Infection and Immunity, June 2000, p. 3193-3199, Vol. 68, No. 6
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Departments of Medicine and Microbiology and Immunology, Vanderbilt University School of Medicine,1 and Veterans Affairs Medical Center,2 Nashville, Tennessee
Received 13 December 1999/Returned for modification 10 February 2000/Accepted 24 February 2000
| |
ABSTRACT |
|---|
|
|
|---|
Individual bacteria of numerous species can communicate and
coordinate their actions via the production, release, and detection of
extracellular signaling molecules. In this study, we used the Vibrio harveyi luminescence bioassay to determine whether
Helicobacter pylori produces such a factor. Cell-free
conditioned media from H. pylori strains 60190 and 26695 each induced >100-fold-greater luminescence in V. harveyi
than did sterile culture medium. The H. pylori signaling
molecule had a molecular mass of <10 kDa, and its activity was
unaffected by heating to 80°C for 5 min or protease treatment. The
genome sequence of H. pylori 26695 does not contain any
gene predicted to encode an acyl homoserine lactone synthase but does
contain an orthologue of luxS, which is required for
production of autoinducer-2 (AI-2) in V. harveyi. To
evaluate the role of luxS in H. pylori, we
constructed luxS null mutants derived from H. pylori 60190 and 26695. Conditioned media from the wild-type
H. pylori strains induced >100-fold-greater luminescence in the V. harveyi bioassay than did conditioned medium from
either mutant strain. Production of the signaling molecule was restored in an H. pylori luxS null mutant strain by complementation
with a single intact copy of luxS placed in a heterologous
site on the chromosome. In addition, Escherichia coli
DH5
produced autoinducer activity following the introduction of an
intact copy of luxS from H. pylori. Production
of the signaling molecule by H. pylori was growth phase
dependent, with maximal production occurring in the mid-exponential
phase of growth. Transcription of H. pylori vacA also was
growth phase dependent, but this phenomenon was not dependent on
luxS activity. These data indicate that H. pylori produces an extracellular signaling molecule related to
AI-2 from V. harveyi. We speculate that this signaling
molecule may play a role in regulating H. pylori gene expression.
| |
INTRODUCTION |
|---|
|
|
|---|
In the past decade, there has been considerable progress in our understanding of intercellular communication among bacteria. In one form of intercellular communication, termed quorum sensing, bacteria release extracellular signaling molecules (autoinducers), which accumulate as the population grows. When the extracellular signaling molecule reaches a critical threshold concentration, a signal transduction cascade is triggered within each cell of the population, the final result being an alteration in gene expression (for reviews, see references 15, 19, and 21). This altered pattern of gene expression presumably increases the capacity of bacteria to survive environmental changes that accompany increased cell density. In various bacterial species, autoinducer-mediated regulation of gene expression controls diverse processes, including sporulation (27), genetic competence (2, 28), antibiotic synthesis (40), alternative sigma factor synthesis (26), the production of virulence determinants (11, 22, 48), and even the production of other quorum-sensing molecules (35).
One of the best studied of the autoinducer-controlled gene expression systems is the density-dependent bioluminescence of marine vibrios (Vibrio fischeri and V. harveyi). V. fischeri exists free in seawater, as well as in a symbiotic relationship within the light organ of squid (38). V. fischeri produces and releases an N-acyl homoserine lactone (AHL) signaling molecule. Transcription of the luciferase operon (luxCDABEGH) of V. fischeri is repressed in the absence of a threshold level of AHL. When cell density, and hence AHL level, reaches a threshold concentration, the LuxR regulator is inactivated, and bioluminescence occurs (6). Many gram-negative bacterial species produce related AHL molecules, but the AHL-mediated quorum-sensing systems are typically quite species specific. The production of AHL molecules in gram-negative bacteria is catalyzed by AHL synthases, which are usually encoded by luxI orthologues.
V. harveyi, a free-living marine bacterium, produces two different quorum-sensing molecules, designated autoinducer-1 (AI-1) and AI-2, which are each capable of regulating luciferase activity. V. harveyi AI-1 has been identified as hydroxybutanoyl-L-homoserine lactone (13). The chemical structure of the second signaling molecule (AI-2) is not known, but the luxS gene is required for its production (44). The presence of AI-2 is detected by a sensory histidine kinase (encoded by luxQ) located within the cytoplasmic membrane of V. harveyi (6). Many strains of Escherichia coli and Salmonella enterica serovar Typhimurium contain luxS orthologues and produce autoinducer molecules that are functionally similar to V. harveyi AI-2 (42-44). Surette et al. (44) have noted that luxS orthologues are present in many additional bacterial species and have suggested that many of these species may produce extracellular signaling molecules.
