Previous Article | Next Article ![]()
Infection and Immunity, June 2000, p. 3776-3779, Vol. 68, No. 6
Sid W. Richardson Ocular Microbiology
Laboratory, Cullen Eye Institute, Department of Ophthalmology, Baylor
College of Medicine,1 and Center for
Extracellular Matrix Biology, Albert B. Alkek Institute of Biosciences
and Technology, Texas A&M University,2 Houston,
Texas
Received 24 January 2000/Returned for modification 1 March
2000/Accepted 23 March 2000
A collagen-binding strain of Staphylococcus aureus
produced suppurative inflammation in a rabbit model of soft contact
lens-associated bacterial keratitis more often than its
collagen-binding-negative isogenic mutant. Reintroduction of the
cna gene on a multicopy plasmid into the mutant helped it
regain its corneal adherence and infectivity. The topical application
of a collagen-binding peptide before bacterial challenge decreased
S. aureus adherence to deepithelialized corneas. These data
suggest that the collagen-binding adhesin is involved in the
pathogenesis of S. aureus infection of the cornea.
Our understanding of the
pathogenesis of infectious diseases of the eye is emerging. The intact
ocular surface thwarts most microorganisms, but predisposing factors
such as contact lens wear can expose tissue components conducive to
bacterial adhesion. A breakdown in local defenses and a source of
microbial contaminants increase the risk of eye infection.
Staphylococcus aureus is responsible for many types of human
ocular infections (21) and accounts for 10% of
culture-positive microbial keratitis at our institution. S. aureus adheres to the injured cornea (12) and releases
proteins that disrupt corneal tissue (11).
S. aureus possesses a family of adhesins that are localized
at the microbial surface and that interact with extracellular matrix
components such as collagen, fibronectin, fibrinogen, laminin, and
elastin with high affinity and specificity (4, 13). One staphylococcal adhesin is composed of an N-terminal domain with a
collagen-binding site and an antipodal domain that attaches to the
bacterial cell wall and projects into the cytoplasm (16). We
sought to determine whether a rift in the corneal epithelial surface
would increase the risk of corneal adherence and infection by
collagen-binding S. aureus.
Previous animal models of staphylococcal keratitis used direct
intrastromal injection to infect the cornea (1, 2, 5, 7, 9).
However, direct inoculation into the corneal stroma does not allow the
investigation of bacterial adherence to the corneal surface, a critical
initial event in the pathogenesis of microbial keratitis. Because
staphylococci attach to contact lenses (3), an animal model
using soft contact lenses contaminated with S. aureus was
developed to study the role of bacterial adherence in the initiation of
keratitis. To enhance the risk of infection, we applied a high-inoculum
challenge to surface-injured corneas. This model was then used to study
the biological role of the collagen-binding adhesin in S. aureus keratitis by comparing the levels of virulence of a
parental strain (Cna+), its isogenic mutant
(Cna Rabbit model of S. aureus keratitis.
The animals
used in this study were treated according to the criteria of the
Association for Research in Vision and Ophthalmology Resolution on the
Use of Animals in Research. In the first set of experiments, a masked
comparison was made between the Cna+ strain and its
Cna Contact lens contamination.
To determine whether rabbit
corneas were exposed to similar amounts of bacteria, 10 new soft
contact lenses (Acuvue) were incubated in TSB containing
108 bacteria for 24 h at 35°C. The contaminated
contact lenses were washed with phosphate-buffered saline (PBS) to
remove planktonic bacteria and then placed in tubes containing 2 ml of
PBS and 10 glass beads that were vortexed for 2 min to dislodge
adherent bacteria. A 0.5-ml aliquot was removed from the solution, and serial dilutions were plated on blood agar. Colony counts were quantified after 48 h of incubation at 35°C. An average of
2.4 × 106 CFU of the parental Cna+ strain
adhered to each contact lens, which was not significantly different
from the average of 3.6 × 106 CFU per lens for the
Cna Construction of a cna-complemented S. aureus strain.
To restore collagen-binding activity to the
S. aureus isogenic mutant, the entire cna gene
together with upstream DNA was amplified by PCR from S. aureus FDA 574 chromosomal DNA by using Taq polymerase
(Life Technologies, Gaithersburg, Md.) and oligonucleotides 5'
GGTACCGGATCCACAGCTTCCGGTTTAATAGGTGTA 3' (forward) and
5' CGAGGTACCAGAACTAAGAATAGCCTTATC 3' (reverse).
