TEXT

Top Abstract Text References

Haemophilus influenzae is a gram-negative bacterium that is responsible for significant morbidity and mortality in young children (4, 20). Under normal growth conditions H. influenzae needs two essential growth factors: NAD and hemin (2). Hemin can serve as a source of both iron and porphyrin, and protoporphyrin IX (PPIX) can substitute for hemin if exogenous iron is available (5, 21). The activity of a putative ferrochelatase was found in whole-cell extracts of H. influenzae (11), indicating that Fe²⁺ and PPIX are chelated into heme. Iron-citrate or ferric ions can be utilized by an uptake system, which was found to be encoded by the genes hitABC (18). Since free iron is limited under in vivo conditions and no siderophores are synthesized, H. influenzae has evolved strategies to scavenge host iron-binding proteins as sources of iron (19). Human transferrin has been shown, for example, to be a suitable substrate and is specifically recognized by two outer-membrane-located receptor proteins encoded by tbpAB (6). Free hemin or PPIX may also be utilized by H. influenzae if it is present in growth media, and they are also scavenged from hemin-containing host proteins by specific hemopexin- and hemoglobin- or haptoglobin-binding protein complexes (1, 7-9, 12, 13, 16, 22).

H. influenzae has only a rudimentary hemin biosynthetic pathway, in which no other enzymes except that encoded by the hemH homologue are known to exist. In this study, we establish that the hemH gene identified by Fleischmann et al. (3) and designated HI1160 encodes a ferrochelatase and that defined mutations in the gene region corresponding to hemH confer a profound growth phenotype.

Construction of hemH mutants. Utilizing the genome sequence provided by Fleischmann et al. (3) (http://www.tigr.org), hemH (HI1160) was PCR amplified from H. influenzae strain Rd chromosomal DNA with oligonucleotides containing flanking EcoRV restriction sites, i.e., hemH1 (AAGATATCAGTGGATCATCGTACTATGC) and hemH2 (AAGATATCGCTGATTTTAGCAAAGTGCG) (synthesized by MWG-Biotech, Ebersberg, Germany). The resulting 1,315-bp product of HI1160 (Fig. 1A) was cleaved with EcoRV and subcloned into HincII- and FspI-linearized pACYC177 (17), resulting in plasmid pMR1 (Fig. 1A). A PCR-generated chloramphenicol acetyltransferase-encoding gene (cat) with flanking PstI restriction sites (10) was inserted into a unique PstI site, resulting in pMR2 (Fig. 1B). An 837-bp segment of the 5' hemH sequence was deleted by PCR amplification of pMR2 with oligonucleotides del1BglII (GAAGATCTCAGGCGTTTAAGGGCACC) and del2BglII (GAAGATCTTTTGCCAAACTTGGATATT), containing flanking BglII restriction sites. Subsequent ligation of the BglII sites resulted in plasmid pMR3 (Fig. 1C). The hemH:: cat gene from pMR2 and the 'hemH(837)::cat gene from pMR3 were amplified again by PCR, using oligonucleotides hemH1 and hemH2, and the DNA fragments were retransformed into H. influenzae strain Rd and H. influenzae type b strain Eagan (Hib), respectively. Chloramphenicol-resistant (Cm^r) colonies were obtained on brain heart infusion (BHI) agar (Difco Laboratories, Detroit, Mich.) supplemented with hemin (20 µg/ml) (Sigma), NAD (10 µg/ml) (Sigma), and chloramphenicol (2 µg/ml) (Sigma). Transformants were designated SCH01 (Rd hemH::cat) and SCH02 [Hib; hemH(837)::cat]. Correct gene replacement in both strains was verified by PCR (Fig. 1D) and Southern blot analysis (data not shown).

View larger version (21K): [in this window] [in a new window]   FIG. 1.   Cloning of hemH and construction of hemH mutants. (A) Cloning of hemH PCR product, containing flanking EcoRV restriction sites, into a HincII- and FspI-linearized pACYC177 plasmid. (B) pMR1 was digested with PstI, and cat was ligated into hemH. (C) Plasmid pMR3 was derived from pMR2 by deletion of the 5' end of hemH (see text). Antibiotic markers and relevant restriction sites are indicated. The hemH gene (hatched arrows), chloramphenicol resistance gene (cat) (light arrows), and kanamycin resistance marker (Kan) (black arrows) are shown. (D) A 0.7% agarose gel with PCR-generated fragments obtained by using oligonucleotides hemH1 and hemH2 and purified chromosomal DNAs of H. influenzae strains Hib (lane 2), SCH01 (lane 3), and SCH02 (lane 4). Lane 1, 1-kbp standard (Gibco Life Technologies).

Characterization of hemH growth phenotypes. Strains SCH01 and SCH02 were tested for their abilities to grow on PPIX- or hemin-supplemented BHI medium. Both hemH mutants failed to grow on medium supplemented with PPIX (20 µg/ml) (Sigma) but grew well on medium containing hemin (20 µg/ml) (Table 1). Complementation of both strains with plasmid pMR1 resulted in growth of both strains on PPIX-containing medium (Table 1), indicating that hemH was responsible for utilization of PPIX. We further tested the ability of strain SCH01 to grow on hemin as an intracellular iron source. To establish iron-limiting conditions, BHI medium was supplemented with the iron chelator deferoxamine mesylate (DFX) (Sigma), which preferentially chelates extracellular iron. We observed no growth of the wild-type (wt) Rd strain on BHI medium with PPIX (20 µg/ml) supplemented with DFX (0.08 mM), indicating that under these conditions no iron source was available for hemin biosynthesis (Table 1). With hemin instead of PPIX, both the wt Rd and the hemH mutant SCH01 could grow in the presence of DFX. This finding demonstrates that both strains can utilize hemin as an iron source and that if HemH could release iron from hemin, as has previously been suggested (11), then an additional cytoplasmic hemin-utilizing and iron liberation system must coexist with hemH.