in fish, fish-eggs, shrimp and freshwater.
Int. J. Food Microbiol.
34:17-26[CrossRef][Medline].
|
| 29.
|
Hanninen, M. L.,
S. Salmi,
L. Mattila,
R. Taipalinen, and A. Siitonen.
1995.
Association of Aeromonas spp with traveller's diarrhoea in Finland.
J. Med. Microbiol.
41:26-31.
|
| 30.
|
Henderson, B.,
S. Poole, and M. Wilson.
1996.
Bacterial modulins: a novel class of virulence factors which cause host tissue pathology by inducing cytokine synthesis.
Microbiol. Rev.
60:316-341[Abstract/Free Full Text].
|
| 31.
|
Henderson, B.,
M. Wilson, and B. Wren.
1997.
Are bacterial exotoxins cytokine network regulators?
Trends Microbiol.
5:454-458[CrossRef][Medline].
|
| 32.
|
Howard, S. P., and J. T. Buckley.
1986.
Molecular cloning and expression in Escherichia coli of the structural gene for the hemolytic toxin aerolysin from Aeromonas hydrophila.
Mol. Gen. Genet.
204:289-295[CrossRef][Medline].
|
| 33.
|
Howard, S. P.,
W. J. Garland,
M. J. Green, and J. T. Buckley.
1987.
Nucleotide sequence of the gene for the hole-forming toxin aerolysin of Aeromonas hydrophila.
J. Bacteriol.
169:2869-2871[Abstract/Free Full Text].
|
| 34.
|
Hsuan, S. L.,
M. S. Kannan,
S. Jeyaseelan,
Y. S. Prakash,
C. Malazdrewich,
M. S. Abrahamsen,
G. C. Sieck, and S. K. Maheswaran.
1999.
Pasteurella haemolytica leukotoxin and endotoxin induced cytokine gene expression in bovine alveolar macrophages requires NF- B activation and calcium elevation.
Microb. Pathog.
26:263-273[CrossRef][Medline].
|
| 35.
|
Husslein, V.,
B. Huhle,
T. Jarchau,
R. Lurz,
W. Goebel, and T. Chakraborty.
1988.
Nucleotide sequence and transcriptional analysis of the AerCaerA region of Aeromonas sobria encoding aerolysin and its regulatory region.
Mol. Microbiol.
2:507-517[CrossRef][Medline].
|
| 36.
|
Janda, J. M., and S. L. Abbott.
1998.
Evolving concepts regarding the genus Aeromonas: an expanding panorama of species, disease presentations, and unanswered questions.
Clin. Infect. Dis.
27:332-344[Medline].
|
| 37.
|
Jin, G. F.,
A. K. Chopra, and C. W. Houston.
1992.
Stimulation of neutrophil leukocyte chemotaxis by a cloned cytolytic enterotoxin of Aeromonas hydrophila.
FEMS Microbiol. Lett.
98:285-290[CrossRef].
|
| 38.
|
Jin, G. F., and C. W. Houston.
1992.
The effect of Aeromonas hydrophila enterotoxins on the phagocytic function of mouse phagocytes.
Dig. Dis. Sci.
37:1697-1703[CrossRef][Medline].
|
| 39.
|
Kamijo, R.,
H. Harada,
T. Matsuyama,
M. Bosland,
J. Gerecitano,
D. Shapiro,
J. Le,
S. I. Koh,
T. Kimura,
S. J. Green,
T. W. Mak,
T. Taniguchi, and J. Vilcek.
1994.
Requirement for transcription factor IRF-1 in NO synthase induction in macrophages.
Science
263:1612-1615[Abstract/Free Full Text].
|
| 40.
|
Kastenbauer, S., and H. W. Loms Ziegler-Heitbrock.
1999.
NF- B1 (p50) is upregulated in lipopolysaccharide tolerance and can block tumor necrosis factor gene expression.
Infect. Immun.
67:1553-1539[Abstract/Free Full Text].
|
| 41.
|
Kirov, S. M.,
E. K. Ardestani, and L. J. Hayward.
1993.
The growth and expression of virulence factors at refrigeration temperature by Aeromonas strains isolated from foods.
Int. J. Food Microbiol.
20:159-168[CrossRef][Medline].
|
| 42.
|
Krause, K. H.,
M. Fivaz,
A. Monod, and F. G. van der Goot.
1998.
Aerolysin induces G-protein activation and Ca2+ release from intracellular stores in human granulocytes.
J. Biol. Chem.
273:18122-18129[Abstract/Free Full Text].
|
| 43.
|
Ljungh, A.,
P. Eneroth, and T. Wadstrom.
1982.
Cytotonic enterotoxin from Aeromonas hydrophila.
