Previous Article | Next Article 
Infection and Immunity, July 2000, p. 4064-4074, Vol. 68, No. 7
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Full Capacity of Recombinant Escherichia coli
Heat-Stable Enterotoxin Fusion Proteins for Extracellular Secretion,
Antigenicity, Disulfide Bond Formation, and Activity
Isabelle
Batisson,
Maurice
Der Vartanian,*
Brigitte
Gaillard-Martinie, and
Michel
Contrepois
Laboratoire de Microbiologie, Institut
National de la Recherche Agronomique, Centre de Recherches de
Clermont-Ferrand-Theix, 63122 Saint-Genès-Champanelle, France
Received 21 January 2000/Returned for modification 22 March
2000/Accepted 24 April 2000
 |
ABSTRACT |
We have successfully used the major subunit ClpG of
Escherichia coli CS31A fimbriae as an antigenic and
immunogenic exposure-delivery vector for various heterologous peptides
varying in nature and length. However, the ability of ClpG as a carrier
to maintain in vitro and in vivo the native biological properties of
passenger peptide has not yet been reported. To address this
possibility, we genetically fused peptides containing all or part of
the E. coli human heat-stable enterotoxin (STh) sequence to
the amino or carboxyl ends of ClpG. Using antibodies to the ClpG and
STh portions for detecting the hybrids; AMS
(4-acetamido-4'-maleimidylstilbene-2,2'-disulfonate), a potent free
thiol-trapping reagent, for determining the redox state of STh in the
fusion; and the suckling mouse assay for enterotoxicity, we
demonstrated that all ClpG-STh proteins were secreted in vitro and in
vivo outside the E. coli cells in a heat-stable active oxidized (disulfide-bonded) form. Indeed, in contrast to many earlier
studies, blocking the natural NH2 or COOH extremities of
STh had, in all cases, no drastic effect on cell release and toxin
activity. Only antigenicity of STh C-terminally extended with ClpG was
strongly affected in a conformation-dependent manner. These results
suggest that the STh activity was not altered by the chimeric
structure, and therefore that, like the natural toxin, STh in the
fusion had a spatial structure flexible enough to be compatible with
secretion and enterotoxicity (folding and STh receptor recognition).
Our study also indicates that disulfide bonds were essential for
enterotoxicity but not for release, that spontaneous oxidation by
molecular oxygen occurred in vitro in the medium, and that the E. coli cell-bound toxin activity in vivo resulted from an effective
export processing of hybrids and not cell lysis. None of the ClpG-STh
subunits formed hybrid CS31A-STh fimbriae at the cell surface of
E. coli, and a strong decrease in the toxin activity was
observed in the absence of CS31A helper proteins. In fact, chimeras
translocated across the outer membrane as a free folded monomer once
they were guided into the periplasm by the ClpG leader peptide through
the CS31A-dependent secretory pathway. In summary, ClpG appears highly
attractive as a carrier reporter protein for basic and applied research
through the engineering of E. coli for culture supernatant
delivery of an active cysteine-containing protein, such as the
heat-stable enterotoxin.
 |
INTRODUCTION |
The plasmid-encoded heat-stable
enterotoxin (STa) produced by enterotoxigenic strains of
Escherichia coli is a major cause of diarrheal diseases in
infants in developing countries, travelers to areas of endemicity, and
domestic livestock (1). STa exerts its toxic effects at the
level of the mammalian small intestine, where it causes fluid
accumulation by specific binding to the high-affinity transmembrane
guanylate cyclase C receptor present on intestinal enterocytes
(36). A highly conserved C-terminal sequence including six
cysteines that form three intramolecular disulfide bonds (Fig. 1) is
required for STa receptor binding (8), full biological
activity (14), and heat stability (18). STa falls
into two classes. The 18-amino-acid STa designated STp and the
19-amino-acid STa designated STh originated from porcine and human
strains, respectively. The nucleotide sequences of genes coding for
different STa toxins have been determined elsewhere (19,
38). Both STp and STh are typical extracellular toxins and are
synthesized as a Pre-Pro-STa precursor of 72 amino acid residues
(29, 31). The Pre region functions as a leader peptide, the
Pro region is cleaved in the periplasmic space where the disulfide bonds of STa are formed with the help of DsbA oxidoreductase
(43), and the mature folded form of STa passes through the
outer membrane. The Pro sequence has been proven to be nonessential for
extracellular toxin release (29). Mature STa without the Pro
sequence may be able to gain access to the extracellular milieu upon
its entry into the E. coli periplasm once guided into this
compartment by a heterologous periplasmic leader peptide
(35). Conflicting observations (31, 43-45) have
been reported for the mechanism of secretion of the toxin from the
periplasm to the exterior of the cell, making this mechanism poorly
understood. Such disagreement may be explained by the small size of the
STa molecule and the escape velocity with which it is released into the
extracellular milieu, and thus by the difficulty of detecting and
quantifying the intermediates in the different cellular compartments.
In addition, STa is poorly antigenic and not immunogenic and reacts
unpredictably with conventional protein treatments such as staining,
trichloroacetic acid (TCA) precipitation, and electrophoresis
(30), thus limiting progress in the study of STa secretion
and in vaccine development. For these reasons, a number of efforts have
been made to develop genetic fusions between STa and several carrier
proteins to facilitate STa detection in secretion and folding studies
and to elicit neutralizing and protective antibodies raised against the
native three-dimensional structure of STa. These carriers were E. coli heat-labile enterotoxin A subunit (33) or B
subunit (3, 9, 20), cholera enterotoxin B subunit
(34), E. coli outer membrane protein OmpC
(32), E. coli maltose-binding protein
(2), a synthetic immunoglobulin G (IgG)-binding fragment
derived from Staphylococcus aureus protein A
(25), and staphylococcal nuclease A (29, 42).
However, in most cases, no hybrid protein with properly folded STa
joined covalently to the carrier protein was both extracellularly
secreted and fully active. In contrast, in this work, we report that
fusions between STa (STh) and the major subunit ClpG of E. coli CS31A fimbriae (16, 17) were secreted outside the
cells through the CS31A-dependent pathway as an antigenic heat-stable
enterotoxic protein.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and media.
E. coli DH5
[F
supE44
(argF-lacZYA)U169 (
80d
lacZ
M15) hsdR17
(rK
mK+) recA1
endA1 gyrA96 (Nalr) thi-1 relA1] (Gibco
BRL) was used as the host strain for recombinant proteins. The bovine
enterotoxigenic E. coli isolate B41
(O101:K
:H
; K99 or F41) was used as the
reference STp enterotoxin-producing strain (38). Bacteria
were grown at 37°C in Luria-Bertani (LB) broth or on LB agar
supplemented with the following antibiotics: ampicillin, 50 µg/ml;
chloramphenicol, 25 µg/ml.
Construction of fusion genes.