Helicobacter pylori is a curved, gram-negative bacterium found associated with the gastric epithelium of humans and other primates. Colonization of the human stomach with H. pylori consistently results in the development of gastric mucosal inflammation and is a risk factor for the development of peptic ulcer disease and gastric adenocarcinoma (10, 14, 25, 33). In the present report, we describe the production of an extracellular signaling molecule by H. pylori and report that H. pylori luxS is essential for this activity.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Bacteria and culture conditions.
Wild-type H. pylori strains and all mutant strains used in this study are
listed in Table 1. H. pylori
strains were routinely cultured at 37°C in ambient air containing 5%
CO2. V. harveyi BB152
(luxL::Tn5) is capable of producing
AI-2 but not AI-1, and strain BB170
(luxN::Tn5) is capable of sensing AI-2
but not AI-1 (7, 42). V. harveyi strains were
grown at 25°C on Luria-marine agar plates (5) or in
autoinducer bioassay (AB) medium (20). V. harveyi
strains were kind gifts of B. Bassler (Princeton University).
|
Generation of cell-free CM and V. harveyi
luminescence bioassay.
H. pylori strains were cultured in
brucella broth supplemented with either 5% fetal bovine serum (FBS) or
0.5% charcoal (12). Cell density was monitored by readings
of optical density at 600 nm (OD600). Cell-free conditioned
media (CM) were prepared by centrifuging H. pylori cultures
at 8,000 × g followed by filtration of the supernatant
through 0.2-µm-pore-size filters. CM preparations were routinely
stored frozen at
70°C. CM preparations from V. harveyi
strains were prepared in the same manner, except that the cells were
cultured in AB medium at 25°C.
Molecular biology techniques. Extraction of H. pylori genomic DNA, cloning, plasmid preparation, restriction enzyme digestion, repair of 5' and 3' overhangs, and PCR protocols were performed essentially as previously described elsewhere (4, 17, 18).
Generation of H. pylori luxS null mutants. luxS from H. pylori 26695 genomic DNA was amplified using primers 5' GCGGACATTGTGGCACATAGCGGC and 5' CTATTGCCTTGCAACAAATCCCCGC, which were derived from the sequence of H. pylori 26695 (46). The 1,490-bp amplicon was cloned into pGEM-T (Promega). The chloramphenicol acetyltransferase (CAT) gene from Campylobacter coli (47) was ligated into the unique XcmI site within the cloned H. pylori 26695 luxS sequence. Disruption of the chromosomal luxS gene in H. pylori 26695 or 60190 was accomplished by natural transformation, allelic exchange, and screening for chloramphenicol-resistant H. pylori clones as previously described (17). The resulting luxS mutant strains derived from H. pylori 26695 and 60190 were designated L26-1 and L60-1, respectively. PCR analysis of genomic DNA indicated the orientation of the CAT cassettes and demonstrated that a double-crossover event had occurred in each mutant (data not shown). To assay for the presence of intracellular autoinducer, luxS H. pylori cells were disrupted by sonication (Virsonic 60; Virtis Company, Gardiner, N.Y.), using three 30-s pulses on ice with 1-min cooling intervals between pulses. The membrane fraction was removed by centrifugation at 10,000 × g for 30 min, and the resulting cytoplasmic fraction was assayed for autoinducer activity.
