Previous Article | Next Article 
Infection and Immunity, June 2000, p. 3280-3285, Vol. 68, No. 6
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
CS22, a Novel Human Enterotoxigenic
Escherichia coli Adhesin, Is Related to CS15
Mariana
Pichel,
Norma
Binsztein, and
Gloria
Viboud*
Departamento de Bacteriología,
Instituto Nacional de Enfermedades Infecciosas-ANLIS "Carlos G. Malbrán," 1281 Capital Federal, Argentina
Received 24 November 1999/Returned for modification 18 February
2000/Accepted 17 March 2000
 |
ABSTRACT |
Enterotoxigenic Escherichia coli (ETEC) expresses a
broad spectrum of O:H antigens. Serogroup O20 is one of the most
prevalent among the ETEC strains lacking any of the defined
colonization factors (CFs), in Argentina. An O20:H
strain, ARG-3,
adhered to Caco-2 cells and exhibited a thermoregulated 15.7-kDa
protein band upon sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE). An antiserum against this protein inhibited
ARG-3 adhesion to Caco-2 cells and bound to very thin fibrilla-like structures on the bacterial surface. A 15.7-kDa protein-defective mutant failed to adhere to Caco-2 cells and lacked immunogold-labeled surface structures. The N-terminal amino acid sequence of the structural subunit showed 95% homology to that of CS15 of ETEC (former
antigen 8786) and 65% homology with fimbria SEF14 of Salmonella enterica serovar Enteritidis. Nevertheless, the molecular size of
ARG-3 adhesin was different from that of CS15, as revealed by SDS-PAGE
and mass spectrometry. Both proteins are immunologically related, yet
not identical, since an antiserum against the 15.7-kDa protein reacted
solely with ARG-3 after absorption with bacteria bearing CS15.
Moreover, only under low stringency conditions could DNA from strain
ARG-3 be amplified by PCR using primers derived from the
nfaA sequence of CS15. Thus, from the DNA sequence obtained from the ARG-3 PCR product, it could be deduced that the subunit protein differed in 30 residues from that of CS15. ARG-3 adhesin was
found in 60% of the O20:H- CF-negative ETEC strains from Argentina; however, it appeared restricted to this serotype. We propose the designation CS22 for the herein identified nonfimbrial adhesin of human ETEC.
 |
INTRODUCTION |
Enterotoxigenic Escherichia
coli (ETEC) is the most common cause of diarrhea in children in
developing countries and in travelers to those areas (5).
ETEC produces heat-labile enterotoxins, heat-stable enterotoxins, or
both, which induce a net secretion of electrolytes and water to the gut
lumen. The ability to adhere to enterocytes and to colonize the small
intestine is essential for ETEC pathogenicity and is conferred by
colonization factors (CFs) (11). The different CFs may be
fimbrial, nonfimbrial or fibrillar structures, and they have been
grouped in four big families according to the homology in their
N-terminal amino acid sequence (11). Recently, Gaastra and
Svennerholm (11) revised the nomenclature of these antigens,
based on the designation proposed by M. M. McConnell. Thus, the
CFs described so far include: CFA/I, CS1 to CS7, CS8 (originally
CFA/III), CS10 (antigen 2230), CS11 (PCFO148), CS12 (PCFO159), CS13
(PCFO9), CS14 (PCFO166), CS15 (antigen 8786), CS17, CS18 (PCFO20),
CS19, CS20, and CS21 (longus). Each CF has a unique subunit molecular
mass as determined by studies of spray mass spectrometry (F. J. Cassels
et al., unpublished data). Most of them are encoded by genes located on
high-molecular-weight plasmids (10, 18, 20), and the
expression of these genes is thermoregulated by the histone-like
protein H-NS (7). The ability of several of these CFs to
promote colonization and induce immune response has been shown in
experimental animals (19) and human volunteers
(9).
Surveys of ETEC isolates have shown that most CFs are associated with a
limited number of O:H serotypes (4, 21, 25). Epidemiological
studies carried out in Argentina (4, 21, 22) revealed that
there is a high proportion (35 to 40%) of ETEC strains isolated from
children with diarrhea that do not express any of the defined CFs.
Serogroup O20 was one of the most prevalent among these CF-negative
ETEC isolates. These findings, along with the recent identification of
CS18 in an O20:H
Argentinean strain, led us to search for other
adhesins on the ETEC isolates belonging to this O group. Since
antibacterial immunity induced by ETEC is to a large extent CF specific
(1, 6), it is essential to study the distribution of the
known CFs in different geographical areas, as well as the emergence of
new adhesins, in order to design effective ETEC vaccines. By assessing
the ability of CF-negative strains to adhere to Caco-2 cells, we
identified a previously undescribed colonization factor on the O20:H
,
ST ETEC strain ARG-3, isolated from a child with diarrhea in Argentina.
 |
MATERIALS AND METHODS |
Bacterial strains and culture conditions.