Plasmids pEH524
(26), pDSPH524 (6), and pDEV41155
(10) were previously constructed. pEH524 and its
derivative pDSPH524 have a pSC101 replicon, while
pDEV41155 contains a pColE1 replicon. The pEH524-determined
clp gene cluster contains seven structural genes encoding
all the secretory proteins required for CS31A biogenesis (26), including the major 257-amino-acid subunit ClpG
encoded by the clpG gene (17) and several minor
proteins involved in the cell surface assembly of the CS31A
polymer. Plasmid pDSPH524 is pEH524 with clpG
deleted, and plasmid pDEV41155 is pBluescript (pSK+;
Stratagene) with clpG only. All constructions specific to
this work are shown in Fig. 1. Plasmid pHPCO838 was constructed from
pDEV41155 by in vitro site-directed mutagenesis using mutagenic and
selection primers. The former primer
(5'-CGTGGCAGTAACTTATGTTAACTAATTGGCTTGA-3') created a unique
HpaI site and added a valine residue between the penultimate
tyrosine and the last C-terminal residue (asparagine) of ClpG. The
latter primer (5'-CGCAGGAAAGAAGATCTGAGCAAAAGGCG-3') mutated
the single AflIII restriction site of the pSK+ plasmid vector into a single BglII site. An additional valine at the
C terminus of ClpG expressed by pHPCO838 did not affect the formation of CS31A fimbriae at the cell surface. Plasmid pSTN24 was engineered from pHPCO838 as follows: a synthetic double-stranded DNA (the 5'
3'
single coding strand was
CGGCAGATCTGTACTG CTGTGAACTTTGTTGTAATCCTGCCTGTACAGGATGTTACCCTGCAG ATCCTCATG)
encoding the last 15 amino acids of mature STh (mSTh) followed by the hexapeptide PADPHA and containing
SphI-flanked ends was inserted in frame in the correct
orientation into the SphI site of pHPCO838. Plasmid pSTC22
was constructed by cloning a synthetic DNA duplex (the 5'
3' single
coding strand was
AACCCTGATAACCCCGGGAACTACTGCTGTGAACTTTGTTGTAATCCTGCCTGTACAGGATGTTACTAA) encoding the heptapeptide VNPDNPG followed by the last 16 amino acids of mSTh and containing HpaI and SmaI
sites, between the HpaI and XbaI sites of
pHPCO838. We constructed pSTC17 by deleting the
HpaI/SmaI fragment from pSTC22, resulting in the
addition of only two amino acid residues (VG) between ClpG and STh.
Plasmid pProSTC28 was made by inserting a blunt-ended
double-stranded DNA fragment (the 5'
3' single coding strand was
AACAAAAGTGGTCCTGAATCGATGAATTCTAGC) encoding amino acid
residues 46 to 53 (NKSGPESM) of the Pro-STa peptide plus the first
three residues (NSS) of mSTh between the HpaI and
SmaI sites of pSTC22.
Plasmids pEHSTN24 and pEHSTC22 consisted of pEH524 in
which the ClpG-encoding SwaI-HpaI fragment was
replaced by the hybrid-encoding EcoRV-Ecl136II
fragment from pSTN24 and pSTC22, respectively. Plasmid
pEHProSTC28 was pEH524 in which the ClpG-encoding
MunI-HpaI fragment was replaced by the
hybrid-encoding MunI-Ecl136II fragment from
pProSTC28. Therefore, pEHSTN24 and pSTN24 carry the same fusion, as do pEHProSTC28 and pProSTC28, and pEHSTC22 and
pSTC22. Because many attempts to subclone the fusion gene from pSTC17 into the clp operon failed, we trans complemented
pSTC17 with pDSPH524 to allow hybrid CS31A formation. Synthetic
oligonucleotides were purified by reverse-phase chromatography
(Eurogentec, Seraing, Belgium), and gene fusions were checked by sequencing.
Production of fusion proteins.
LB broth preculture (1 or 2 ml) containing exponentially growing cells was poured onto LB plates
which were incubated overnight at 37°C in a humid atmosphere with the
agar surface facing up. Bacteria were carefully harvested by being
scraped from the agar surface, and the final suspension volume was made
up to 2 ml with phosphate-buffered saline (PBS). After centrifugation
at 12,000 × g for 10 min, the resulting supernatants
were designated the solid culture supernatant fractions. Cell pellets
were suspended and washed in PBS and resuspended in PBS in a final
volume of 2 ml. This suspension was then divided into two equal parts.
One part was used as the whole-cell fraction. The other part was
sonicated and centrifuged, and the resulting supernatant was referred
to as the cell sonicate fraction. Supernatants from LB broth cultures were obtained after centrifugation and used as the liquid culture supernatant fractions. The bacterial enumeration with data expressed in
CFU per milliliter was done by spreading out dilutions of PBS-suspended cells on MacConkey lactose agar medium containing the appropriate antibiotic and incubating them overnight at 37°C.
Competitive ELISA.
Competitive enzyme-linked immunosorbent
assay (ELISA) using the commercially available assay kit for E. coli STa (COLI ST EIA) produced by Denka Seiken Co., Ltd., Tokyo,
Japan (37), was performed to detect fusion proteins in
culture supernatants. The reactivity of the STa moiety of hybrids was
determined by using a supplied STa-monospecific horseradish peroxidase
(HRP)-conjugated antibody and ELISA plates coated with synthetic STa
peptide. After wells were washed once with the supplied buffer, 200 µl of various dilutions of the supernatant to be tested and 10 µl
of conjugated monoclonal antibody were added. Following incubation for
90 min at room temperature, the wells were washed five times with
buffer. Enzyme substrate solution (100 µl), prepared by adding an
H2O2 solution to o-phenylenediamine,
was added, and the plate was left in the dark at room temperature for
30 min. The reaction was stopped by addition of 100 µl of 1.5 N
H2SO4, and the absorbance at 490 nm
(A490) was measured using a Dynatech MR5000
microplate reader. A positive sample was identified by inhibition of
binding of HRP-conjugated monoclonal antibodies to the well, as
demonstrated by a decrease in A490 (Fig. 2). The
positive samples were defined as giving an A490
of <0.2 (as this is a competitive assay), and the negative samples
were defined as giving an A490 of
1.2.
Double-antibody sandwich ELISA.
Microtiter plates (Immulon
2; Dynatech) were coated by overnight incubation at 4°C with 100 µl
of the STa-specific monoclonal antibody 11C (42) diluted
1:250 in 50 mM carbonate buffer (pH 9.6). After removal of buffer,
plates were incubated overnight at 4°C with blocking buffer (PBS-2%
dry milk-1% fetal calf serum) and washed twice with PBS-0.05% Tween
20 and once with PBS. Supernatants were serially plated in twofold
dilutions (100 µl per well) in antibody buffer (PBS-0.2% dry
milk-0.5% fetal calf serum) and incubated for 2 h at 37°C.
After washing twice with PBS-0.05% Tween 20 and once with PBS, 100 µl of 1:500-dilution rabbit anti-ClpG antiserum (16) was
dispensed in each well and the plates were incubated for 90 min at
37°C. After washing, 100 µl of 1:1,000-dilution goat anti-rabbit
HRP-conjugated IgG was added and the plates were incubated for 2 h
at 37°C. After washing, 100 µl of 2 nM H2O2 and 10 mg of ABTS [2-2'-azino-bis
(3-ethylbenzthiazoline-6-sulfonic acid) diammonium salt] (Sigma)
substrate in 100 ml of phosphate-citrate buffer (80 mM citric acid, 125 mM Na2HPO4) were added and the plates were
incubated for 20 min in the dark at room temperature. The
A405 was read on a Dynatech MR5000 reader.
Western immunoblotting.