luxS complementation studies. For complementation studies, we used suicide plasmid pAD-1, which the H. pylori ureA sequence with unique restriction sites for XbaI and SmaI in close proximity to the ureA ribosome binding site and initiation codon (3). This plasmid is designed such that cloned sequences can be placed within the urease locus on the H. pylori chromosome (resulting in a urease-negative phenotype), and the cloned sequence will then be transcribed under the control of the ureA promoter and translated using the ureA ribosome binding site (3). luxS was amplified from H. pylori genomic DNA using primers 5' TGCTTAGATGAAAACACCAAAAATGAATGTAGAGAG and 5' TCCCCCGGGTCAAACCCCCACTTCAGACCAC, which contain restriction sites for XbaI and SmaI, respectively, at the 5' ends. The amplicon, which contained the entire luxS open reading frame (ORF), was digested with XbaI and SmaI and cloned into pAD-1. A selectable marker, aphA3 from pUC4K (Amersham Pharmacia), was then cloned into the SmaI site, and the resulting plasmid (pAD/luxS-aphA3) was used to transform H. pylori luxS null mutant strains (L60-1 and L26-1). H. pylori colonies were screened for both chloramphenicol and kanamycin resistance. The resulting urease-negative mutants were designated L60-2 and L26-2, respectively.
| |
RESULTS |
|---|
|
|
|---|
H. pylori produces an extracellular signaling
molecule.
Many strains of E. coli and S. enterica serovar Typhimurium produce and release autoinducers that
can induce bioluminescence in V. harveyi (7).
This led us to speculate that H. pylori may produce a
similar signaling molecule. To test this hypothesis, we used a V. harveyi reporter strain, BB170 (kind gift from B. Bassler), which
does not have a functional sensor for AI-1 (AHL) but has an intact
sensor for AI-2. V. harveyi BB152 is capable of producing
AI-2, but not AI-1, and was thus used as a source of homologous AI-2 in
the bioassay. Figure 1A shows the result of a typical experiment. When inoculated into AB medium containing 10%
sterile brucella broth, V. harveyi BB170 produces a strong luminescent signal for about 4 h, and the levels of luminescence decrease markedly by the 5-h time point. In contrast, when inoculated into AB medium containing 10% CM from V. harveyi BB152 (a
supplemental source of AI-2), V. harveyi BB170 maintains a
high level of luminescence at the 5-h time point. These results confirm
data previously reported by Surette and Bassler (42) and
illustrate that the 5-h time point is appropriate for monitoring the
effects of exogenous AI-2 in this assay.
|
H. pylori contains a luxS orthologue.
The recent discovery by Surette et al. (44) that the
luxS gene is essential for AI-2 production in V. harveyi, S. enterica serovar Typhimurium, and E. coli, prompted us to search the genomes of two sequenced strains
of H. pylori (26695 and J99) for luxS orthologues. Both genomes contain luxS orthologues,
designated ORF HP 0105 and JHP 0097, respectively (1, 46).
The predicted primary structures of LuxS proteins from these two
H. pylori strains are 95% identical. LuxS from H. pylori is most closely related to LuxS proteins found in
gram-positive species (Staphylococcus aureus [67% amino
acid identity], Bacillus subtilis [45% amino acid
identity], and Clostridium perfringens [44% amino acid
identity]) (Fig. 2). The flanking gene
arrangements are widely divergent among most of these species. However,
in both H. pylori and C. perfringens,
luxS is linked to two genes (cysK and
metB) that are involved in amino acid biosynthesis. Neither
of these genes is linked to luxS loci in the other species
examined to date.
|
|
Characteristics of the H. pylori signaling molecule. Experiments utilizing a 10-kDa-cutoff ultrafiltration membrane (Amicon) demonstrated that the <10-kDa fraction of H. pylori CM induced luminescence in V. harveyi BB170, whereas the >10-kDa fraction had no effect (data not shown). Incubation of H. pylori CM preparations with proteinase K (Sigma) had no effect on the autoinducer activity. The autoinducer activity in CM from H. pylori was almost completely abrogated by treatment at 100°C for 5 min. In contrast, treatment at 80°C for the same length of time had no effect on the activity of the signaling molecule (data not shown). These data indicate that the H. pylori signaling molecule is a small (<10-kDa) heat-resistant molecule that is likely not proteinaceous.
Production of the H. pylori signaling molecule is
growth phase dependent.
To examine the kinetics of autoinducer
production in H. pylori, we prepared CM at serial time
points reflecting all phases of growth from broth cultures of H. pylori 60190. The maximal autoinducer activity was detected in CM
preparations from mid-logarithmic-phase cultures (Fig.
4). Levels of autoinducer activity were
markedly reduced in CM prepared from stationary-phase H. pylori cultures (Fig. 4). This pattern of results was very
reproducible, but the absolute values of luminescence varied
considerably among individual experiments. The loss of autoinducer
activity in stationary-phase cultures suggests that either the H. pylori signaling molecule is labile or H. pylori cells
are capable of degrading the autoinducer.
|
Growth phase-dependent regulation of vacA
transcription.