All ETEC strains
used in the study were kept at
70°C in Trypticase soy broth
supplemented with 15% glycerol and were grown in CF antigen (CFA) agar
containing 1.5 g of Bacto Bile Salts no. 3 (Difco, Detroit, Mich.)
per liter (CFA-BS agar) (14), or in Trypticase soy agar
(TSA) at 37°C overnight.
Preparation of bacterial heat extracts.
Bacterial
suspensions of overnight cultures of the ETEC strains were heated at
60°C for 30 min. After centrifugation for 10 min at 2,000 × g, supernatants were separated and kept at
20°C until use.
Dot blot.
Bacterial heat extracts or whole bacteria were
spotted on nitrocellulose membranes and reacted with specific
monoclonal antibodies raised against CFA/I, CS1 to CS8, CS12, and CS14,
provided by Ann-Mari Svennerholm, or with polyclonal antiserum against
CS15, provided by Arlette Darfeuille-Michaud, or CS18 (24).
The antibody-antigen complexes were detected with immunoglobulin G
(IgG) antibody labeled with horseradish peroxidase and developed with
hydrogen peroxide substrate and 4-chloro-naphthol chromogen, as
described elsewhere (21).
SDS-PAGE and immunoblotting.
Crude protein extracts and
purified fimbrial proteins were electrophoresed through sodium dodecyl
sulfate-20% polyacrylamide gel electrophoresis (SDS-20% PAGE) gels
according to the method described by Laemmli (12). The gels
were either stained with Coomassie brilliant blue R250, or
electroblotted to nitrocellulose membranes using the Mini Trans-Blot
electrophoretic transfer cell (Bio-Rad Laboratories, Hercules, Calif.).
The membranes were incubated overnight at room temperature with
antifimbrial rabbit serum and developed as described above.
Serotyping.
ETEC strain ARG-3 was kindly serotyped by
Richard Wilson at the Department of Veterinary Science, Pennsylvania
State University. The strains from our ETEC culture collection were
serotyped by Ida Ørskov, International Escherichia and
Klebsiella Center, Statens Seruminstitut, Copenhagen, Denmark.
Purification of fimbrial proteins.
Whole-cell suspension of
strain ARG-3 was prepared by growing bacteria at 37°C overnight on
CFA agar. Bacteria were harvested with phosphate-buffered saline (PBS),
and the suspension was homogenized using an Omnimixer blender for 5 min
at maximal speed in an ice bath. The homogenate was centrifuged at
12,000 × g for 20 min at 4°C. Purified protein was
obtained after serial precipitations with ammonium sulfate (20, 40, and
60%) as previously described (8).
Preparation of antisera and Fab fragments.
Rabbit immune
antiserum was obtained following four subcutaneous injections with 100 µg of purified protein at 2-week intervals, as previously described
(24). Specific anti-ARG-3 adhesin serum (C238) was obtained
by absorption with ARG-3 bacteria grown at 22°C. The IgG fraction of
this serum was purified by affinity chromatography in a protein A
column (Bio-Rad Laboratories). After digestion with papain, the Fab
fragments were purified by absorbing the intact IgG and the Fc fraction
in a protein A column.
Adhesion to cultured human colon carcinoma cell line Caco-2.
Caco-2 adhesion assay was performed as previously described, with some
modifications (23). After incubating the cells with the
bacterial suspensions for 3 h, the samples were washed five times
with PBS and treated with 200 µl of Triton X-100 (0.5% in PBS) for
10 min at 37°C, and serial dilutions in PBS were plated by duplicate
on TSA to determine the number of adherent bacteria/milliliter. The
mean number of bacteria/cell was calculated by dividing the number of
bacteria/milliliter by the number of Caco-2 cells/milliliter. Alternatively, after washing with PBS, cells were fixed with methanol and treated with 10% Giemsa stain for light microscopy examination.
Adhesion inhibition tests.
Adhesion inhibition by Fab
fragments of extensively absorbed C238 antiserum was tested by mixing
equal volumes of Fab fragment preparation and a suspension of 8 × 108 bacteria/ml. The mixture was incubated at room
temperature for 20 min and added to the Caco-2 cells. The adhesion
assay was performed as described above. CS8, CS6-positive strain
34420A, and CS12-positive strain 350C1A, mixed with the
same preparation of Fab fraction, were used as unrelated controls.
N-terminal amino acid sequence determination.
Crude protein
extracts from ARG-3 strain were separated by SDS-PAGE as described
above, and electroblotted to a ProBlott (PEByosystems, Foster City,
Calif.) immobilization membrane. After staining with 1% Ponceau S
strain, the 15.7-kDa adhesin subunit band was excised and sent for
N-terminal amino acid sequence analysis to the Protein Structure Core
Facility, Department of Biochemistry and Molecular Biology, University
of Nebraska Medical Center.
Electron microscopy.
