Previous Article | Next Article ![]()
Infection and Immunity, May 2000, p. 3007-3009, Vol. 68, No. 5
Zentrum für Infektionsforschung,
Universität Würzburg, 97070 Würzburg,
Germany,1 and Department of
Paediatrics, John Radcliffe Hospital, Headington, Oxford OX3 9DU,
United Kingdom2
Received 7 October 1999/Returned for modification 22 November
1999/Accepted 11 January 2000
Haemophilus influenzae lacks most of the biosynthetic
enzymes for hemin synthesis. However, the organism has retained
ferrochelatase activity, which we identified to be encoded by a
hemH-homologous gene. In this report we characterize the
growth physiology conferred by hemH mutations under
infection and laboratory conditions.
Haemophilus influenzae is
a gram-negative bacterium that is responsible for significant morbidity
and mortality in young children (4, 20). Under normal growth
conditions H. influenzae needs two essential growth factors:
NAD and hemin (2). Hemin can serve as a source of both iron
and porphyrin, and protoporphyrin IX (PPIX) can substitute for hemin if
exogenous iron is available (5, 21). The activity of a
putative ferrochelatase was found in whole-cell extracts of H. influenzae (11), indicating that Fe2+ and
PPIX are chelated into heme. Iron-citrate or ferric ions can be
utilized by an uptake system, which was found to be encoded by the
genes hitABC (18). Since free iron is limited
under in vivo conditions and no siderophores are synthesized, H. influenzae has evolved strategies to scavenge host iron-binding
proteins as sources of iron (19). Human transferrin has been
shown, for example, to be a suitable substrate and is specifically
recognized by two outer-membrane-located receptor proteins encoded by
tbpAB (6). Free hemin or PPIX may also be
utilized by H. influenzae if it is present in growth media,
and they are also scavenged from hemin-containing host proteins by
specific hemopexin- and hemoglobin- or haptoglobin-binding protein
complexes (1, 7-9, 12, 13, 16, 22).
H. influenzae has only a rudimentary hemin biosynthetic
pathway, in which no other enzymes except that encoded by the
hemH homologue are known to exist. In this study, we
establish that the hemH gene identified by Fleischmann et
al. (3) and designated HI1160 encodes a ferrochelatase and
that defined mutations in the gene region corresponding to
hemH confer a profound growth phenotype.
Construction of hemH mutants.
Utilizing the genome
sequence provided by Fleischmann et al. (3)
(http://www.tigr.org), hemH (HI1160) was PCR amplified from H. influenzae strain Rd chromosomal DNA with
oligonucleotides containing flanking EcoRV restriction
sites, i.e., hemH1 (AAGATATCAGTGGATCATCGTACTATGC) and
hemH2 (AAGATATCGCTGATTTTAGCAAAGTGCG) (synthesized by
MWG-Biotech, Ebersberg, Germany). The resulting 1,315-bp product of
HI1160 (Fig. 1A) was cleaved with
EcoRV and subcloned into HincII- and FspI-linearized pACYC177 (17), resulting in
plasmid pMR1 (Fig. 1A). A PCR-generated chloramphenicol
acetyltransferase-encoding gene (cat) with flanking
PstI restriction sites (10) was inserted into a
unique PstI site, resulting in pMR2 (Fig. 1B). An 837-bp segment of the 5' hemH sequence was deleted by PCR
amplification of pMR2 with oligonucleotides del1BglII
(GAAGATCTCAGGCGTTTAAGGGCACC) and del2BglII
(GAAGATCTTTTGCCAAACTTGGATATT), containing flanking BglII restriction sites. Subsequent ligation of the
BglII sites resulted in plasmid pMR3 (Fig. 1C). The
hemH:: cat gene from pMR2 and the
'hemH(
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Characterization of Ferrochelatase
(hemH) Mutations in Haemophilus
influenzae
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References
837)::cat gene
from pMR3 were amplified again by PCR, using oligonucleotides
hemH1 and hemH2, and the DNA fragments were retransformed into H. influenzae strain Rd and H. influenzae type b strain
Eagan (Hib), respectively. Chloramphenicol-resistant (Cmr)
colonies were obtained on brain heart infusion (BHI) agar (Difco Laboratories, Detroit, Mich.) supplemented with hemin (20 µg/ml) (Sigma), NAD (10 µg/ml) (Sigma), and chloramphenicol (2 µg/ml) (Sigma). Transformants were designated SCH01
(Rd hemH::cat) and SCH02 [Hib;
hemH(
837)::cat]. Correct
gene replacement in both strains was verified by PCR (Fig. 1D) and
Southern blot analysis (data not shown).