In previous studies (M. H. Forsyth and T. L. Cover, unpublished data), we have noted that the transcription of
H. pylori vacA (encoding a vacuolating cytotoxin) is
dependent on the bacterial growth phase. Figure
5 shows the results of a typical
experiment in which vacA transcription was monitored using a
reporter strain (60190 VX-1) containing a
vacA::xylE transcriptional fusion
(17). Levels of XylE activity are low during the early,
low-cell-density portions of the growth curve. XylE activity
progressively increases as cultures proceed into exponential,
higher-cell-density phases of growth. Peak levels of vacA
transcription are reached at the onset of stationary phase and
subsequently decline over time.
|
Activity of recombinant H. pylori LuxS expressed in
E. coli DH5
.
Many pathogenic E. coli
strains produce an AI-2-like activity (42) that can be
detected using the V. harveyi bioassay. However, the
commonly used laboratory strain of E. coli, DH5
, fails to produce measurable amounts of autoinducer due to a frameshift mutation
in the 3' portion of the luxS ORF (44). To
examine the function of H. pylori luxS in E. coli, we cloned the luxS orthologue of H. pylori into pGEM-T (Promega) and introduced this plasmid (pLuxS)
into E. coli DH5
. Conditioned media from E. coli DH5
containing pGEM-T (without H. pylori
sequence) lacked autoinducer activity in the V. harveyi
bioassay, whereas CM from E. coli DH5
containing pLuxS
induced much higher levels of luminescence (Fig. 6). As expected, disruption of the cloned
H. pylori luxS gene, accomplished by inserting a CAT
cassette into the unique XcmI site, resulted in the loss of
autoinducer production. These data are further confirmation that
H. pylori luxS plays an essential role in the production of
an extracellular signaling molecule.
|
| |
DISCUSSION |
|---|
|
|
|---|
The capacity of individual bacteria to regulate gene expression in response to changes in bacterial cell density is known as quorum sensing. Several different families of bacterial quorum-sensing molecules have been described, including AHL derivatives (AI-1 molecules), small peptides, and AI-2 molecules (2, 15, 19). In the present study, we describe the production of a quorum-sensing molecule (autoinducer) by H. pylori. Several lines of evidence suggest that the H. pylori autoinducer is closely related to the AI-2 family of signaling molecules: (i) like the AI-2 molecules of V. harveyi, E. coli, and S. enterica serovar Typhimurium, the H. pylori autoinducer is a low-molecular-mass molecule that is relatively heat resistant; (ii) the H. pylori autoinducer is detectable by a V. harveyi reporter strain that responds to AI-2, but not AI-1, molecules; and (iii) a functional luxS orthologue is essential for the production of the H. pylori signaling molecule, as well as for production of AI-2 molecules in V. harveyi, E. coli, and S. enterica serovar Typhimurium.
The AI-2 family of quorum-sensing molecules has only been recently described (44), and there are many features of this quorum-sensing pathway that are not yet completely understood. In particular, the molecular composition of AI-2 has not yet been elucidated for any bacterial species. The luxS gene clearly seems to be essential for the production of this novel autoinducer (44), but it is not known whether LuxS possesses enzymatic activity or whether it serves some other function. H. pylori LuxS does not exhibit any obvious homology to known enzymes. If LuxS is an enzyme required for AI-2 synthesis, it is not known whether luxS alone is sufficient for synthesis of AI-2 or whether other genes are required. Moreover, nothing is known about the mechanisms whereby AI-2 is released or secreted into the extracellular milieu. As noted in this study, H. pylori luxS null mutants do not contain detectable cell-associated autoinducer activity, which suggests that LuxS is not required for secretion of the autoinducer.
In both E. coli and S. enterica serovar Typhimurium (42), as well as H. pylori, production of AI-2 is influenced by the growth phase of the bacteria. The mechanism of growth phase regulation of AI-2 production is not known. However, we speculate that there may be transcriptional regulation of luxS (or possibly other genes in the AI-2 biosynthetic pathway). In addition, there may be regulation of genes in an AI-2 degradative pathway.