Samples were mixed with an equal
volume of 2× Laemmli buffer, boiled for 5 min, applied to a sodium
dodecyl sulfate-15% polyacrylamide gel, and semidry
electrotransferred onto 0.2-µm nitrocellulose paper (Bio-Rad). Blots
were blocked and washed with 1% bovine serum albumin-0.1% Tween 20 in Tris-buffered saline (TBS) and incubated overnight with primary
antibodies, including ClpG-specific rabbit antiserum (16)
and the STa-monospecific antibodies 11C (40) and 20C1
(7). Filters were then developed with secondary goat
anti-rabbit or anti-mouse HRP-conjugated IgG and with
H2O2-
-chloronaphthol as a substrate. In
another procedure for development of Western blots, a 1:1,000 dilution
of biotinylated IgG (Sigma) in TBS-0.05% Tween 20 was used as
secondary antibody. After incubation for 1 h and washing,
membranes were again incubated for 30 min with a 1:100 dilution of
HRP-conjugated streptavidin (250 µg/ml; Sigma) in TBS-0.05% Tween
20 and developed with H2O2-
-chloronaphthol.
Assay for enterotoxin activity.
Enterotoxin activity of
supernatant fractions was examined in the suckling mouse assay as
described previously (15). Three-day-old Swiss OF1 suckling
mice were separated from their mothers immediately before use and
randomly divided into groups. A 0.1-ml aliquot of each sample was
directly delivered to the stomach of infant mice using a flexible
plastic tube. Three hours later, the entire intestine from each mouse
was removed and weighed, and the ratio of the gut weight to the
remaining carcass weight (G/C ratio) was calculated. The mean G/C ratio
and standard error of the mean of several separated assays were
determined for each mouse batch. A G/C ratio of
0.090 corresponded to
unambiguous accumulation of fluid in the gut lumen. One mouse unit (MU)
was defined as the enterotoxin activity corresponding to a minimum
effective dose that gave a positive response. In our study, the minimum effective dose of STa necessary to produce an activity of 1 MU was 8 ng, as determined by using pure toxin STp (Calbiochem).
Redox state analysis of hybrid toxin.
Redox states of
extracellular fusion proteins were assessed as previously described
(21). Culture supernatants were incubated on ice for 1 h with final 5% TCA. As indicated, when necessary, 100 mM
dithiothreitol (DTT) was added, and the mixture was incubated for 10 min at 37°C before the TCA precipitation step to completely reduce
extracellular proteins. The precipitates were centrifuged at
16,000 × g for 15 min at 4°C, and the supernatants
were discarded. The pellets were then washed with cold acetone and
after centrifugation were air dried. The precipitates were resuspended
in 0.1 mM 1% SDS-50 mM Tris-HCl (pH 8.0)-1 mM EDTA containing 10 mM
AMS (4-acetamido-4'-maleimidylstilbene-2,2'-disulfonate) (Molecular
Probes, Inc.). Proteins were separated by nonreducing SDS-12%
polyacrylamide gel electrophoresis (PAGE), transferred to a
nitrocellulose membrane, and probed with anti-ClpG or anti-STa antibodies.
Quantitation of free thiols.
Quantitation of free thiols in
supernatants was determined by using the Thiol and Sulfide Quantitation
kit from Molecular Probes as recommended by the suppliers. In this
sensitive spectrophotometric assay, thiols reduce an inactive disulfide
derivative of papain (papain-S-SCH3), stoichiometrically releasing the
active enzyme (papain-SH). The reactivated papain catalyzes the
hydrolysis of the chromogenic substrate,
N-benzoyl-L-arginine-p-nitroanilide (L-BAPNA), resulting in an amplified spectrophotometric
signal proportional to the initial amount of thiol. The activity of the enzyme is evaluated by measuring the A410 of the
p-nitroaniline chromophore released from
L-BAPNA. The thiol concentration in the samples was read at
A410 from the standard curve generated in the
papain-S-SHC3-based assay using an 0.1 mM L-cysteine
working solution as a thiol standard. This solution was previously
calibrated by the Ellman assay (13,600 M
1
cm
1 is the molar extinction at 412 nm of
5-thio-2-nitrobenzoate generated from Ellman's reagent in reacting
with the free thiol of the L-cysteine).
Cell surface detection of fusion proteins.
The CS31A
heteropolymer, a class 3-related fimbria (24), mediates
E. coli and Klebsiella pneumoniae adhesion to the
human intestinal cell line Intestine-407 (12) through the
receptor-binding domain of the ClpG protein (13). Therefore,
formation of CS31A-STh fimbriae at the cell surface of recombinant
E. coli DH5
strains was examined by adhesion assay on
monolayers of Intestine-407 cells and by electron microscopy after
immunogold labeling with primary rabbit anti-ClpG antibodies and
secondary goat anti-rabbit colloidal gold-labeled IgG (Sigma). The
adherence and immunolabeling assays were performed as previously
described by Di Martino et al. (13) and Der Vartanian et al.
(10), respectively. Strains DH5
(pEH524) and
DH5
(pDSPH524) were used as positive and negative controls, respectively.
 |
RESULTS |
Fusion proteins are extracellularly secreted.
Four distinct
ClpG-STh fusion proteins with a foreign insert of 17 to 28 amino acids
in length were obtained (Fig. 1). Hybrids in supernatants were detected by competitive and double-antibody sandwich ELISAs using microtiter plates precoated with synthetic STa
(Fig. 2A) and STa-monospecific antibody
11C (Fig. 2B), respectively. Supernatants of strains harboring
pEHSTC22, pEHProSTC28, or, to a lesser extent,
pSTC17+pDSPH524 reacted with 11C (Fig. 2). In contrast, the
supernatant of DH5
(pEHSTN24) retained no (Fig. 2A) or little
(Fig. 2B) affinity for 11C. In the two ELISAs, maximum expression of
antigenicity was obtained with hybrid STh from DH5
(pEHSTC22) and DH5
(pEHProSTC28).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 1.
Structure of fusion proteins. (A) The STh enterotoxin
structure. The STh (STa3) sequence is from the work of Guzman-Verduzco
and Kupersztoch (19). Only amino acid residues 46 to 72 of
the Pre-Pro-STh precursor are shown in boldface. The six cysteines
involved in the three disulfide bonds are indicated. (B) ClpG-STh
fusion proteins. An additional valine at the C terminus of ClpG
expressed by pHPCO838 did not affect the formation of CS31A fimbriae at
the cell surface. Plasmids pEHSTN24 and pSTN24 carry the same
fusion, as do pEHProSTC28 and pProSTC28, and pEHSTC22 and
pSTC22 (see Materials and Methods). The numbers in lightface above the
boxes are the positions of the amino acid residues relative to the
signal peptide cleavage site 1/+1 of the ClpG precursor (B), and
those in boldface are the positions of the amino acid residues relative
to the STh precursor (A and B). Indicated amino acids represent either
residues composing the sequence of the linker at the ClpG-STh junction
or residues introduced in ClpG by site-directed mutagenesis (marked by
an asterisk).
|
|

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 2.
Detection of fusion proteins. (A) Culture supernatants
were assayed for the presence of STh in the hybrid by competitive
ELISA, consisting of the addition of various dilutions of the
supernatant and of STa-monospecific HRP-conjugated antibodies to plates
coated with synthetic STa. A positive sample was identified by binding
inhibition of STa-specific HRP-conjugated monoclonal antibody to the
immobilized STa as monitored by a decrease in
A490. A sample giving an
A490 of 1.2 contained no STh. (B)
Double-antibody sandwich ELISA consisted of the addition of serially
twofold-diluted supernatant sample to plates coated with the
STa-monospecific 11C antibody followed by binding of rabbit anti-ClpG
antibodies. Antibody binding was detected by the measurement of
A405 using HRP-labeled goat anti-rabbit IgG. The
double-sandwich ELISA was performed to ensure probing of the entire
hybrid proteins, thus overcoming the risk of detection of intact STh
free of ClpG.
|
|
Secretion of hybrids was also analyzed by Western immunoblotting using
ClpG-specific antiserum (Fig.