BamHI and KpnI restriction enzyme sites
(underlined) were incorporated into the forward and reverse primers,
respectively. The 4.2-kb PCR product was cloned into the
Escherichia coli vector pGEM-3 (Promega, Madison, Wis.) and
used to transform E. coli JM101 cells. A pGEM-3 derivative
containing the cna gene was digested with
BamHI-EcoRI, releasing a 4.2-kb fragment that was
then ligated to BamHI-EcoRI-cleaved E. coli-S. aureus shuttle vector pL150 encoding chloramphenicol
resistance and transformed into JM101 cells. Plasmid DNA, isolated from
E. coli clones containing the proper plasmid construct, was
then used to electrotransform S. aureus RN4220. To select
for S. aureus RN4220 cells harboring the plasmid, cells were
plated on tryptic soy agar (TSA) containing 5 µg of chloramphenicol
per ml. Chloramphenicol-resistant (Cmr) S. aureus colonies were screened by restriction digest analysis, and
one transformant was selected (pCNA4.2). Finally, pCNA4.2 from S. aureus RN4220 was used to electrotransform the
gentamicin-resistant (Gmr) isogenic mutant. Transformants
were plated on TSA containing gentamicin at 10 µg/ml and
chloramphenicol at 5 µg/ml, yielding a Gmr
Cmr transformant containing pCNA4.2.
Collagen-binding activity of S. aureus strains.
The parental Cna+ strain, its Cna
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The Collagen-Binding Adhesin Is a Virulence Factor
in Staphylococcus aureus Keratitis


![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References
), and the isogenic mutant complemented with an
intact version of the gene (cna) encoding the
collagen-binding adhesin. We also studied the protective effect of
applying adhesin analogs before bacterial challenge.
isogenic mutant (15). New Zealand White
rabbits (eight in each group) were anesthetized by subcutaneous
injection of ketamine (35 mg/kg of body weight) and xylazine (5 mg/kg
of body weight). The corneal epithelium of the right eye of each rabbit
was marked with a 9-mm trephine and then debrided within this area by
using a Paton spatula. New etafilcon A contact lenses (Acuvue;
Vistakon, Jacksonville, Fla.) that had been incubated at 35°C for
24 h in tryptic soy broth (TSB) containing 108 CFU/ml
were placed onto the deepithelialized corneas. The nictitating membranes were removed to prevent dislocation of the contact lens, and
the eyelids were sutured closed with 6-0 braided polyester. Eyelids
were opened 48 h after contact lens placement, and slit-lamp biomicroscopy of the rabbit corneas was performed to determine the
presence or absence of an epithelial defect with stromal suppuration. To confirm the presence of S. aureus, corneal scrapings were
inoculated onto blood agar plates and incubated at 35°C. Corneas were
then removed, embedded in paraffin, sectioned at 6 µm, stained with hematoxylin-eosin, and examined by light microscopy. In a second set of
experiments, the virulence levels of the Cna
mutant and
its complemented derivative were compared by using the same rabbit
model (five rabbits in each group).
mutant (P = 0.61).
isogenic
mutant, and the cna-complemented strain (Cna+)
were analyzed for their collagen-binding activity. As shown in Fig.
1, S. aureus Cna+
and Cna
strains bound 75.3 and 3.7%, respectively, of
the added 125I-labeled bovine collagen type II. The
cna-complemented strain bound levels of
125I-labeled collagen similar to those of the wild-type
strain.

View larger version (37K):
[in a new window]
FIG. 1.
Differential binding of 125I-labeled
collagen type II by S. aureus strains. The strains were
incubated with 5 × 104 cpm of
125I-labeled collagen type II for 1 h at room
temperature. Bacterial binding was quantified as described previously
(20). Each sample was done in duplicate, and results are
expressed as the mean ± standard deviation for the
Cna+ parental strain (Phillips), the Cna
isogenic mutant (PH100), and the cna-complemented mutant
(PH101).
Comparison of S. aureus strains in the rabbit model of
keratitis.
The corneas from six (75%) of the rabbits subjected to
soft contact lenses contaminated with the parental Cna+
S. aureus strain developed bacterial keratitis, as evidenced by dense, suppurative stromal infiltration. Cultures confirmed the
presence of S. aureus in all inflamed corneas. None of the corneas exposed to the isogenic mutant developed suppurative keratitis, even though in all cases the induced epithelial defect was visible. The
difference between the two groups was statistically significant (P = 0.007). Histopathological examination of corneas
exposed to the parental Cna+ S. aureus strain
revealed bacteria attached to the corneal surface and within the
corneal stroma, dense neutrophil infiltration, and a marked disruption
of tissue integrity (Fig. 2).
|
mutant developed bacterial keratitis. Corneal
scrapings demonstrated the presence of S. aureus in all
clinically infected corneas.