Strain ARG-3 was grown overnight at 37 and at 22°C on CFA-BS agar, suspended in distilled water, and applied
on Formvar-coated nickel grids (200 mesh). The grids were either
negatively stained with 1% ammonium molybdate or developed by
immunogold labeling, using absorbed C238 antiserum and gold-labeled
protein A (Auro Probe EM; Amersham International, Little Chalfont,
United Kingdom) as previously described (24). The grids were
then examined in an electron microscope (model EM109, Zeiss,
Oberkochen, Germany).
Mass spectrometry.
The mass of the adhesin protein subunit
was determined by electrospray mass spectrometry (F. Cassels, L. Pannell, J. Barringer, J. Anderson, M. Lisher, S. F. Khalil, and
S. J. Savarino, Abstr. 97th Gen. Meet. Am. Soc. Microbiol. 1997, abstr. D-95, 1997) at the laboratory of Frederick Cassels, Walter Reed
Army Institute of Research, Washington, D.C.
Mutagenesis.
Mutagenesis was performed on strain ARG-3 by
treatment with the alkylating agent
N-methyl-N'-nitro-N-nitrosoguanidine
(NTG) (15). Briefly, late log-phase culture of ARG-3 was
exposed to NTG for 10 min at 37°C, and after washing the cells to
remove the mutagen, the bacteria were suspended in PBS and plated onto CFA-BS agar. Mutants that did not react with the absorbed antiadhesin serum in dot blots were selected for further analyses.
PCR.
Two pairs of primers were designed based on the
sequence of the nfaA gene of CS15 antigen (2), to
amplify two fragments: one of 628 bp, encompassing the whole structural
gene and an inner fragment of 156 bp (primers 1, ATAAAAAATAAAGCACGCAG, and 2, CAACGTCAGCATCTTACAGT; and primers 3, TAAATGGGATAGTAATGAGG, and 4, CCTCTGTATCTGGTTCTTCA, respectively). An aliquot of 50 µl
of the reaction mixture contained 100 nmol of MgCl2, 0.4 U
of Taq polymerase, 5 µl of 10× buffer, 1.25 nmol of each
deoxynucleoside triphosphate, 25 pmol of each primer, and 2 µl of DNA
preparation. The amplification reaction consisted of 10 min at 94°C;
30 cycles of 94°C for 1 min, 57.1°C (low stringency) or 64.9°C
(high stringency) for 1 min, and 72°C for 1 min; and a final
extension of 10 min at 72°C. The DNA used as template consisted of a
bacterial suspension in water (optical density at 620 nm, approximately
1), boiled for 10 min. Equal amounts of the PCR products (10 µl) were
loaded in 1.2% agarose gels.
Nucleotide sequence accession number.
A 628-bp PCR product
from strain ARG-3 was sequenced at the Centro de Investigación en
Ciencias Agropecuarias, INTA, Buenos Aires, Argentina. Nucleotide or
protein database searches were performed using Blast Network Service.
The sequence obtained was submitted to GenBank under accession no.
AF145205.
 |
RESULTS |
Strain ARG-3 produces a thermoregulable surface protein.
Among
a group of CF-negative O20 ETEC strains isolated from children with
diarrhea in different areas of Argentina, a cluster of genetically
related isolates was identified in a previous study (M. Pichel, N. Binsztein, and G. I. Viboud, unpublished data). These strains were
shown to be related, yet not identical, by random amplified polymorphic
DNA and pulsed-field gel electrophoresis (PFGE) analyses. An ST-O20:H
strain, ARG-3, representing this group, was chosen for further
characterization. Heat extracts from this isolate exhibited a strong
band of 15.7 kDa upon SDS-PAGE when the bacteria were grown at 37°C
(either on CFA with or without BS or on TSA), that was absent when
grown at 22°C (Fig. 1). Serial ammonium
sulfate precipitation and centrifugation of crude bacterial heat
extracts allowed the purification of the ARG-3 temperature-dependent protein (Fig. 1). This protein was used as an immunogen to produce a
monospecific polyclonal antiserum (C238), which was subsequently absorbed with strain ARG-3 grown at room temperature.

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 1.
SDS-PAGE analysis of purified adhesin subunit and heat
extracts from ETEC strains grown on CFA-BS agar. Lanes: 1, heat extract
from strain ARG-3 grown at 37°C; 2, heat extract from strain ARG-3
grown at 22°C; 3, purified adhesin from strain ARG-3; 4, heat extract
from mutant strain ARG-3/247; 5, molecular mass marker (broad-range
standard, Bio-Rad): aprotinin (6.5 kDa), lysozyme (14.4 kDa), soybean
trypsin inhibitor (21.5 kDa), carbonic anhidrase (31 kDa), ovalbumin
(45 kDa), bovine serum albumin (66.2 kDa), phosphorylase b
(97.4 kDa), -galactosidase (116.25 kDa), and myosin (200 kDa).
|
|
The surface protein is an adhesin.