3A and B)
and two distinct
STa-monospecific antibodies (Fig.
3C and D).
Immunoblots of the
liquid (Fig.
3A) and solid (Fig.
3B) culture
supernatant fractions
showed identical electrophoretic profiles. The
yield of proteins
in supernatants from plate-grown cultures (5 × 10
10 to 2 × 10
11 CFU/ml) greatly exceeded
that from broth cultures (1 × 10
9 to 2 × 10
9 CFU/ml), explaining why samples from solid cultures
were preferentially
used throughout this study. Hybrids encoded by
pEHSTN24 and pEHSTC22
(Fig.
3B, lanes 1 and 2) were visualized
as a single protein band
migrating more slowly than native ClpG. By
contrast, those specified
by pEHProSTC28 and
pDSPH524+pSTC17 (Fig.
3B, lanes 3 and 4) migrated
as two
protein bands, the lower running like ClpG. A chimera from
pEHSTN24
reacted with anti-ClpG (Fig.
3B, lane 1) but not with
anti-STa
antibodies (Fig.
3C and D, lane 1), indicating, together
with the
competitive ELISA data (Fig.
2), a very low antigenicity
due to the
fusion rather than a loss of the STh moiety from the
hybrid. In
contrast (Fig.
3C and D), the single protein from pEHSTC22
(lane 2)
and the upper proteins from pEHProSTC28 (lane 3) and
pDSPH524+pSTC17 (lane 4) reacted with anti-STa antibodies.
Therefore,
the single proteins from pEHSTN24 and pEHSTC22, and
the upper
proteins from pEHProSTC28 and pDSPH524+pSTC17,
represented the
full-length hybrid molecules. The degradation product
from pEHProSTC28
reacted only with anti-ClpG (Fig.
3A and B, lane
3), while the
one from pDSPH524+pSTC17 was additionally
detected with 11C and
20C1 (Fig.
3, lane 4), suggesting that some
hybrids from pEHProSTC28
and pDSPH524+pSTC17 were
C-terminally and N-terminally cleaved,
respectively.

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 3.
Immunoblot analysis of fusion proteins produced by
E. coli DH5 harboring the indicated plasmid. Lanes:
1, pEHSTN24; 2, pEHSTC22; 3, pEHProSTC28; 4, pSTC17+pDSPH524. Recombinants were cultured at 37°C in LB liquid
(A) or LB agar medium (B to D). (A) Supernatants were from broth
cultures containing 1 × 109 to 2 × 109 CFU/ml. (B) Supernatants were from plate-gown cultures
containing 5 × 1010 to 2 × 1011
CFU/ml. Supernatant samples were boiled in Laemmli buffer with -ME
and loaded onto 0.1% SDS-15% polyacrylamide gels. After
electrophoresis, proteins were electrotransferred to nitrocellulose
membranes and incubated either with ClpG-specific antiserum (A and B)
or with the STa-specific monoclonal antibody 11C (C) or 20C1 (D).
HRP-labeled goat anti-rabbit IgG (A and B) or biotin-labeled goat
anti-mouse IgG in concert with HRP-conjugated streptavidin (C and D)
was used as secondary antibody. The arrows at left point to the
position of ClpG as assessed by the simultaneous migration of
ClpG-containing solid culture supernatant from E. coli
DH5 (pEH524) (data not shown).
|
|
Fusion proteins retain full heat-stable enterotoxin activity.
STh activity of the supernatant and of the whole-cell fractions was
determined in vivo by means of a suckling mouse assay and compared with
that of the natural STp toxin produced by the bovine E. coli
B41 strain (Table 1). The measure of the
minimal effective dose allowing expression of enterotoxicity in MU was determined as based on Fig. 4. The mean
G/C ratio values and the score values varied, respectively, between
0.109 and 0.157 and between 75 and 100%, whatever the source of the
fusion proteins (supernatant or whole cell) tested in both solid and
liquid media (Table 1). Thus, in all cases, results showed positive
enterotoxicity. Specific toxin activity in supernatants (expressed in
MU per 1010 CFU) was 27- to 65-fold higher in liquid
culture conditions than in solid culture conditions, probably because
of better oxygenation. Activity of the supernatant of recombinant
E. coli DH5
strains was 0.7- to 2.5-fold higher
than that of the E. coli B41 control strain, and
enterotoxicity of the whole cells reached about 5 to 112% of that of
B41. Overall, the supernatant and whole-cell fractions of
DH5
(pEHProSTC28) appeared as the most highly active samples, whereas those of DH5
(pSTC17+pDSPH524) were the
least active. No enterotoxin activity was detected in cell sonicate fractions (data not shown), suggesting that they contained no or little
properly folded STh. All solid culture supernatant fractions retained
suckling mouse activity even after heat treatment at up to 95°C for
15 min (Table 2). Unexpectedly, hybrid
STh expressed by pSTC17 seemed be more heat stable than the pure native
toxin STp.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Determination of minimal effective dose of the
whole-cell (A) and culture supernatant (B) fractions. Only data
obtained under solid culture conditions are presented as an example for
minimal effective dose calculation. After centrifugation of overnight
cultures, supernatants were separated from the cell pellets which were
washed and suspended with PBS buffer (2 ml). Before centrifugation and
after suspension in PBS, bacteria were enumerated on MacConkey lactose
agar medium. Various dilutions of the supernatant and whole-cell
preparations were tested in the suckling mouse assay. The enterotoxin
titer was expressed as the highest dilution that gave a G/C ratio of
0.090 corresponding to an enterotoxin activity of 1 MU. Each datum
point is the average of G/C ratios, which were plotted
semilogarithmically versus bacterial densities (A) or supernatant
dilution values (B), and the point at which the curve crossed the line
equal to a G/C ratio of 0.090 (dotted line) was defined as the density
(A) or the dilution (B) giving an enterotoxin activity of 1 MU. The
points of the data with whole cells are 108.60,
108.82, 109.20, and 109.96 CFU, for
DH5 (pEHProSTC28), DH5 (pEHSTN24),
DH5 (pEHSTC22), and DH5 (pSTC17+pDSPH524),
respectively.
|
|
Enterotoxicity, but not secretion, is affected by reducing
conditions, and disulfide bonds are able to reform spontaneously with
air oxidation.
Strains were grown with 5 mM
-mercaptoethanol
(
-ME) and the biological properties of STh hybrids after
-ME
reduction were checked (Fig. 5).
Supernatants showed an overall defect in enterotoxicity only when
recombinant strains were cultured in the presence of
-ME (Fig. 5A, a
and b). Reduced hybrids were extracellularly released in vitro since
supernatants from
-ME-grown cultures partially recovered activity
after they had been left overnight in contact with air oxygen (Fig. 5A,
c). To verify the oxidizing effect of air on
-ME-inactivated STh, we
estimated the degree of air oxidation by quantifying the reduced
protein products in the supernatants of
-ME-treated strains and by
testing the activity of these supernatants after exposure to air for 18 and 42 h (Table 3). As a function of
time, increasing activity was correlated with decreasing free thiol
concentration in samples and therefore with increasing oxidation.