Effect of topical adhesin on S. aureus corneal adherence. A recombinant version of the collagen adhesin containing the entire A-domain (M55; amino acid residues 30 to 529) was produced by using the pOE vector (Qiagen, Chatsworth, Calif.) as described previously (14). The purified protein was dissolved in PBS to yield a solution containing 200 µg/ml (8). After debriding of the corneal epithelium, 9-mm-diameter central corneal buttons were excised and either were processed immediately or were first immersed in the adhesin solution for 15 min (two buttons in each group). Five microliters of TSB containing 108 CFU/ml was applied to the surface of each corneal button, which was then incubated at room temperature for 60 min. Scanning electron microscopy showed that the mean number of adherent bacteria in the nonpretreated control group was 7.5 × 104 per mm2 of corneal surface area, while that of the pretreated corneas averaged 1.2 × 104 per mm2.
Bacterial adherence involves surface-associated microbial proteins that bind to tissue ligands (6, 18). The collagen adhesin of S. aureus is a virulence factor in experimental bacterial arthritis and osteomyelitis (19). We now report that a contact lens-associated ulcerative keratitis model can be used to investigate the dynamics of bacterial adherence to the injured corneal surface. Significantly more eyes exposed to collagen-binding strains of S. aureus developed bacterial keratitis than eyes exposed to an isogenic mutant lacking a functional collagen-binding adhesin. Adhesin analogs decreased the amount of S. aureus adhering to the deepithelialized cornea. These findings implicate the role of adhesin-mediated bacterial adherence to the cornea's substrata in the pathogenesis of S. aureus keratitis. Additional adhesion mechanisms may also be involved in initiating staphylococcal corneal infection (10, 17), since only one-third of our human S. aureus corneal isolates bind collagen (data not shown). Our cna-deficient mutant caused bacterial keratitis in a few animals, and preliminary experiments showed similar rates of corneal infection for both an S. aureus strain that does not bind collagen and its isogenic mutant into which the cna gene was introduced. Also, topical ophthalmic adhesins attenuated, but did not avert, bacterial keratitis following S. aureus challenge (data not shown). This study demonstrates that the collagen-binding adhesin is a virulence factor for S. aureus keratitis. A better understanding of the early events that cause bacterial infection of the cornea may lead to the development of therapeutics that can inhibit bacterial binding and prevent microbial keratitis.| |
ACKNOWLEDGMENTS |
|---|
This research was supported by a Research Award from the Eye Bank Association of America, an unrestricted grant from Research to Prevent Blindness, the Sid Richardson Foundation, and grants from the National Eye Institute and the National Institute of Arthritis and Musculoskeletal and Skin Diseases. K. R. Wilhelmus is an RPB Senior Scientific Investigator.
We thank Rebecca Penland for helping with the bacteriological cultures, Amy Schneider for assisting with the molecular biological studies, Frank Kretzer and Ramon Font for supervising histopathological processing and photomicrography, and Patricia Chévez-Barrios for performing electron microscopy.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: 6565 Fannin St., Suite NC205, Houston, TX 77030. Phone: (713) 798-5952. Fax: (713) 798-4142. E-mail: kirkw{at}bcm.tmc.edu.
Present address: Inhibitex, Inc., Alpharetta, GA 30004.
Present address: Microbiology Department, SmithKline Beecham,
Collegeville, PA 19426.
Editor: E. I. Tuomanen
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Callegan, M. C.,
J. A. Hobden,
J. M. Hill,
M. S. Insler, and R. J. O'Callaghan.
1992.
Topical antibiotic therapy for the treatment of experimental Staphylococcus aureus keratitis.
Investig. Ophthalmol. Vis. Sci.
33:3017-3023 |
| 2. |
Davis, S. D.,
L. D. Sarff, and R. A. Hyndiuk.
1978.
Staphylococcal keratitis. Experimental model in guinea pigs.
Arch. Ophthalmol.
96:2114-2116 |
| 3. | Fleiszig, S. M., D. J. Evans, M. F. Mowrey-McKee, R. Payor, T. S. Zaidi, V. Vallas, E. Muller, and G. B. Pier. 1996. Factors affecting Staphylococcus epidermidis adhesion to contact lenses. Optom. Vis. Sci. 73:590-594[CrossRef][Medline]. |
| 4. | Foster, T. J., and M. Höök. 1998. Surface protein adhesins of Staphylococcus aureus. Trends Microbiol. 6:484-488[CrossRef][Medline]. |
| 5. | Fukuda, M., A. Inoue, and K. Sasaki. 1999. An animal model of corneal bacterial infection induced by intracorneal injection of Staphylococcus epidermidis. Nippon Ganka Gakkai Zasshi 103:506-511[Medline]. |
| 6. |
Hartford, O.,
D. McDevitt, and T. J. Foster.
1999.