ETEC ARG-3 adhered to
Caco-2 cells with 7.2 ± 0.39 bacteria/cell (mean ± standard
deviation) (Fig. 2A). IgG purified from antiserum C238 was digested with papain, and the resulting Fab fragments were used to determine inhibition of ARG-3 adhesion. Thus,
incubation of the C238 Fab fragments with ARG-3 strain dramatically decreased the adhesion index to 0.75 ± 0.25 bacteria/cell
(P = 0.0026) (Fig. 2B). In contrast, no significant
inhibition was observed when strain 34420A, expressing the unrelated
adhesins CS8 and CS6, or strain 350C1A, expressing CS12,
was preincubated with the same preparation (14.5 ± 2.1 and
13.0 ± 1.4 bacteria/cell [P = 0.49] and
19.0 ± 1.4 and 17.8 ± 1.8 bacteria/cell [P = 0.54], respectively).

View larger version (117K):
[in this window]
[in a new window]
|
FIG. 2.
Micrographs showing adhesion and adhesion inhibition of
ETEC strain ARG-3 to Caco-2 cells. (A) Strain ARG-3; (B) adhesion
inhibition of strain ARG-3 to Caco-2 cells using Fab fragments of
monospecific C238 antiserum raised against purified adhesin.
|
|
Electron microscopy examination revealed the presence of a mesh of very
thin, flexible structures on the surface of strain
ARG-3 when bacteria
were grown at 37°C (Fig.
3A). These
organelles
surrounded the bacteria, and their small diameter made them
very
difficult to visualize by negative staining. However, immunogold
labeling using C238 serum, showed that gold particles bound to
this
mesh of fibrilla-like structures present on the surface of
ARG-3 grown
at 37°C (Fig.
3B and
3C). These organelles appeared
organized into
bundles in the presence of the antibody and seemed
to be easily
detached from the bacteria, since gold particles
were also seen apart
from the cells. On the other hand, when bacteria
were cultured at
22°C, no labeling occurred (Fig.
3D).

View larger version (101K):
[in this window]
[in a new window]
|
FIG. 3.
(A) Electron micrographs showing strain ARG-3 grown at
37°C negatively stained with 1% ammonium molybdate (bar, 20 nm). (B)
Strain ARG-3 grown at 37°C after immunogold labeling with specific
C238 antiserum (bar, 100 nm). (C) Same preparation as in panel B, but
at a higher magnification (bar, 50 nm). (D) Strain ARG-3 grown at
22°C, gold immunolabeled with C238 antiserum (bar, 100 nm).
|
|
The new adhesive factor is related to CS15.
Strain ARG-3
tested negative in different immunoassays for CFA/I, CS1 to CS8, CS12,
CS14, CS17, and CS19. The sera against two related ETEC fimbriae, i.e.,
CS18 and CS20, reacted weakly with ARG-3 adhesin; however, they differ
from ARG-3 adhesin in respect of morphology and molecular size. The
N-terminal residues of the 15.7-kDa protein band were sequenced. The
resulting sequence was different from those of the most prevalent ETEC
CFs. However, it was found to be homologous to that of CS15 adhesin of
ETEC (3), with 85% (17 of 20) identical and 95% similar
residues. In addition, the sequence obtained was also similar to that
of SEF14 fimbriae of Salmonella enterica serovar Enteritidis
(16), with 55% (11 of 20) identical and 65% conserved
residues. Direct comparison between strains ARG-3 and 8786 in SDS-PAGE
showed differences in migration of the adhesive subunits; i.e., 15.7 kDa versus 16.3 kDa (Fig. 4). Anti-CS15
serum, donated by A. Darfeuille, reacted with the 15.7-kDa band, albeit
more weakly than with the homologous antigen (Fig. 4A). When C238 serum
was used as the antibody, an analogous cross-reaction was observed with
CS15 antigen (Fig. 4B). Thus, this indicates that the two proteins are
immunologically related. However, after absorption with strain 8786 bearing CS15, C238 antiserum reacted solely with strain ARG-3, showing
that the proteins are not identical (data not shown).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 4.
Western blot analyses of heat extracts from ETEC strains
ARG-3 and 8786 grown at 37°C using absorbed C238 antiserum raised
against purified adhesin from ARG-3 (A) or specific anti-CS15 serum
(B). Lanes: 1, ARG-3; 2, 8786.
|
|
The mass of the ARG-3 protein subunit was experimentally determined by
electrospray mass spectrometry at the laboratory of
Fred Cassels and
found to be 15,024.15 Da. In contrast, the CS15
mass calculated from
the amino acids deduced from the DNA sequence
(
2) and
determined by mass spectrometry (F. Cassel, personal
communication) was
considerably higher (15,348 Da). To further
evaluate the differences
between CS15 and ARG-3 adhesive factor,
a PCR assay was designed, using
two pairs of primers based on
the sequence of the
nfaA gene
of the CS15 protein subunit. Under
high-stringency conditions, both the
628 bp encompassing the whole
structural gene and 156-bp inner fragment
were amplified from
strain 8786 only. However, at lower annealing
temperatures both
fragments were amplified from 8786 as well as from
ARG-3 (Fig.