Furthermore, live recombinant bacteria previously cultured with
-ME
and then washed with PBS secreted hybrids capable of suckling mouse
activity (Fig. 5B).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of reducing culture conditions on the suckling
mouse activity of the supernatant (A) and whole-cell (B) fractions. LB
broth-grown cells (2 ml) were poured onto LB agar medium containing (A,
b and c, and B) or not (A, a) 5 mM ( -ME) and spread over the agar
surface before overnight incubation at 37°C in a humid atmosphere
with the agar surface facing up. Bacteria were then harvested by being
scraped from the agar surface. After centrifugation, all of the
supernatants were separated from cells (A), and each of them was then
halved. One half was tested as it was (a and b), and the other was kept
overnight at room temperature in contact with air before use (c). The
corresponding -ME-treated cell pellets were washed and resuspended
in PBS, thus constituting the -ME-cleared whole-cell fractions (B).
Bars are the means ± standard errors of 2 determinations using 4 to 12 mice per sample as indicated above the bars. The dotted line
equal to a G/C ratio of 0.090 represents the toxicity threshold above
which the samples are considered positive.
|
|
STh in the fusions is in an oxidized state.
We were able to
achieve very clear separation between the oxidized and reduced forms of
ClpG-STh hybrids by examining the electrophoretic mobility of samples
treated or not with DTT and AMS, which is a potent thiol-blocking
reagent (Fig. 6). Reduced and oxidized
forms of chimeras from supernatant samples were not distinguishable on
immunoblots when they were treated only with either DTT or AMS. In
contrast, hybrids treated with both DTT and AMS showed an upward change
in position. This indicates that the shift of the band position was due
to chemical binding of AMS to the sulfhydryl groups generated by the
reduction of oxidized cysteines by DTT. Consequently,
extracellular hybrids are in an oxidized state. As shown in Fig.
7, in which only the supernatant of
DH5
(pEHProSTC28) is presented as an example,
unoxidized full-length hybrids reacted with anti-ClpG serum (lane +AMS
+DTT) but not with anti-STa antibodies (lanes +AMS +DTT and
AMS
+DTT). In contrast, the oxidized form reacted with both antibodies
(lane
AMS
DTT for anti-ClpG and lanes
AMS
DTT and +AMS
DTT
for anti-STa). Given that ClpG contains no cysteine residue, it is
therefore clear that STh in the fusions is disulfide bonded.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 6.
Redox state of extracellular hybrids. LB broth-gown
cells (2 ml) were poured onto LB agar medium and spread over the agar
surface before overnight incubation at 37°C in a humid atmosphere
with the agar surface facing up. Bacteria were then harvested by being
scraped from the agar surface, separated from supernatants by
centrifugation, and discarded. Supernatants were first reduced (+) or
not ( ) with 100 mM DTT at 37°C for 10 min, precipitated with TCA,
washed with acetone, and then diluted in 1% SDS-1 mM EDTA-50 mM
Tris-HCl (pH 8.0), containing (+) or not ( ) 10 mM AMS. Samples were
subjected to nonreducing SDS-12% PAGE, electrotransfer, and blotting
with anti-ClpG antiserum. AMS is a potent thiol-blocking reagent highly
soluble in aqueous solutions that blocks irreversibly free cysteines by
producing thioesters (21). The reduced and oxidized forms
can be separated by the charge difference due to AMS which increases
the apparent molecular mass by 490 Da. Oxidized forms are resistant to
reaction with AMS and migrate as a lower-molecular-weight protein band
than do reduced forms. The position labeled "red" refers to reduced
STh bound to AMS, while the position labeled "ox" designates either
oxidized STh treated or not with AMS or unoxidized STh uncoupled to
AMS.
|
|

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 7.
STh in the fusion is disulfide bonded. The oxidation
state of the fusion protein present in the overnight solid culture
supernatant of DH5 (pEHProSTC28) was determined as described
in the legend to Fig. 6, except that Western blots were additionally
probed with anti-STa antibodies consisting of a mixture of the
monoclonal antibodies 11C and 20C1.
|
|
CS31A export pathway, but not CS31A biogenesis, is required for
extracellular secretion.
The presence of CS31A-STh hybrid fimbriae
at the cell surface of recombinant bacteria was determined by the
CS31A-mediated adhesion assay on monolayers of the Intestine-407 cell
line and by electron microscopy after immunogold labeling using
anti-ClpG antibodies. All recombinants gave negative results in the two assays (data not shown). The ability of hybrid subunits to polymerize into a chimeric CS31A fimbrial structure was also investigated by
immunoblot analysis using PAGE under nondenaturing conditions (data not
shown). The fusion proteins never appeared as a ladder of oligomeric
bands of regularly increasing molecular mass, constituting the
polymeric form of native CS31A (11). All these data confirm a lack of cell surface assembly of CS31A chimeras.
To gauge the importance of the CS31A export pathway in ClpG-STh protein
release, we used plasmids carrying the
clpG-STh fusion
gene
(Fig.
1) but not the CS31A helper genes encoding the secretory
proteins
required for full CS31A biogenesis. The specific activity
of hybrids
expressed by these plasmids was then measured (Table
4). In all experiments performed in
liquid and solid culture
conditions, only supernatants and whole cells
of DH5

(pProSTC28)
unequivocally displayed secretion and
enterotoxicity. Nevertheless,
this strain had toxin activity at least
one-fifth the level seen
in Table
1, in which all four chimeras are
shown to have enterotoxin
activity. In addition, no chimeric toxin from
pProSTC28 was detected
in immunoblots using anti-ClpG and anti-STa
antibodies (data not
shown), suggesting that processing of native toxin
occurred. These
findings underline the stimulating effect of the CS31A
export
machinery on the secretion of fusion proteins.
 |
DISCUSSION |
Recently, ClpG, the major subunit of E. coli CS31A
fimbriae, has been shown to accept various virus epitopes without
affecting CS31A formation (6, 10, 11, 27). In this study, we
exploited ClpG as a provider of a signal peptide and an extracellular
export carrier for the active cysteine-containing passenger peptide, the small human heat-stable enterotoxin STh of E. coli. We
obtained four distinct ClpG-STh proteins after having fused various
STh-encoding DNA sequences to the 5' or 3' extremity of the
clpG gene. All were secreted in vitro in the culture
supernatants with a heat-stable enterotoxin activity comparable to that
of the natural STa toxin, indicating that they retained a
three-dimensional structure close to that of native STa, which must be
flexible since it is able to tolerate ClpG at its N- or C-terminal end.
Our results indicate a much higher specific activity of toxin from
broth cultures than of that from plate-grown cultures (Table 1). We
speculate that the higher specific activity in broth is due to better
oxygenation, and thus to better oxidation of cysteine-containing
proteins, although protein yields are higher from plate-grown cells
(Fig. 3) and the protein is fully oxidized (Fig. 6). Nevertheless, the fact that protein from solid culture is fully oxidized does not necessarily mean that it is properly folded in an active form. One can
imagine that plate-grown cultures generate more chimeric STh species
with incorrectly formed disulfide bonds not compatible with enterotoxin
activity compared with broth cultures, in which increased oxygenation
enhanced the rapid formation of the correct disulfide bond. It is here
shown that disulfide bonds of STh can be formed spontaneously in the
presence of molecular oxygen. It is also known that, for aerobically
growing cells, the air oxygen may be the ultimate source of the
oxidizing power and that the oxidizing equivalent for the correct
formation of protein disulfide bonds in vivo appears to be provided by
oxygen through the respiratory chain (22, 23). In contrast
to cell sonicates, live recombinant bacteria induced fluid accumulation
in the mouse intestine, suggesting that toxin activity in vivo resulted
from an effective export processing of hybrids and not cell lysis.