View larger version (21K):
[in a new window]
FIG. 1.
Cloning of hemH and construction of
hemH mutants. (A) Cloning of hemH PCR product,
containing flanking EcoRV restriction sites, into a
HincII- and FspI-linearized pACYC177 plasmid. (B)
pMR1 was digested with PstI, and cat was ligated
into hemH. (C) Plasmid pMR3 was derived from pMR2 by
deletion of the 5' end of hemH (see text). Antibiotic
markers and relevant restriction sites are indicated. The
hemH gene (hatched arrows), chloramphenicol resistance gene
(cat) (light arrows), and kanamycin resistance marker (Kan)
(black arrows) are shown. (D) A 0.7% agarose gel with PCR-generated
fragments obtained by using oligonucleotides hemH1 and hemH2 and
purified chromosomal DNAs of H. influenzae strains Hib (lane
2), SCH01 (lane 3), and SCH02 (lane 4). Lane 1, 1-kbp standard (Gibco
Life Technologies).
Characterization of hemH growth phenotypes.
Strains SCH01 and SCH02 were tested for their abilities to grow
on PPIX- or hemin-supplemented BHI medium. Both hemH mutants failed to grow on medium supplemented with PPIX (20 µg/ml) (Sigma) but grew well on medium containing hemin (20 µg/ml) (Table
1). Complementation of both strains with
plasmid pMR1 resulted in growth of both strains on
PPIX-containing medium (Table 1), indicating that hemH was
responsible for utilization of PPIX. We further tested the ability of
strain SCH01 to grow on hemin as an intracellular iron source. To
establish iron-limiting conditions, BHI medium was supplemented with
the iron chelator deferoxamine mesylate (DFX) (Sigma), which
preferentially chelates extracellular iron. We observed no growth
of the wild-type (wt) Rd strain on BHI medium with PPIX (20 µg/ml)
supplemented with DFX (0.08 mM), indicating that under these conditions
no iron source was available for hemin biosynthesis (Table 1). With
hemin instead of PPIX, both the wt Rd and the hemH mutant
SCH01 could grow in the presence of DFX. This finding demonstrates that
both strains can utilize hemin as an iron source and that if HemH could
release iron from hemin, as has previously been suggested
(11), then an additional cytoplasmic hemin-utilizing and
iron liberation system must coexist with hemH.
|
| |
ACKNOWLEDGMENTS |
|---|
This work was funded by BMBF grant 01KI8906.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Zentrum für Infektionsforschung, Universität Würzburg, Röntgenring 11, 97070 Würzburg, Germany. Phone: (49) 931 312153. Fax: (49) 931 312578. E-mail: joachim.reidl{at}mail.uni-wuerzburg.de.
Editor: J. T. Barbieri
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Cope, L. D.,
R. Yogev,
U. Muller-Eberhard, and E. J. Hansen.
1995.
A gene cluster involved in the utilization of both free heme and heme:hemopexin by Haemophilus influenzae type b.
J. Bacteriol.
177:2644-2653 |
| 2. | Evans, N. M., D. D. Smith, and A. J. Wicken. 1974. Hemin and nicotinamide adenine dinucleotide requirements of Haemophilus influenzae. J. Med. Microbiol. 7:359-365[Medline]. |
| 3. |
Fleischmann, R. D.,
M. D. Adams,
O. White,
R. A. Clayton,
E. F. Kirkness,
A. R. Kerlavage,
C. J. Bult,
J. F. Tomb,
B. A. Dougherty,
J. M. Merrick,
K. McKenney,
G. Sutton,
W. FitzHugh,
C. Fields,
J. D. Gocayne,
J. Scott,
R. Shirley,
L. I. Liu,
A. Glodek,
J. M. Kelley,
J. F. Weidman,
C. A. Phillips,
T. Spriggs,
E. Hedblom,
M. D. Cotton,
T. R. Utterback,
M. C. Hanna,
D. T. Nguyen,
D. M. Saudek,
R. C. Brandon,
L. D. Fine,
J. L. Frichman,
J. L. Fuhrmann,
N. S. M. Geoghagen,
C. L. Gnehm,
L. A. McDonald,
K. V. Small,
C. M. Fraser,
H. O. Smith, and J. C. Venter.
1995.
Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.
Science
269:496-512 |
| 4. | Funkhouser, A., M. C. Steinhoff, and J. Ward. 1991. Haemophilus influenzae disease and immunization in developing countries. Rev. Infect. Dis. 13:542-554. |
| 5. |
Granick, S., and H. Gilder.