5), suggesting that there are
differences in the sequence corresponding
to at least one of the
primers used in each reaction.

View larger version (83K):
[in this window]
[in a new window]
|
FIG. 5.
Agarose gel electrophoresis patterns of PCR amplicons
obtained with primers 1 and 2 (A) and primers 3 and 4 (B) derived from
the sequence of gene nfaA, which codes for the structural
subunit of CS15. Lanes: 1, molecular mass marker (100-bp ladder;
Bio-Rad); 2 and 4, strain 8786; 3 and 5 strain ARG-3. Amplifications
under low-stringency conditions are shown in lanes 2 and 3 and those
under high-stringency conditions are shown in lanes 4 and 5.
|
|
Subsequently, the nucleotide sequence of the 628-bp PCR product was
determined and found to contain an open reading frame
of 498 nucleotides coding for a polypeptide of 166 amino acids.
Homology
searches using BLAST revealed that the deduced amino
acid sequence of
this gene was highly homologous to those of CS15
and SEF14 fimbriae of
S. enterica serovar Enteritidis, sharing
81 and 46% of the
residues respectively (Fig.
6). The
structural
subunit gene of ARG-3 adhesin was designated
cseA, and the sequence
was submitted to GenBank under
accession no.
AF145205.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 6.
Comparison of the deduced amino acid sequence of CS22
structural subunit with those of CS15 and S. enterica
serovar Enteritidis fimbria SEF14. Identical amino acids are boxed, and
well-conserved residues are marked with a +.
|
|
A mutant strain lacks adhesive capacity.
After mutagenesis
with NTG, 500 colonies were screened by dot blot assay with absorbed
C238 antiserum. A stable clone, which did not react with the highly
absorbed antiserum, was obtained. Heat extract from mutant ARG-3/247
lacked the 15.7-kDa protein subunit (Fig. 1A). Moreover, when this
strain was tested in the Caco-2 adhesion assay, the number of bound
bacteria was almost 10 times less than the number observed for the
wild-type strain ARG-3 (0.73 ± 0.30 bacteria/cell versus
7.25 ± 0.39). In addition, strain ARG-3/247 did not react with
serum C238 in immunoelectron microscopy (data not shown).
Prevalence of the new CF.
A total of 345 ETEC isolates from
children with diarrhea and healthy controls in Argentina (4, 21,
22), including strains of various serotypes (O78:H12, O78:H
,
O153:H45, O6:H16, O20:H
, O20:H34, O29:H10, and O114:H21), were
screened for the expression of the new adhesive factor by dot blot
assay, using specific C238 antiserum absorbed with a CS15-positive
strain, and further confirmed by Western blotting. ARG-3 adhesin was
found restricted to serotype O20:H
, accounting for about 60% (7 of
12) of the CF-negative strains of this serotype. These isolates
appeared to be genetically related, albeit not identical, as determined
by random amplified polymorphic DNA and PFGE analyses (Pichel et al.,
unpublished data). Moreover, they had no epidemiological links; thus,
they proceeded from four different regions of the country and had been isolated over a period of 5 years. None of the tested strains was
positive for CS15.
 |
DISCUSSION |
Many epidemiological studies have been carried out to determine
the distribution of ETEC CFs in different geographical areas (25). Surveys in Argentina, as well as in other locations,
have shown that a high proportion of ETEC strains does not possess any
of the hitherto-defined CFs (4, 21, 22). In the present report, we describe the identification of a new CF of human ETEC in
strain ARG-3 that belongs to serogroup O20, one of the most prevalent
among the CF-negative ETEC strains in Argentina (4, 21, 22).
In line with the recently proposed nomenclature (11) we name
this new adhesin CS22.
Several findings support the idea that the 15.7-kDa protein present in
the heat extracts of strain ARG-3 is the subunit of the CS22 adhesin
observed on the surface of the bacteria, i.e., that the expression of
this protein is temperature dependent, as is the case for all the CFs
of ETEC, and the antiserum raised against this protein bound to the
very thin organelles on the surface of the bacteria, as shown by
immunogold electron microscopy. Moreover, a nonadhesive mutant strain
defective in the 15.7-kDa protein did not produce fibrilla-like surface structures.
The Caco-2 cell line has proven to be an excellent model to study the
adhesion of human enteropathogens to the intestinal epithelium
(23). The cells, derived from a human colonic carcinoma, differentiate into an epithelial cell layer, which resembles the small
intestinal epithelium. In the present study, the Fab fragments of the
antiserum raised against the purified structural subunit of CS22 and
exhaustively absorbed specifically inhibited the binding of ARG-3
bacteria to Caco-2 cells, from which we conclude that CS22 is
responsible for the adhesion to these cells. The inhibition is
specific, since the Fab fraction of C238 antiserum did not significantly affect the adhesion of bacteria bearing unrelated adhesins CS8 or CS12. Furthermore, a mutant strain derived from ARG-3
that did not express the new adhesin, as seen by electron microscopy,
SDS-PAGE, and immunoblot analyses, showed a significantly reduced
adhesion index to Caco-2 cells, confirming the role of CS22 in
conferring the ability to adhere to the intestinal epithelium.