These findings show that chimeras were processed in vitro and in vivo
in such a way that carriage by ClpG and the gastrointestinal
environment did not alter STh activity. Thus, hybrids might be directed
into the E. coli periplasm by the ClpG leader peptide, and
the structure of the chimeras attaining the periplasm was suitable for
translocation across the outer membrane in vitro and in vivo. However,
it cannot be excluded that some turnover of the chimera molecules may
occur during secretion, leading to the loss of intact STh moieties, and
that processing of these hybrids to release free STh may take place in
the mouse assay both for the cell-free samples and for the cell-bound
activity. If true, cleavage between ClpG and STh domains should occur
whatever the nature of the joint peptide and the fusion protein, which
is unlikely. Indeed, only two of the four fusion proteins generated
truncated derivative products in culture supernatants, indicating
differences in conformation-dependent protease sensitivity of hybrids.
Moreover, the extracellular hybrid STh was shown to be completely
oxidized and, therefore, disulfide bonded, dismissing the idea that STh
folds only if it is released from fusion proteins.
Supernatants of bacteria cultured in the presence of
-ME displayed
no activity which was recovered after prolonged exposure to air, while
the corresponding whole E. coli cells expressed enterotoxin
activity after being cleared of
-ME, thus confirming that, as
hypothesized above, activity in vivo resulted from an effective export
processing of hybrids. Taken together, these results provide evidence
that disulfide bond formation in STh was essential for toxin activity
but not for outer membrane translocation and that bonds can be formed
in vitro in the medium by spontaneous air oxidation. Thus, folding of
chimeric STh can occur in the extracellular milieu, as suggested by
Rasheed et al. (31) and Yang et al. (45) for the
natural toxin.
Like the natural STa peptide (40), hybrid STh reacted poorly
with STa-monospecific antibodies only when in an unoxidized form and
exhibited very low antigenicity only when C-terminally blocked with
ClpG. These results suggest that, in agreement with those of Sanchez et
al. (34), the free carboxyl end in the toxin is required for
antibody recognition and, above all, that the overall shape of the STh
in the hybrid is important for proper anti-STa antibody binding and,
therefore, that likely anti-STa antibodies recognized conformational
epitopes on chimeric STh. Clements (9) emphasized the
importance of including an appropriate linker between the two domains
of the LT-B (B subunit of heat-labile enterotoxin)-STa fusion for
antigenicity of the hybrid proteins and showed that maximum
antigenicity was obtained with a 7-amino-acid proline-containing
linker. In this study, among the fusions with STh N-terminally extended
with ClpG, those with a linker of at least 7 amino acids with one or
two proline residues at the ClpG-STh junction were more antigenic. In
addition, the presence of linkers with two proline residues seemed to
protect chimeras against proteolytic cleavage, as deduced from
immunoblot analysis. On the other hand, the hybrid containing a linker
with only two amino acids was poorly antigenic and enterotoxic but,
however, exhibited more heat stability, suggesting that the biological
properties of STh can be modified by altering the stereochemistry of
the molecule by means of rearrangement of the disulfide bonds.
In disagreement with many studies (see the Introduction), we showed
that blocking the natural amino or carboxy terminus of STh with a
heterologous carrier can be permissive for secretion, folding, and
enterotoxicity. Some of these studies (19, 44) concluded
that, for successful mobilization through the membranes and for full
biological activity, the STa domain has to contain the natural 18 or 19 amino acids not N- or C-terminally blocked by other residues. These
discrepancies lead us to suspect the CS31A export pathway of being
involved in the transport of ClpG-STh chimeras across the outer
membrane. To address this possibility, we examined the abilities of
hybrid ClpG subunits to form CS31A-STh fimbriae at the cell surface of
the CS31A helper protein-proficient cells (clp+)
and to be secreted by the CS31A helper protein-deficient cells (clp mutant). Surprisingly, none of these chimeras was cell
surface assembled into a fimbrial structure on
clp+ strains, clearly proving that ClpG in the
fusion adopted a conformation incompatible with anchorage, assembly,
and elongation of fimbriae. These data definitely rule out the idea
that presentation of hybrid subunits at the cell surface of bacteria as
repeating units along the fimbrial structure constitutes an essential
feature for the exit of the hybrid to the extracellular milieu. On the
other hand, out of four recombinant constructs devoid of the
clpG gene, only pProSTC28 significantly expressed
secretable active ClpG-STh chimeras in clp mutant strains.
The possibility that processing of native toxin from pProSTC28
happened is supported by the findings that (i) this chimera
possesses part of the naturally cleavable Pro-STh region; (ii) in
contrast to other ClpG-STh fusions, only hybrids from
pEHProSTC28 were probably C-terminally cleaved, as based on
immunoblot analysis; and (iii) no protein was detected in supernatants from plate- and broth-grown cultures when using anti-ClpG and anti-STa
antibodies in immunoblotting experiments. In summary, secretion of STh
chimeras, as free monomers, follows the CS31A-dependent pathway by
using ClpG as an extracellular export carrier probably capable of
interacting directly with one or several CS31A-specific minor proteins,
especially with the CS31A chaperone ClpE (5), for effective
outer membrane translocation. However, since most of the fusion
constructs involve fusions at the C terminus of the fimbrial subunit,
ClpG, it appeared surprising that they could be secreted by the CS31A
fimbrial secretion machinery. Indeed, mainly based on pilus Pap studies
(39), the current model of interaction of fimbrial subunits
with the periplasmic chaperone would predict that these fusions would
not interact well with the chaperones and thus be subject to
degradation in the periplasm. However, the C-terminal part of ClpG has
not been deleted and none of the amino acids composing this part has
been changed. Therefore, we believe that the binding chaperone site on
the ClpG chimera is still accessible and that the linker between the
ClpG and STh domains maintains this accessibility by improving the flexibility of ClpG at the fusion junction, thus minimizing the disturbing effect of the fusion on the native C-terminal ClpG and
N-terminal STh conformations. Other possibilities are that ClpG in the
fusion may be completely or partially protected by the STh structure
against proteolytic degradation in the periplasm and that other regions
of ClpG may be involved in chaperone binding, as suggested for K88, a
CS31A-related fimbria (4).
Conflicting observations have been reported for the mechanism of
secretion of the toxin from the periplasm to the outside of the
E. coli cell, making this mechanism poorly understood. Some
authors (43, 44) found that the Pro-STa region is cleaved in
the periplasmic space where the mature STa is correctly folded, while
others (31, 45) hypothesized that Pro-STa can exit to the
extracellular milieu and that STa is disulfide bonded outside the cell.