Toxicon
20:787-794[Medline].
|
| 44.
|
Majeed, K. N.,
A. F. Egan, and I. C. MacRae.
1990.
Production of exotoxins by Aeromonas spp. at 5°C.
J. Appl. Bacteriol.
69:332-337[Medline].
|
| 45.
|
Merino, S.,
A. Aguilar,
M. M. Nogueras,
M. Regue,
S. Swift, and J. M. Tomas.
1999.
Cloning, sequencing, and role of two phospholipases (A1 and C) from mesophilic Aeromonas sp. serogroup O:34.
Infect. Immun.
67:4008-4013[Abstract/Free Full Text].
|
| 46.
|
Merino, S.,
M. M. Nogueras,
A. Aguilar,
X. Rubires,
S. Alberti,
V. J. Benedi, and J. M. Tomas.
1998.
Activation of the complement classical pathway (C1q binding) by mesophilic Aeromonas hydrophila outer membrane protein.
Infect. Immun.
66:3825-3831[Abstract/Free Full Text].
|
| 47.
|
Merino, S.,
X. Rubires,
S. Knochel, and J. M. Tomas.
1995.
Emerging pathogens: Aeromonas spp.
Int. J. Food Microbiol.
28:157-168[CrossRef][Medline].
|
| 48.
|
Merino, S.,
X. Rubires,
A. Aguilar,
S. Alberti,
S. Hernandez-Alles,
V. J. Benedi, and J. M. Tomas.
1996.
Mesophilic Aeromonas sp. serogroup O:11 resistance to complement-mediated killing.
Infect. Immun.
64:5302-5309[Abstract].
|
| 49.
|
Mulin, J. M., and K. V. Snock.
1990.
Effect of tumor necrosis factor on epithelial tight junctions and transepithelial permeability.
Cancer Res.
50:2172-2176[Abstract/Free Full Text].
|
| 50.
|
Parker, M. W.,
F. G. van der Goot, and J. T. Buckley.
1996.
Aerolysin the ins and outs of a channel forming protein.
Mol. Microbiol.
19:205-212[CrossRef][Medline].
|
| 51.
|
Peitsch, M. C.,
C. Borner, and J. Tschopp.
1993.
Sequence similarity of phospholipase A2-activating protein and the G -subunits: a new concept of effector protein activation in signal transduction.
Trends Biochem. Sci.
18:292-293[CrossRef][Medline].
|
| 52.
|
Pemberton, J. M.,
S. P. Kidd, and R. Schmidt.
1997.
Secreted enzymes of Aeromonas.
FEMS Microbiol. Lett.
152:1-10[CrossRef][Medline].
|
| 53.
|
Peterson, J. W., and L. Ochoa.
1989.
Role of prostaglandins and cAMP in the secretory effects of cholera toxin.
Science
245:857-859[Abstract/Free Full Text].
|
| 54.
|
Peterson, J. W.,
S. S. Saini,
W. D. Dickey,
G. R. Klimpel,
J. S. Bomalaski,
M. A. Clark,
X. J. Xu, and A. K. Chopra.
1996.
Cholera toxin induces synthesis of phospholipase A2-activating protein.
Infect. Immun.
64:2137-2143[Abstract].
|
| 55.
|
Potomski, J.,
V. Burke,
J. Robinson,
D. Fumarola, and G. Miragliotta.
1987.
Aeromonas cytotonic enterotoxin cross-reactive with cholera toxin.
J. Med. Microbiol.
13:179-186.
|
| 56.
|
Potomski, J.,
V. Burke,
I. Watson, and M. Gracey.
1987.
Purification of cytotoxic enterotoxin of Aeromonas sobria by use of monoclonal antibodies.
J. Med. Microbiol.
23:171-177[Abstract/Free Full Text].
|
| 57.
|
Pugazhenthi, S.,
E. Miller,
C. Sable,
P. Young,
K. A. Heidenreich,
L. M. Boxer, and J. E. B. Reusch.
1999.
Insulin-like growth factor-1 induces bcl-2 promoter through the transcription factor cAMP-response element binding protein.
J. Biol. Chem.
274:27529-27535[Abstract/Free Full Text].
|
| 58.
|
Rose, J. M.,
C. W. Houston,
D. H. Coppenhaver,
J. D. Dixon, and A. Kurosky.
1989.
Purification and chemical characterization of a cholera toxin-cross-reactive cytolytic enterotoxin produced by a human isolate of Aeromonas hydrophila.
Infect. Immun.
57:1165-1169[Abstract/Free Full Text].
|
| 59.
|
Rose, J. M.,
C. W. Houston, and A. Kursoky.
1989.
Bioactivity and immunological characterization of a cholera toxin-cross-reactive cytolytic enterotoxin from Aeromonas hydrophila.
Infect. Immun.