Many bacterial species contain luxS orthologues (Fig. 2),
and production of an AI-2 molecule has now been experimentally
demonstrated in V. harveyi, E. coli, S. enterica serovar Typhimurium, and H. pylori. Whether
these AI-2 molecules are chemically identical or exhibit some variation
is not yet known. However, the capacity of AI-2 molecules from multiple
species to induce luminescence in V. harveyi suggests that
there is considerable structural similarity. If LuxS is indeed a unique
synthase required for AI-2 production, potentially the expression of
recombinant LuxS from various bacterial species in E. coli
DH5
will facilitate the characterization and comparison of these
various AI-2 autoinducers.
Although it seems likely that many bacterial species produce AI-2 molecules, the function of these molecules remains poorly understood. At present, these autoinducers are known to regulate the expression of luciferase in V. harveyi (6) and the expression of a type III secretion system in E. coli O157:H7 (41). However, the full complement of genes that might be regulated by AI-2 has not yet been explored. We consider it likely that AI-2 molecules may regulate gene expression in each of the bacterial species that produce them. If this hypothesis is correct, then mechanisms must be present for sensing and responding to these autoinducers. In V. harveyi, AI-2 is sensed by a histidine kinase (LuxQ) located within the cytoplasmic membrane (6). It seems likely that similar sensing systems may be operable in E. coli, S. enterica serovar Typhimurium, and H. pylori, but these systems have not yet been identified. The H. pylori genome sequence predicts the existence of several histidine kinases, but it is not known which, if any, of these has a functional activity corresponding to V. harveyi LuxQ.
The transcription of vacA (encoding H. pylori vacuolating cytotoxin) is growth phase dependent (Forsyth and Cover, unpublished data; this study), and the growth phase induction of vacA transcription seems to resemble the production kinetics of H. pylori AI-2. To test whether the growth phase regulation of vacA is dependent on H. pylori AI-2, we compared the transcription of vacA in wild-type and isogenic luxS mutant H. pylori strains. Inactivation of luxS did not alter vacA transcription, and therefore the mechanism of vacA growth phase regulation remains unknown. Growth phase regulation has been documented for virulence determinants in multiple bacterial species (24, 31, 32, 36) and is likely to be important in pathogenesis. We speculate that yet another quorum-sensing system may operate in H. pylori and that this system is the mediator the observed induction of vacA transcription.
Quorum-sensing systems mediated by AHL signaling molecules are typically quite species specific. In contrast, the AI-2 quorum-sensing systems of E. coli, S. enterica serovar Typhimurium (42-44), and H. pylori do not appear to be species specific. One possible role for such a nonspecific bacterial sensing system could be detection of total viable bacterial biomass as an indication of competition for resources. For example, alteration of gene expression in response to increasing bacterial density might be advantageous if it resulted in decreased utilization of nutrients or if it induced utilization of alternate nutrients.
Alternatively, this H. pylori signaling molecule may not regulate H. pylori gene expression, but may act on various other bacterial species. For example, some S. aureus strains produce signal molecules which interfere with quorum sensing in other S. aureus strains (23), and S. aureus may also produce a signaling molecule identical to that produced by Enterococcus faecalis (16, 34). Yet another alternative target for H. pylori signal molecules may be the cells of the gastric system itself. For example, Pseudomonas aeruginosa produces a signal molecule, OdHL, N-(3-oxododecanoyl)-L-homoserine lactone, that possesses immunomodulatory activity (45) and alters the expression of P2Y2 and P2Y4 receptors in tracheal gland cells (39). If gastric epithelial cells were responsive to an H. pylori signaling molecule, this might represent a bacterial strategy for altering the gastric environment to allow persistent H. pylori colonization (8, 9).
H. pylori is perhaps unique in terms of its place within the gastrointestinal ecosystem. While nearly the entire length of the gastrointestinal tract has an abundant and diverse microbial flora, H. pylori is often the sole species colonizing the gastric mucosa. Given the vast number of bacteria from countless species which pass through the stomach, many of which can colonize other regions of the alimentary canal, it is remarkable that H. pylori is nearly the only species to successfully colonize this niche. This may be due to unique properties that allow H. pylori to enter the gastric mucus layer and escape the very acidic pH of the gastric environment (29, 30). In addition, H. pylori produces bacteriocins that may act to prevent colonization by other bacterial species (37). We speculate that the capacity of H. pylori to produce and detect AI-2 may be an important component of the process by which bacterial overgrowth in the gastric mucosa is prevented.
| |
ACKNOWLEDGMENTS |
|---|
We thank Bonnie L. Bassler for her kind gifts of V. harveyi strains. We also thank Dawn Israel and Martin Blaser for their gift of pAD-1 as well as Mark McClain for productive discussions.