Matrix-binding proteins of Staphylococcus aureus: functional analysis of mutant and hybrid molecules.
Microbiology
145:2497-2505 |
| 7. |
Kupferman, A., and H. M. Leibowitz.
1976.
Quantitation of bacterial infection and antibiotic effect in the cornea.
Arch. Ophthalmol.
94:1981-1984 |
| 8. |
Mohamed, N.,
M. A. Teeters,
J. M. Patti,
M. Höök, and J. M. Ross.
1999.
Inhibition of Staphylococcus aureus adherence to collagen under dynamic conditions.
Infect. Immun.
67:589-594 |
| 9. | Mohan, M., J. L. F. Sangawe, and V. M. Mahajan. 1984. Pathogenesis of experimentally produced corneal ulcers in rabbits. Ann. Ophthalmol. 16:246-252[Medline]. |
| 10. | Montanaro, L., C. R. Arciola, L. Baldassarri, and E. Borsetti. 1999. Presence and expression of collagen adhesin gene (cna) and slime production in Staphylococcus aureus strains from orthopaedic prosthesis infections. Biomaterials 20:1945-1999[CrossRef][Medline]. |
| 11. | O'Callaghan, R. J. 1999. Role of exoproteins in bacterial keratitis. Cornea 18:532-537[Medline]. |
| 12. |
Panjwani, N.,
B. Clark,
M. Cohen,
M. Barza, and J. Baum.
1990.
Differential binding of P. aeruginosa and S. aureus to corneal epithelium in culture.
Investig. Ophthalmol. Vis. Sci.
31:696-701 |
| 13. | Patti, J. M., B. L. Allen, M. J. McGavin, and M. Höök. 1994. MSCRAMM-mediated adherence of microorganisms to host tissues. Annu. Rev. Microbiol. 48:585-617[Medline]. |
| 14. | Patti, J. M., J. O. Boles, and M. Höök. 1993. Identification and biochemical characterization of the ligand binding domain of the collagen adhesin from Staphylococcus aureus. Biochemistry 32:11428-11435[CrossRef][Medline]. |
| 15. |
Patti, J. M.,
T. Bremell,
D. Krajewska-Pietrasik,
A. Abdelnour,
A. Tarkowski,
C. Rydén, and M. Höök.
1994.
The Staphylococcus aureus collagen adhesin is a virulence determinant in experimental septic arthritis.
Infect. Immun.
62:152-161 |
| 16. |
Patti, J. M.,
H. Jonsson,
B. Guss,
L. M. Switalski,
K. Wiberg,
M. Lindberg, and M. Höök.
1992.
Molecular characterization and expression of a gene encoding a Staphylococcus aureus collagen adhesin.
J. Biol. Chem.
267:4766-4772 |
| 17. | Schwab, U., H. J. Thiel, K. P. Steuhl, and G. Doering. 1996. Binding of Staphylococcus aureus to fibronectin and glycolipids on corneal surfaces. Ger. J. Ophthalmol. 5:417-421[Medline]. |
| 18. |
Snodgrass, J. L.,
N. Mohamed,
J. M. Ross,
S. Sau,
C. Y. Lee, and M. S. Smeltzer.
1999.
Functional analysis of the Staphylococcus aureus collagen adhesin B domain.
Infect. Immun.
67:3952-3959 |
| 19. | Switalski, L. M., J. M. Patti, W. Butcher, A. G. Gristina, P. Speziale, and M. Höök. 1993. A collagen receptor on Staphylococcus aureus strains isolated from patients with septic arthritis mediates adhesion to cartilage. Mol. Microbiol. 7:99-107[Medline]. |
| 20. |
Switalski, L. M.,
P. Speziale, and M. Höök.
1989.
Isolation and characterization of a putative collagen receptor from Staphylococcus aureus strain Cowan-1.
J. Biol. Chem.
264:21080-21086 |
| 21. | Wilhelmus, K. R. 1988. The red eye. Infectious conjunctivitis, keratitis, endophthalmitis, and periocular cellulitis. Infect. Dis. Clin. N. Am. 2:99-116[Medline]. |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»