On the other hand, an important aspect of vaccine development is the
possibility that effective neutralization and protection against STa
require the production of antibodies to STa antigen in the fusion
protein that may recognize native STa and that are directed against
epitopes associated with toxicity. Our unpublished preliminary studies
indicate that all of the four toxic ClpG-STh fusions could induce high
titers of anti-STh serum antibodies, among which some neutralized
native STa toxin activity. By contrast, a nontoxic ClpG-STh mutant
induced no anti-STh antibodies. Therefore, although the ClpG-STh fusion
proteins could be processed differently from the natural STa, we think
that these fusions may be helpful for studying STa action, secretion,
and folding and for contributing to vaccine development by taking
advantage of the easy detection of STh hybrids using ClpG as an
immunogenic marker carrier protein. One can also imagine using ClpG as
a carrier for a nonimmunogenic, functionally active, full-length native
cysteine-containing protein of medical interest such as, for an
example, human chorionic gonadotropin or gonadotropin releasing
hormone. Active immunization of women against human chorionic
gonadotropin and that of domestic animals against gonadotropin
releasing hormone have been considered as cost-effective promising
options for immunocontraception (28, 41).
 |
ACKNOWLEDGMENTS |
This project was supported by the Conseil Régional Auvergne
(Clermont-Ferrand, France) and the Institut National de la Recherche Agronomique (Paris, France).
We are grateful for donation of mouse anti-STa monoclonal antibodies by
R. A. Gianella (20C1) and T. Takeda (11C). P. Di Martino and A. Darfeuille-Michaud are gratefully acknowledged for help in regard to
the adherence to Intestine-407 cells. We thank M. Chavarot, C. De
Martrin, A. Garrivier, B. Jaffeux, and G. Vert for technical assistance
and S. Dutilloy for secretarial assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratoire de
Microbiologie, INRA de Clermont-Fd-Theix, 63122 Saint-Genès-Champanelle, France. Phone: 33 04 73624243. Fax: 33 04 73624581. E-mail: dvartan{at}clermont.inra.fr.
Editor:
J. D. Clements
 |
REFERENCE |
| 1.
|
Acheson, D. W. K.
1992.
Enterotoxins in acute infective diarrhoea.
J. Infect.
24:225-245[CrossRef][Medline].
|
| 2.
|
Aitken, R., and T. R. Hirst.
1992.
Development of an immunoassay using recombinant maltose-binding protein-STa fusions for quantitating antibody responses against STa, the heat-stable enterotoxin of Escherichia coli.
J. Clin. Microbiol.
30:732-734[Abstract/Free Full Text].
|
| 3.
|
Aitken, R., and T. R. Hirst.
1993.
Recombinant enterotoxins as vaccines against Escherichia coli-mediated diarrhoea.
Vaccine
11:227-233[CrossRef][Medline].
|
| 4.
|
Bakker, D.,
C. E. M. Vader,
B. Roosendaal,
F. R. Mooi,
B. Oudega, and F. K. de Graaf.
1991.
Structure and function of periplasmic chaperone-like proteins involved in the biosynthesis of K88 and K99 fimbriae in enterotoxigenic Escherichia coli.
Mol. Microbiol.
5:875-886[CrossRef][Medline].
|
| 5.
|
Bertin, Y.,
J. P. Girardeau,
M. Der Vartanian, and C. Martin.
1993.
The ClpE protein involved in biogenesis of the CS31A capsule-like antigen is a member of a periplasmic chaperone family in Gram-negative bacteria.
FEMS Microbiol. Lett.
108:59-68[CrossRef][Medline].
|
| 6.
|
Bousquet, F.,
C. Martin,
J.-P. Girardeau,
M.-C. Méchin,
M. Der Vartanian,
H. Laude, and M. Contrepois.
1994.
CS31A capsule-like antigen as an exposure vector for heterologous antigenic determinants.
Infect. Immun.
62:2553-2561[Abstract/Free Full Text].
|
| 7.
|
Brandwein, H.,
A. Deutsch,
M. Thompson, and R. Giannella.
1985.
Production of neutralizing monoclonal antibodies to Escherichia coli heat-stable enterotoxin.
Infect. Immun.
47:242-246[Abstract/Free Full Text].
|
| 8.
|
Carpick, B. W., and J. Gariépy.
1991.
Structural characterization of functionally important regions of the Escherichia coli heat-stable enterotoxin STIb.
Biochemistry
30:4803-4809[CrossRef][Medline].
|
| 9.
|
Clements, J. D.
1990.
Construction of a nontoxic fusion peptide for immunization against Escherichia coli strains that produce heat-labile and heat-stable enterotoxins.
Infect. Immun.
58:1159-1166[Abstract/Free Full Text].
|
| 10.
|
Der Vartanian, M.,
M.-C. Méchin,
B. Jaffeus,
Y. Bertin,
I. Félix, and B. Gaillard-Martinie.
1994.
Permissible peptide insertions surrounding the signal peptide-mature protein junction of the ClpG prepilin: CS31A fimbriae of Escherichia coli as carriers of foreign sequences.
Gene
148:23-32[CrossRef][Medline].
|
| 11.
|
Der Vartanian, M.,
J.-P. Girardeau,
C. Martin,
E. Rousset,
M. Chavarot,
H. Laude, and M. Contrepois.
1997.
An Escherichia coli CS31A fibrillum chimera capable of inducing memory antibodies in outbred mice following booster immunization with the entero-pathogenic coronavirus transmissible gastroenteritis virus.
Vaccine
15:111-120[CrossRef][Medline].
|
| 12.
|
Di Martino, P.,
Y. Bertin,
J.-P. Girardeau,
V. Livrelli,
B. Joly, and A. Darfeuille-Michaud.
1995.
Molecular characterization and adhesive properties of CF29K, an adhesin of Klebsiella pneumoniae strains involved in nosocomial infections.
Infect. Immun.
63:4336-4344[Abstract].
|
| 13.
|
Di Martino, P.,
J.-P. Girardeau,
M. Der Vartanian,
B. Joly, and A. Darfeuille-Michaud.
1997.
The central variable V2 region of the CS31A major subunit is involved in the receptor-binding domain.
Infect. Immun.
65:609-616[Abstract].
|
| 14.
|
Gariépy, J.,
A. K. Judd, and G. K. Schoolnick.
1987.
Importance of disulfide bonds in the structure and activity of Escherichia coli enterotoxins ST1b.
Proc. Natl. Acad. Sci. USA
84:8907-8911[Abstract/Free Full Text].
|
| 15.
|
Giannella, R. A.
1976.
Suckling mouse model for detection of heat-stable Escherichia coli enterotoxin: characteristics of the model.
Infect. Immun.
14:95-99[Abstract/Free Full Text].
|
| 16.
|
Girardeau, J.-P.,
M. Der Vartanian,
J. L. Ollier, and M. Contrepois.
1988.
CS31A, a new K88-related fimbrial antigen on bovine enterotoxigenic and septicemic Escherichia coli strains.
Infect. Immun.
56:2180-2188[Abstract/Free Full Text].
|
| 17.
|
Girardeau, J.-P.,
Y. Bertin,
C. Martin,
M. Der Vartanian, and C. Boeuf.
1991.
Sequence analysis of the clpG gene, which codes for surface antigen CS31A subunit: evidence of an evolutionary relationship between CS31A, K88, and F41 subunit genes.
J. Bacteriol.
173:7673-7683[Abstract/Free Full Text].
|
| 18.
|
Greenberg, R. N., and R. L. Guerrant.
1981.
E. coli heat-stable enterotoxin.
Pharmacol. Ther.