The specific antiserum raised against CS22 showed cross-reaction with
the protein subunit of antigen CS15, and an analogous cross-reaction
was observed between the specific anti-CS15 serum and the structural
subunit of CS22. This immunological relatedness is in line with the
high homology observed between the deduced amino acid sequences of
these CFs (81% identity, 87% similarity). However, after absorption
with bacteria bearing CS15, the anti-CS22 serum reacted only with
ARG-3, suggesting that the adhesins have both common as well as unique
epitopes. Furthermore, the mass of the CS22 protein subunit calculated
by electrospray mass spectrometry differs from that of CS15. This
technique measures the mass of a protein to an accuracy of about 1 part
in 10,000 and, therefore, it has been proposed as a method of
identification of ETEC CFs (Cassels et al., Abstr. 97th Gen. Meet. Am.
Soc. Microbiol.). The difference in size of the two adhesins was also
observed by SDS-PAGE. The subunit proteins of both CS15 and CS22
appeared to have higher molecular sizes by SDS-PAGE than by mass
spectrometry, probably due to the effect of the SDS molecules bound to
the proteins.
The PCR assay using primers based on the sequence of the
nfaA gene shows that, although closely related, the
nucleotide sequences of the structural subunit genes of CS22 and CS15
are not identical, since only under low-stringency conditions was the
reaction positive for ARG-3. In fact, the nucleotide sequence of the
CS22 structural gene (cseA) differed in 41 of 498 nucleotides from that of CS15.
CS15 has been described as a nonfimbrial adhesin. However, as mentioned
by the authors (3), the disposition of the gold particles in
the immunoelectron microscopy examination of strain 8786 strongly
suggests that the antiserum was bound to fibrilla-like structures.
Furthermore, this observation was confirmed in our laboratory (data not
shown), and the arrangement observed closely resembles that of CS22 and
other members of the nonfimbrial adhesin group. Nevertheless, no
significant homology was found between CS22 and the amino acid
sequences of adhesins nonfimbrial F1845, Dr, AFA I, and AFA III.
The deduced amino acid sequence of the CS22 subunit was, however, very
similar to that of S. enterica serovar Enteritidis SEF14
fimbria. Interestingly, a sequence showing extensive homology to the
insertion element IS3 of E. coli was found
upstream of the gene coding for SEF14 (16), suggesting that
this virulence factor could have been transferred horizontally between
the two species. It is worth noting, however, that CS22 and SEF14 have distinct morphologies, probably due to differences in the tertiary structure of their subunits. It would be interesting to evaluate if the
homology in the structural gene extends to other genes of the fimbrial
operon, such as those involved in the biogenesis of the organelles.
CS22 was found in almost 60% of the CF-negative O20:H
Argentinean
strains tested. Although restricted to this phenotype, the new adhesin
was identified in strains isolated from different locations that were
shown to be genotypically related, but not identical, as determined by
PFGE. This finding is in agreement with the observation of Wolf
(25) that certain combinations of phenotypic traits
(serotype, toxin profile, and CF) are more prevalent among ETEC and can
be widespread over distant places. Examples of this are the
LT/ST-O6:H16 CFA/II (17), ST-O153:H45 CFA/I (A. B. F. Pacheco, L. C. S. Ferreira, M. G. Pichel, D. F. Almeida, N. Binsztein, and G. I. Viboud, unpublished data), and LT-O114:H21 CS17 strains. It would therefore be important to evaluate the presence of CS22 in strains from other areas, especially in those
in which O20 serogroup is prevalent.
 |
ACKNOWLEDGMENTS |
We thank M. and J. P. Bozzini for their skillful assistance
with the electron microscope, F. Cassels for performing the mass spectrometry analysis of CS22, A. Darfeuille-Michaud for providing strain 8786 and the anti-CS15 serum, E. Illan and A. Lewis for culturing the Caco-2 cells, A.-M. Svennerholm for providing the monoclonal antibodies against the different CFs, and R. Wilson for
serotyping strain ARG-3. We gratefully acknowledge A. Roge and R. Melano for very fruitful discussions and G. Lafuente Devier and A. Garbini for technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Present address: Department of
Molecular Genetics and Microbiology, School of Medicine, State
University of New York at Stony Brook, Stony Brook, NY 11794-5222. Phone: (631) 632-8783. Fax: (631) 632-9797. E-mail:
gviboud{at}ms.cc.sunysb.edu.
Editor:
A. D. O'Brien
 |
REFERENCES |
| 1.
|
Åhrén, C. M., and A.-M. Svennerholm.
1985.
Experimental enterotoxin-induced Escherichia coli diarrhea and protection by previous infection with bacteria of the same adhesin or enterotoxin type.
Infect. Immun.
50:255-261[Abstract/Free Full Text].
|
| 2.
|
Aubel, D.,
A. Darfeuille-Michaud,
C. Martin, and B. Joly.
1992.