57:1170-1176[Abstract/Free Full Text].
|
| 60.
|
Rossjohn, J.,
R. J. Gilbert,
D. Crane,
P. J. Morgan,
T. J. Mitchell,
A. J. Rowe,
P. W. Andrew,
J. C. Paton,
R. K. Tweten, and M. W. Parker.
1998.
The molecular mechanism of pneumolysin, a virulence factor from Streptococcus pneumoniae.
J. Mol. Biol.
284:449-461[CrossRef][Medline].
|
| 61.
|
Saini, S. S.,
A. K. Chopra, and J. W. Peterson.
1999.
Melittin activates endogenous phospholipase D during cytolysis of human monocytic leukemia cells.
Toxicon
37:1605-1619[Medline].
|
| 62.
|
Saini, S. S.,
J. W. Peterson, and A. K. Chopra.
1997.
Melittin binds to secretory phospholipase A2 and inhibits its enzymatic activity.
Biophys. Biochem. Res. Commun.
238:436-442.
|
| 63.
|
Shenkar, R., and E. Abraham.
1999.
Mechanisms of lung neutrophil activation after hemorrhage or endotoxemia: roles of reactive oxygen intermediates, NF- B, and cyclic AMP response element binding protein.
J. Immunol.
163:954-962[Abstract/Free Full Text].
|
| 64.
|
Taylor, C. T.,
N. Fueki,
A. Agah,
R. M. Hershberg, and S. P. Colgan.
1999.
Critical role of cAMP response element binding protein expression in hypoxia-elicited induction of epithelial tumor necrosis factor- .
J. Biol. Chem.
274:19447-19454[Abstract/Free Full Text].
|
| 65.
|
Tesh, V. L.,
B. Ramegowda, and J. E. Samuel.
1994.
Purified Shiga-like toxins induce expression of proinflammatory cytokines from murine peritoneal macrophages.
Infect. Immun.
62:5085-5094[Abstract/Free Full Text].
|
| 66.
|
Wadstrom, T.,
A. Ljungh, and B. Wretlind.
1976.
Enterotoxin, haemolysin and cytotoxic protein in Aeromonas hydrophila from human infections.
Acta Pathol. Microbiol. Scand. Sect. B
84:112-114[Medline].
|
| 67.
|
Wang, Z., and H. H. Tai.
1999.
Cyclic AMP response element mediates dexamethasone induced suppression of prostaglandin H synthase-2 gene expression in human amnion derived WISH cells.
Prostaglandins Leuko. Essent. Fatty Acids
60:243-248[CrossRef][Medline].
|
| 68.
|
Xie, Q. W.,
Y. Kashiwabara, and C. Nathan.
1994.
Role of transcription factor NF- B/Rel in induction of nitric oxide synthase.
J. Biol. Chem.
269:4705-4708[Abstract/Free Full Text].
|
| 69.
|
Xu, X. J.,
M. R. Ferguson,
V. L. Popov,
C. W. Houston,
J. W. Peterson, and A. K. Chopra.
1998.
Role of a cytotoxic enterotoxin in Aeromonas-mediated infections: development of transposon and isogenic mutants.
Infect. Immun.
66:3501-3509[Abstract/Free Full Text].
|
| 70.
|
Yamada, S.,
S. Matsushita,
S. Dejsirilet, and Y. Kudoh.
1997.
Incidence and clinical symptoms of Aeromonas-associated travellers' diarrhoea in Tokyo.
Epidemiol. Infect.
119:121-126[CrossRef][Medline].
|
| 71.
|
Zhang, Y.,
J. Lemasters, and B. Herman.
1999.
Secretory group IIA phospholipase A2 generates anti-apoptotic survival signals in kidney fibroblasts.
J. Biol. Chem.
274:27726-27733[Abstract/Free Full Text].
|
Infection and Immunity, May 2000, p. 2808-2818, Vol. 68, No. 5
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Fujii, Y., Tsurumi, K., Sato, M., Takahashi, E., Okamoto, K.
(2008). Fluid Secretion Caused by Aerolysin-Like Hemolysin of Aeromonas sobria in the Intestines Is Due to Stimulation of Production of Prostaglandin E2 via Cyclooxygenase 2 by Intestinal Cells. Infect. Immun.
76: 1076-1082
[Abstract]
[Full Text]
-
Rahman, M., Huys, G., Rahman, M., Albert, M. J., Kuhn, I., Mollby, R.
(2007). Persistence, Transmission, and Virulence Characteristics of Aeromonas Strains in a Duckweed Aquaculture-Based Hospital Sewage Water Recycling Plant in Bangladesh. Appl. Environ. Microbiol.
73: 1444-1451
[Abstract]
[Full Text]
-
Kirschnek, S., Gulbins, E.