This work was supported by grant AI 39657 from the National Institutes of Health and by the Medical Research Service of the Department of Veterans Affairs.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Division of Infectious Diseases, Medical Center North A3310, Vanderbilt University School of Medicine, Nashville, TN 37232-2605. Phone: (615) 322-2035. Fax: (615) 343-6160. E-mail: covertl{at}ctrvax.vanderbilt.edu.
Editor: A. D. O'Brien
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Alm, R. A., L. L. Ling, D. T. Moir, et al. 1999. Genomic sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature 397:176-180[CrossRef][Medline]. |
| 2. | Alloing, G., C. Granadel, D. A. Morrison, and J. P. Claverys. 1996. Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae. Mol. Microbiol. 21:471-478[CrossRef][Medline]. |
| 3. |
Ando, T.,
D. A. Israel,
K. Kusugami, and M. J. Blaser.
1999.
HP0333, a member of the dprA family, is involved in natural transformation in Helicobacter pylori.
J. Bacteriol.
181:5572-5580 |
| 4. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1994. Current protocols in molecular biology. Wiley-Interscience, New York, N.Y. |
| 5. | Bassler, B. L., M. Wright, R. E. Showalter, and M. R. Silverman. 1993. Intercellular signalling in Vibrio harveyi: sequence and function of genes regulating expression of luminescence. Mol. Microbiol. 9:773-786[Medline]. |
| 6. | Bassler, B. L., M. Wright, and M. R. Silverman. 1994. Multiple signaling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pathway. Mol. Microbiol. 13:273-286[Medline]. |
| 7. |
Bassler, B. L.,
E. P. Greenberg, and A. M. Stevens.
1997.
Cross-species induction of luminescence in the quorum sensing bacterium Vibrio harveyi.
J. Bacteriol.
179:4043-4045 |
| 8. | Blaser, M. J. 1997. Ecology of Helicobacter pylori in the human stomach. J. Clin. Investig. 100:759-762[Medline]. |
| 9. |
Blaser, M. J., and D. Kirschner.
1999.
Dynamics of Helicobacter pylori colonization in relation to the host response.
Proc. Natl. Acad. Sci. USA
96:8359-8364 |
| 10. |
Blaser, M. J.,
G. I. Perez-Perez,
H. Kleanthous,
T. L. Cover,
R. M. Peek,
P. H. Chyou,
G. N. Stemmermann, and A. Nomura.
1995.
Infection with Helicobacter pylori strains possessing cagA is associated with an increased risk of developing adenocarcinoma of the stomach.
Cancer Res.
55:2111-2115 |
| 11. |
Brint, J. M., and D. E. Ohman.
1995.
Synthesis of multiple exoproducts in Pseudomonas aeruginosa is under the control of RhlR-RhlI, another set of regulators in strain PAO1 with homology to the autoinducer-responsive LuxR-LuxI family.
J. Bacteriol.
177:7155-7163 |
| 12. |
Buck, G. M., and J. S. Smith.
1987.
Medium supplementation for growth of Campylobacter pyloridis.
J. Clin. Microbiol.
25:597-599 |
| 13. |
Cao, J. G., and E. A. Meighen.
1989.
Purification and structural identification of an autoinducer for the luminescence system of Vibrio harveyi.
J. Biol. Chem.
264:21670-21676 |
| 14. | Cover, T. L., and M. J. Blaser. 1996. Helicobacter pylori infection, a paradigm for chronic mucosal inflammation: pathogenesis and implications for eradication and prevention. Adv. Intern. Med. 41:85-117[Medline]. |
| 15. | Dunny, G. M., and S. C. Winans. 1999. Cell-cell signaling in bacteria. ASM Press, Washington, D.C. |
| 16. |
Firth, N.,
P. D. Fink,
L. Johnson, and R. A. Skurray.
1994.
A lipoprotein signal peptide encoded by the staphylococcal conjugative plasmid pSK41 exhibits an activity resembling that of Enterococcus faecalis pheromone cAD1.