Nucleotide sequence of the nfaA gene encoding the antigen 8786 adhesive factor of enterotoxigenic Escherichia coli.
FEMS Microbiol. Lett.
98:277-284[CrossRef].
|
| 3.
|
Aubel, D.,
A. Darfeuille-Michaud, and B. Joly.
1991.
New adhesive factor (antigen 8786) on a human enterotoxigenic Escherichia coli O114:H4 strain isolated in Africa.
Infect. Immun.
59:1290-1299[Abstract/Free Full Text].
|
| 4.
|
Binsztein, N.,
M. Jouve,
G. I. Viboud,
L. Lopez Moral,
M. Rivas,
I. Ørskov,
C. Åhrén, and A.-M. Svennerholm.
1991.
Colonization factors of enterotoxigenic Escherichia coli isolated from children in Argentina.
J. Clin. Microbiol.
29:1893-1898[Abstract/Free Full Text].
|
| 5.
|
Black, R. E.
1993.
Epidemiology of diarrhoeal disease: implications for control by vaccines.
Vaccine
11:100-106[CrossRef][Medline].
|
| 6.
|
Cravioto, A.,
R. E. Reyes,
F. Trujillo,
F. Uride,
A. Navarro,
J. M. De La Roca,
J. M. Hernandez,
G. Perez, and V. Vazquez.
1990.
Risk of diarrhea during the first year of life associated with initial and subsequent colonization by specific enteropathogens.
Am. J. Epidemiol.
131:886-904[Abstract/Free Full Text].
|
| 7.
|
De Graaf, F. K., and W. Gaastra.
1994.
Fimbriae of enterotoxigenic Escherichia coli, p. 57-88.
In
P. Klemm (ed.), Fimbriae: adhesion, genetics, biogenesis, and vaccines. CRC Press, Inc., Boca Raton, Fla.
|
| 8.
|
Evans, D. G.,
D. J. Evans, Jr.,
S. Clegg, and J. A. Pauley.
1979.
Purification and characterization of the CFA/I antigen of enterotoxigenic Escherichia coli.
Infect. Immun.
25:738-748[Abstract/Free Full Text].
|
| 9.
|
Evans, D. G.,
T. K. Satterwhite,
D. J. Evans, Jr., and H. L. DuPont.
1978.
Differences in serological responses and excretion patterns of volunteers challenged with enterotoxigenic Escherichia coli with and without the colonization factor antigen.
Infect. Immun.
19:883-888[Abstract/Free Full Text].
|
| 10.
|
Evans, D. G.,
R. P. Silver,
D. J. Evans, Jr.,
D. G. Chase, and S. L. Gorbach.
1975.
Plasmid-controlled colonization factor associated with virulence in Escherichia coli enterotoxigenic for humans.
Infect. Immun.
12:656-667[Abstract/Free Full Text].
|
| 11.
|
Gaastra, W., and A.-M. Svennerholm.
1996.
Colonization factors of human enterotoxigenic Escherichia coli (ETEC).
Trends Microbiol.
4:444-452[CrossRef][Medline].
|
| 12.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature (London)
227:680-685[CrossRef][Medline].
|
| 13.
|
Levine, M. M.,
P. Ristaino,
G. Marley,
C. Smyth,
S. Knutton,
E. Boedeker,
R. Black,
C. Young,
M. L. Clements,
C. Cheney, and R. Patnaik.
1984.
Coli surface antigens 1 and 3 of colonization factor antigen II-positive enterotoxigenic Escherichia coli: morphology, purification, and immune responses in humans.
Infect. Immun.
44:409-420[Abstract/Free Full Text].
|
| 14.
|
McConnell, M. M.,
H. Chart,
A. M. Field,
M. Hibberd, and B. Rowe.
1989.
Characterization of a putative colonization factor (PCFO166) of enterotoxigenic Escherichia coli of serogroup O166.
J. Gen. Microbiol.
135:1135-1144[Abstract/Free Full Text].
|
| 15.
|
Miller, J.
1991.
Mutagenesis, p. 94-96.
In
J. Miller (ed.), A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 16.
|
Ogunniyi, A. D.,
I. Kotlarski,
R. Morona, and P. A. Manning.
1997.
Role of SefA subunit protein of SEF14 fimbriae in the pathogenesis of Salmonella enterica serovar Enteritidis.
Infect. Immun.
65:708-717[Abstract].
|
| 17.
|
Pacheco, A. B. F.,
K. C. Soares,
G. I. Viboud,
D. F. Almeida,
N. Binsztein, and L. C. S. Ferreira.
1998.
Clonal nature of enterotoxigenic Escherichia coli serotype O6:H16 revealed by RAPD.
J. Clin. Microbiol.
36:2099-2102[Abstract/Free Full Text].
|
| 18.
|
Peñaranda, M. E.,
D. G. Evans,
B. E. Murray, and D. J. Evans, Jr.
1983.