(2006). Phospholipase A2 Functions in Pseudomonas aeruginosa- Induced Apoptosis. Infect. Immun.
74: 850-860
[Abstract]
[Full Text]
-
Galindo, C. L., Fadl, A. A., Sha, J., Pillai, L., Gutierrez, C. Jr., Chopra, A. K.
(2005). Microarray and Proteomics Analyses of Human Intestinal Epithelial Cells Treated with the Aeromonas hydrophila Cytotoxic Enterotoxin. Infect. Immun.
73: 2628-2643
[Abstract]
[Full Text]
-
Galindo, C. L., Fadl, A. A., Sha, J., Gutierrez, C. Jr., Popov, V. L., Boldogh, I., Aggarwal, B. B., Chopra, A. K.
(2004). Aeromonas hydrophila Cytotoxic Enterotoxin Activates Mitogen-activated Protein Kinases and Induces Apoptosis in Murine Macrophages and Human Intestinal Epithelial Cells. J. Biol. Chem.
279: 37597-37612
[Abstract]
[Full Text]
-
Galindo, C. L., Fadl, A. A., Sha, J., Chopra, A. K.
(2004). Microarray Analysis of Aeromonas hydrophila Cytotoxic Enterotoxin-Treated Murine Primary Macrophages. Infect. Immun.
72: 5439-5445
[Abstract]
[Full Text]
-
Sha, J., Fadl, A. A., Klimpel, G. R., Niesel, D. W., Popov, V. L., Chopra, A. K.
(2004). The Two Murein Lipoproteins of Salmonella enterica Serovar Typhimurium Contribute to the Virulence of the Organism. Infect. Immun.
72: 3987-4003
[Abstract]
[Full Text]
-
Sinha, S., Shimada, T., Ramamurthy, T., Bhattacharya, S. K., Yamasaki, S., Takeda, Y., Nair, G. B.
(2004). Prevalence, serotype distribution, antibiotic susceptibility and genetic profiles of mesophilic Aeromonas species isolated from hospitalized diarrhoeal cases in Kolkata, India. J Med Microbiol
53: 527-534
[Abstract]
[Full Text]
-
Sha, J., Kozlova, E. V., Fadl, A. A., Olano, J. P., Houston, C. W., Peterson, J. W., Chopra, A. K.
(2004). Molecular Characterization of a Glucose-Inhibited Division Gene, gidA, That Regulates Cytotoxic Enterotoxin of Aeromonas hydrophila. Infect. Immun.
72: 1084-1095
[Abstract]
[Full Text]
-
Stassen, M., Muller, C., Richter, C., Neudorfl, C., Hultner, L., Bhakdi, S., Walev, I., Schmitt, E.
(2003). The Streptococcal Exotoxin Streptolysin O Activates Mast Cells To Produce Tumor Necrosis Factor Alpha by p38 Mitogen-Activated Protein Kinase- and Protein Kinase C-Dependent Pathways. Infect. Immun.
71: 6171-6177
[Abstract]
[Full Text]
-
Galindo, C. L., Sha, J., Ribardo, D. A., Fadl, A. A., Pillai, L., Chopra, A. K.
(2003). Identification of Aeromonas hydrophila Cytotoxic Enterotoxin-induced Genes in Macrophages Using Microarrays. J. Biol. Chem.
278: 40198-40212
[Abstract]
[Full Text]
-
Sha, J., Kozlova, E. V., Chopra, A. K.
(2002). Role of Various Enterotoxins in Aeromonas hydrophila-Induced Gastroenteritis: Generation of Enterotoxin Gene-Deficient Mutants and Evaluation of Their Enterotoxic Activity. Infect. Immun.
70: 1924-1935
[Abstract]
[Full Text]
-
Sha, J., Lu, M., Chopra, A. K.
(2001). Regulation of the Cytotoxic Enterotoxin Gene in Aeromonas hydrophila: Characterization of an Iron Uptake Regulator. Infect. Immun.
69: 6370-6381
[Abstract]
[Full Text]
-
Albert, M. J., Ansaruzzaman, M., Talukder, K. A., Chopra, A. K., Kuhn, I., Rahman, M., Faruque, A. S. G., Islam, M. S., Sack, R. B., Mollby, R.
(2000). Prevalence of Enterotoxin Genes in Aeromonas spp. Isolated From Children with Diarrhea, Healthy Controls, and the Environment. J. Clin. Microbiol.
38: 3785-3790
[Abstract]
[Full Text]
-
Ribardo, D. A., Crowe, S. E., Kuhl, K. R., Peterson, J. W., Chopra, A. K.
(2001). Prostaglandin Levels in Stimulated Macrophages Are Controlled by Phospholipase A2-activating Protein and by Activation of Phospholipase C and D. J. Biol. Chem.
276: 5467-5475
[Abstract]
[Full Text]