J. Bacteriol.
176:5871-5873 |
| 17. |
Forsyth, M. H.,
J. C. Atherton,
M. J. Blaser, and T. L. Cover.
1998.
Heterogeneity in levels of vacuolating cytotoxin gene (vacA) transcription among Helicobacter pylori strains.
Infect. Immun.
66:3088-3094 |
| 18. |
Forsyth, M. H., and T. L. Cover.
1999.
Mutational analysis of the vacA promoter provides insight into gene transcription in Helicobacter pylori.
J. Bacteriol.
181:2261-2266 |
| 19. | Fuqua, C., S. C. Winans, and E. P. Greenberg. 1996. Census and consensus in bacterial ecosystems: the LuxR-LuxI family of quorum-sensing gene regulators. Annu. Rev. Microbiol. 50:727-751[CrossRef][Medline]. |
| 20. | Greenberg, E. P., J. W. Hastings, and S. Ulitzur. 1979. Induction of luciferase synthesis in Beneckea harveyi by other marine bacteria. Arch. Microbiol. 120:87-91[CrossRef]. |
| 21. |
Hastings, J. W., and E. P. Greenberg.
1999.
Quorum sensing: the explanation of a curious phenomenon reveals a common characteristic of bacteria.
J. Bacteriol.
181:2667-2668 |
| 22. | Ji, G., R. C. Beavis, and R. P. Novick. 1995. Cell density control of staphylococcal virulence mediated by an octapeptide pheromone. Proc. Natl. Acad. Sci. USA 192:12055-12059. |
| 23. |
Ji, G.,
R. C. Beavis, and R. P. Novick.
1997.
Bacterial interference caused by autoinducing peptide variants.
Science
276:2027-2030 |
| 24. | Karita, M., M. K. R. Tummuru, H. P. Wirth, and M. J. Blaser. 1996. Effect of growth phase and acid shock on Helicobacter pylori cagA expression. Infect. Immun. 64:4501-4507[Abstract]. |
| 25. | Labigne, A., and H. deReuse. 1996. Determinants of Helicobacter pylori pathogenicity. Infect. Agents Dis. 5:191-202[Medline]. |
| 26. | Latifi, A., M. Foglino, K. Tanaka, P. Williams, and A. Lazdunski. 1996. A hierarchical quorum-sensing cascade in Pseudomonas aeruginosa links the transcriptional activators LasR and RhlR (VsmR) to expression of the stationary-phase sigma factor RpoS. Mol. Microbiol. 21:1137-1146[CrossRef][Medline]. |
| 27. |
Li, S.,
B. U. Lee, and L. J. Shimkets.
1992.
CsgA expression entrains Myxococcus xanthus development.
Genes Dev.
6:401-410 |
| 28. | Magnuson, R., J. Solomon, and A. D. Grossman. 1994. Biochemical and genetic characterization of a competence pheromone from Bacillus subtilis. Cell 77:207-221[CrossRef][Medline]. |
| 29. | McGowan, C. C., T. L. Cover, and M. J. Blaser. 1996. Helicobacter pylori and gastric acid: biological and therapeutic implications. Gastroenterology 110:926-938[CrossRef][Medline]. |
| 30. | McGowan, C. C., A. Necheva, S. A. Thompson, T. L. Cover, and M. J. Blaser. 1998. Acid-induced expression of an LPS-associated gene in Helicobacter pylori. Mol. Microbiol. 30:19-31[CrossRef][Medline]. |
| 31. | Mellies, J., T. Rudel, and T. F. Meyer. 1997. Transcriptional regulation of pilC2 in Neisseria gonorrhoeae: response to oxygen availability and evidence for growth-phase regulation in E. coli. Mol. Gen. Genet. 255:285-293[CrossRef][Medline]. |
| 32. | Mikulskis, A. V., I. Delor, V. H. Thi, and G. R. Cornelis. 1994. Regulation of the Yersinia enterocolitica Yst gene. Influence of growth phase, temperature, osmolarity, pH and bacterial host factors. Mol. Microbiol. 14:905-915[CrossRef][Medline]. |
| 33. | Mobley, H. L. 1996. Defining Helicobacter pylori as a pathogen: strain heterogeneity and virulence. Am. J. Med. 100:25-115. |
| 34. | Muscholl-Silberhorn, A., E. Samberger, and R. Wirth. 1997. Why does Staphylococcus aureus secrete an Enterococcus faecalis-specific pheromone? FEMS Microbiol. Lett. 157:261-266[CrossRef][Medline]. |
| 35. |
Pesci, E. C.,
J. P. Pearson,
P. C. Seed, and B. H. Iglewski.
1997.