ST:LT:CFA/II plasmids in enterotoxigenic Escherichia coli belonging to serogroups O6, O8, O80, O85, and O139.
J. Bacteriol.
154:980-983[Abstract/Free Full Text].
|
| 19.
|
Svennerholm, A.-M.,
M. M. McConnell, and G. Wiklund.
1992.
Roles of different putative colonization factor antigens in colonization of human enterotoxigenic Escherichia coli in rabbits.
Microb. Pathog.
13:381-389[CrossRef][Medline].
|
| 20.
|
Thomas, L. V.,
B. Rowe, and M. M. McConnell.
1987.
In strains of Escherichia coli O167 a single plasmid encodes for the coli surface antigens CS5 and CS6 of putative colonization factor PCF8775, heat-stable enterotoxin, and colicin Ia.
Infect. Immun.
55:1929-1931[Abstract/Free Full Text].
|
| 21.
|
Viboud, G. I.,
N. Binsztein, and A.-M. Svennerholm.
1993.
Characterization of monoclonal antibodies against putative colonization factors of enterotoxigenic Escherichia coli and their use in an epidemiological study.
J. Clin. Microbiol.
31:558-564[Abstract/Free Full Text].
|
| 22.
|
Viboud, G. I.,
M. Jouve,
N. Binsztein,
M. Vergara,
M. Rivas,
M. Quiroga, and A.-M. Svennerholm.
1999.
Prospective cohort study of enterotoxigenic Escherichia coli infections in Argentinean children.
J. Clin. Microbiol.
37:2829-2833[Abstract/Free Full Text].
|
| 23.
|
Viboud, G. I.,
M. M. McConnell,
A. Helander, and A.-M. Svennerholm.
1996.
Binding of enterotoxigenic Escherichia coli expressing different colonization factors to tissue-cultured Caco-2 cells and to isolated human enterocytes.
Microb. Pathog.
21:139-147[CrossRef][Medline].
|
| 24.
|
Viboud, G. I.,
N. Binsztein, and A.-M. Svennerholm.
1993.
A new fimbrial putative colonization factor, PCFO20, in human enterotoxigenic Escherichia coli.
Infect. Immun.
61:5190-5197[Abstract/Free Full Text].
|
| 25.
|
Wolf, M.
1997.
Occurrence, distribution, and association of O and H serogroups, colonization factor antigens, and toxins of enterotoxigenic Escherichia coli.
Clin. Microbiol. Rev.
10:569-584[Abstract].
|
Infection and Immunity, June 2000, p. 3280-3285, Vol. 68, No. 6
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Shaheen, H. I., Abdel Messih, I. A., Klena, J. D., Mansour, A., El-Wakkeel, Z., Wierzba, T. F., Sanders, J. W., Khalil, S. B., Rockabrand, D. M., Monteville, M. R., Rozmajzl, P. J., Svennerholm, A. M., Frenck, R. W.
(2009). Phenotypic and Genotypic Analysis of Enterotoxigenic Escherichia coli in Samples Obtained from Egyptian Children Presenting to Referral Hospitals. J. Clin. Microbiol.
47: 189-197
[Abstract]
[Full Text]
-
Sjoling, A., Wiklund, G., Savarino, S. J., Cohen, D. I., Svennerholm, A.-M.
(2007). Comparative Analyses of Phenotypic and Genotypic Methods for Detection of Enterotoxigenic Escherichia coli Toxins and Colonization Factors. J. Clin. Microbiol.
45: 3295-3301
[Abstract]
[Full Text]
-
Froehlich, B., Parkhill, J., Sanders, M., Quail, M. A., Scott, J. R.
(2005). The pCoo Plasmid of Enterotoxigenic Escherichia coli Is a Mosaic Cointegrate. J. Bacteriol.
187: 6509-6516
[Abstract]
[Full Text]
-
Torres, A. G., Zhou, X., Kaper, J. B.
(2005). Adherence of Diarrheagenic Escherichia coli Strains to Epithelial Cells. Infect. Immun.
73: 18-29
[Full Text]
-
Froehlich, B., Holtzapple, E., Read, T. D., Scott, J. R.
(2004). Horizontal Transfer of CS1 Pilin Genes of Enterotoxigenic Escherichia coli. J. Bacteriol.
186: 3230-3237
[Abstract]
[Full Text]
-
Pichel, M. G., Binsztein, N., Qadri, F., Giron, J. A.
(2002). Type IV Longus Pilus of Enterotoxigenic Escherichia coli: Occurrence and Association with Toxin Types and Colonization Factors among Strains Isolated in Argentina. J. Clin. Microbiol.
40: 694-697
[Abstract]
[Full Text]
-
Pichel, M., Binsztein, N., Gutkind, G., Viboud, G.
(2001). Identification of a Cluster of Strains Bearing a New Adhesin among Genetically Diverse Enterotoxigenic Escherichia coli Isolates of Serogroup O20. J. Clin. Microbiol.
39: 782-786
[Abstract]
[Full Text]