1946.
The porphyrin requirements of Haemophilus influenzae and some functions of the vinyl and propionic acid chains of heme.
J. Gen. Physiol.
30:1-13 |
| 6. | Gray-Owen, S. D., S. Loosmore, and A. B. Schryvers. 1995. Identification and characterization of genes encoding the human transferrin-binding proteins from Haemophilus influenzae. Infect. Immun. 63:1201-1210[Abstract]. |
| 7. |
Hanson, M. S.,
S. E. Pelzel,
J. Latimer,
U. Muller-Eberhard, and E. J. Hansen.
1992.
Identification of a genetic locus of Haemophilus influenzae type b necessary for the binding and utilization of heme bound to human hemopexin.
Proc. Natl. Acad. Sci. USA
89:1973-1977 |
| 8. | Jin, H., Z. Ren, J. M. Pozsgay, C. Elkins, P. W. Whitby, D. J. Morton, and T. L. Stull. 1996. Cloning of a DNA fragment encoding a heme-repressible hemoglobin-binding outer membrane protein from Haemophilus influenzae. Infect. Immun. 64:3134-3141[Abstract]. |
| 9. | Jin, H., Z. Ren, P. W. Whitby, D. J. Morton, and T. L. Stull. 1999. Characterization of hgpA, a gene encoding a haemoglobin/haemoglobin-haptoglobin-binding protein of Haemophilus influenzae. Microbiology 145:905-914[Abstract]. |
| 10. |
Kraiß, A.,
S. Schlör, and J. Reidl.
1998.
In vivo transposon mutagenesis in Haemophilus influenzae.
Appl. Environ. Microbiol.
64:4697-4702 |
| 11. |
Loeb, M.
1995.
Ferrochelatase activity and protoporphyrin IX utilization in Haemophilus influenzae.
J. Bacteriol.
177:3613-3615 |
| 12. | Maciver, I., L. J. L., H. H. Liem, U. Muller-Eberhard, Z. Hrkal, and E. J. Hansen. 1996. Identification of an outer membrane protein involved in utilization of hemoglobin-haptoglobin complexes by nontypeable Haemophilus influenzae. Infect. Immun. 64:3703-3712[Abstract]. |
| 13. |
Morton, D. J.,
P. W. Whitby,
H. Jin,
Z. Ren, and T. L. Stull.
1999.
Effect of multiple mutations in the hemoglobin- and hemoglobin-haptoglobin-binding proteins, HgpA, HgpB, and HgpC, of Haemophilus influenzae type b.
Infect. Immun.
67:2729-2739 |
| 14. | Moxon, E., M. Glode, A. Sutton, and J. Robbins. 1977. The infant rat model of bacterial meningitis. J. Infect. Dis. 136:186-190. |
| 15. | Moxon, E. R., A. L. Smith, D. R. Averill, and D. H. Smith. 1974. Haemophilus influenzae menigitis in infant rats after intranasal inoculation. J. Infect. Dis. 129:154-162[Medline]. |
| 16. |
Ren, Z.,
H. Jin,
D. J. Morton, and T. L. Stull.
1998.
hgpB, a gene encoding a second Haemophilus influenzae hemoglobin- and hemoglobin-haptoglobin-binding protein.
Infect. Immun.
66:4733-4741 |
| 17. |
Rose, R. E.
1988.
The nucleotide sequence of pACYC177.
Nucleic Acids Res.
16:356 |
| 18. |
Sanders, J. D.,
L. D. Cope, and E. J. Hansen.
1994.
Identification of a locus involved in the utilization of iron by Haemophilus influenzae.
Infect. Immun.
62:4515-4525 |
| 19. | Schryvers, A. B., and S. Gray-Owen. 1992. Iron acquisition in Haemophilus influenzae: receptor for human transferrin. J. Infect. Dis. 165:103-104. |
| 20. | Truk, D. C. 1984. The pathogenicity of Haemophilus influenzae. J. Med. Microbiol. 18:1-16[Medline]. |
| 21. |
White, D. C., and S. Granick.
1963.
Hemin biosynthesis in Haemophilus.
J. Bacteriol.
85:842-850 |
| 22. | Wong, J. C. Y., R. Patel, D. Kendall, P. W. Whitby, A. Smith, J. Holland, and P. Williams. 1995. Affinity, conservation, and surface exposure of hemopexin-binding proteins in Haemophilus influenzae. Infect. Immun. 63:2327-2333[Abstract]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|