Regulation of las and rhl quorum sensing in Pseudomonas aeruginosa.
J. Bacteriol.
179:3127-3132 |
| 36. | Puente, J. L., D. Bieber, S. W. Ramer, W. Murray, and G. K. Schoolnik. 1996. The bundle-forming pili of enteropathogenic Escherichia coli: transcriptional regulation by environmental signals. Mol. Microbiol. 20:87-100[CrossRef][Medline]. |
| 37. | Putsep, K., C. I. Branden, H. G. Boman, and S. Normark. 1999. Antibacterial peptide from Helicobacter pylori. Nature 398:671-672[CrossRef][Medline]. |
| 38. | Ruby, E. G., and M. J. McFall-Ngai. 1999. Oxygen-utilizing reactions and symbiotic colonization of the squid light organ by Vibrio fischeri. Trends Microbiol. 7:414-420[CrossRef][Medline]. |
| 39. |
Saleh, A.,
C. Figarella,
W. Kammouni,
S. Marchand-Pinatel,
A. Lazdunski,
A. Tubul,
P. Brun, and M. D. Merten.
1999.
Pseudomonas aeruginosa quorum-sensing signal molecule N-(3-oxododecanoyl)-L-homoserine lactone inhibits expression of P2Y receptors in cystic fibrosis tracheal gland cells.
Infect. Immun.
67:5076-5082 |
| 40. |
Schripsema, J.,
K. E. de Rudder,
T. B. van Vliet,
P. P. Lankhorst,
E. de Vroom,
J. W. Kijne, and A. A. van Brussel.
1996.
Bacteriocin small of Rhizobium leguminosarum belongs to the class of N-acyl-L-homoserine lactone molecules, known as autoinducers and as quorum sensing cotranscription factors.
J. Bacteriol.
178:366-371 |
| 41. |
Sperandio, V.,
J. L. Mellies,
W. Nguyen,
S. Shin, and J. B. Kaper.
1999.
Quorum sensing controls expression of type III secretion gene transcription and protein secretion in enterohemorrhagic and enteropathogenic Escherichia coli.
Proc. Natl. Acad. Sci. USA
96:15196-15201 |
| 42. |
Surette, M. G., and B. L. Bassler.
1998.
Quorum sensing in Escherichia coli and Salmonella typhimurium.
Proc. Natl. Acad. Sci. USA
95:7046-7050 |
| 43. | Surette, M. G., and B. L. Bassler. 1999. Regulation of autoinducer production in Salmonella typhimurium. Mol. Microbiol. 31:585-595[CrossRef][Medline]. |
| 44. |
Surette, M. G.,
M. B. Miller, and B. L. Bassler.
1999.
Quorum sensing in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: a new family of genes responsible for autoinducer production.
Proc. Natl. Acad. Sci. USA
96:1639-1644 |
| 45. |
Telford, G.,
D. Wheeler,
P. Williams,
P. T. Tomkins,
P. Appleby,
H. Sewell,
G. S. Stewart,
B. W. Bycroft, and D. I. Pritchard.
1998.
The Pseudomonas aeruginosa quorum-sensing signal molecule N-(3-oxododecanoyl)-L-homoserine lactone has immunomodulatory activity.
Infect. Immun.
66:36-42 |
| 46. | Tomb, J. F., O. White, A. R. Kerlavage, et al. 1997. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388:539-547[CrossRef][Medline]. |
| 47. | Wang, Y., and D. E. Taylor. 1990. Chloramphenicol resistance in Campylobacter coli: nucleotide sequence, expression, and cloning vector construction. Gene 94:23-28[CrossRef][Medline]. |
| 48. |
Winson, M. K.,
C. Camara,
A. Latifi, et al.
1995.
Multiple N-acyl-L-homoserine lactone signal molecules regulate production of virulence determinants and secondary metabolites in Pseudomonas aeruginosa.
Proc. Natl. Acad. Sci. USA
92:9427-9431 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|