13:507-531[CrossRef][Medline].
|
| 19.
|
Guzman-Verduzco, L.-M., and Y. M. Kupersztoch.
1989.
Rectification of two Escherichia coli heat-stable enterotoxin allele sequences and lack of biological effect of changing the carboxy-terminal tyrosine to histidine.
Infect. Immun.
57:645-648[Abstract/Free Full Text].
|
| 20.
|
Guzman-Verduzco, L.-M., and Y. M. Kupersztoch.
1990.
Export and processing analysis of a fusion between the extracellular heat-stable enterotoxin and the periplasmic B subunit of the heat-labile enterotoxin in Escherichia coli.
Mol. Microbiol.
4:253-264[CrossRef][Medline].
|
| 21.
|
Joly, J. C.,
W. S. Leung, and J. R. Swartz.
1998.
Overexpression of Escherichia coli oxidoreductases increases recombinant insulin-like growth factor-I accumulation.
Proc. Natl. Acad. Sci. USA
95:2773-2777[Abstract/Free Full Text].
|
| 22.
|
Kobayashi, T.,
S. Kishigami,
M. Sone,
H. Inokuchi,
T. Mogi, and K. Ito.
1997.
Respiratory chain is required to maintain oxidized states of the DsbA-DsbB disulfide bond formation system in aerobically growing Escherichia coli cells.
Proc. Natl. Acad. Sci. USA
94:11857-11862[Abstract/Free Full Text].
|
| 23.
|
Kobayashi, T., and K. Ito.
1999.
Respiratory chain strongly oxidizes the CXXC motif of DsbB in the Escherichia coli disulfide bond formation pathway.
EMBO J.
18:1192-1198[CrossRef][Medline].
|
| 24.
|
Low, D.,
B. Braaten, and M. Van Der Woude.
1996.
Fimbriae, p. 146-157.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C.
|
| 25.
|
Löwenadler, B.,
M. Lake,
A. Elmblad,
E. Holmgren,
J. Holmgren,
A. Karlström, and A.-M. Svennerholm.
1991.
A recombinant Escherichia coli heat-stable enterotoxin (STa) fusion protein eliciting anti-STa neutralizing antibodies.
FEMS Microbiol. Lett.
82:271-278[CrossRef].
|
| 26.
|
Martin, C.,
C. B uf, and F. Bousquet.
1991.
Escherichia coli CS31A fimbriae: molecular cloning, expression and homology with the K88 determinant.
Microb. Pathog.
10:429-442[CrossRef][Medline].
|
| 27.
|
Méchin, M.-C.,
M. Der Vartanian, and C. Martin.
1996.
The major subunit ClpG of Escherichia coli CS31A fibrillae as an expression vector for different combinations of two TGEV coronavirus epitopes.
Gene
179:211-218[CrossRef][Medline].
|
| 28.
|
Mukhopadhyay, A.
2000.
Reversible protection of disulfide bonds followed by oxidative folding render recombinant hCG highly immunogenic.
Vaccine
18:1802-1810[CrossRef][Medline].
|
| 29.
|
Okamoto, K., and M. Takahara.
1990.
Synthesis of Escherichia coli heat-stable enterotoxin STp as a pre-pro form and role of the pro sequence in secretion.
J. Bacteriol.
172:5260-5265[Abstract/Free Full Text].
|
| 30.
|
Rasheed, J. K.,
L.-M. Guzman-Verduzco, and Y. M. Kupersztoch.
1988.
Hyperproduction of heat-stable enterotoxin (STA4) of Escherichia coli and analysis of the unusual electrophoretic behavior of reduced and alkylated forms of STAs.
Microb. Pathog.
5:333-343[CrossRef][Medline].
|
| 31.
|
Rasheed, J. K.,
L.-M. Guzman-Verduzco, and Y. M Kupersztoch.
1990.
Two precursors of the heat-stable enterotoxin of Escherichia coli: evidence of extracellular processing.
Mol. Microbiol.
4:265-273[CrossRef][Medline].
|
| 32.
|
Saarilahti, H. T.,
E. T. Palva,
J. Holmgren, and J. Sanchez.
1989.
Fusion of genes encoding Escherichia coli heat-stable enterotoxin and outer membrane protein OmpC.
Infect. Immun.
57:3663-3665[Abstract/Free Full Text].
|
| 33.
|
Sanchez, J.,
T. R. Hirst, and B. E. Uhlin.
1998.
Hybrid enterotoxin LTA::STa proteins and their protection from degradation by in vivo association with B-subunits of Escherichia coli heat-labile enterotoxin.
Gene
64:265-275.
|
| 34.
|
Sanchez, J.,
S. Johansson,
B. Löwenadler,
A.-M. Svennerholm, and J. Holmgren.
1990.
Recombinant cholera toxin B subunit and gene fusion proteins for oral vaccination.
Res. Microbiol.
141:971-979[Medline].
|
| 35.
|
Sanchez, J.,
R. M. Solorzano, and J. Holmgren.
1993.
Extracellular secretion of STa heat-stable enterotoxin by Escherichia coli after fusion to a heterologous leader peptide.
FEBS Lett.
330:265-269[CrossRef][Medline].
|
| 36.
|
Schulz, S.,
C. K. Green,
P. S. T. Yuen, and D. L. Garbers.
1990.
Guanylyl cyclase is a heat-stable enterotoxin receptor.
Cell
63:941-948[CrossRef][Medline].
|
| 37.
|
Scotland, S. M.,
G. A. Willshaw,
B. Said,
H. R. Smith, and B. Rowe.
1989.
Identification of Escherichia coli that produces heat-stable enterotoxin STA by a commercially available enzyme-linked immunoassay and comparison of the assay with infant mouse and DNA probe tests.
J. Clin. Microbiol.
27:1697-1699[Abstract/Free Full Text].
|
| 38.
|
So, M., and B. J. McCarthy.
1980.
Nucleotide sequence of the bacterial transposon Tn1681 encoding a heat-stable (ST) toxin and its identification in enterotoxigenic Escherichia coli strains.
Proc. Natl. Acad. Sci. USA
77:4011-4015[Abstract/Free Full Text].
|
| 39.
|
Soto, G. E.,
K. W. Dodson,
D. Ogg,
C. Liu,
J. Heuser,
S. Knight,
J. Kihlberg,
C. H. Jones, and S. J. Hultgren.
1998.
Periplasmic chaperone recognition motif of subunits mediates quaternary interactions in the pilus.
EMBO J.
17:6155-6167[CrossRef][Medline].
|
| 40.
|
Takeda, T.,
G. B. Nair,
K. Suzuki,
H. Xiao Zhe,
Y. Yokoo,
P. De Mol,
W. Hemelhof,
J. P. Butzler,
Y. Takeda, and Y. Shimonishi.
1993.
Epitope mapping and characterization of antigenic determinants of heat-stable enterotoxin (STh) of enterotoxigenic Escherichia coli by using monoclonal antibodies.
Infect. Immun.
61:289-294.
|
| 41.
|
Van der Zee, A.,
C. V. Noordegraaf,
H. van den Bosch,
J. Gielen,
H. Bergmans,
W. Hoekstra, and I. van Die.
1995.
P-fimbriae of Escherichia coli as carriers for gonadotropin releasing hormone: development of a recombinant contraceptive vaccine.
Vaccine
13:753-758[CrossRef][Medline].
|
| 42.
|
Yamanaka, H.,
Y. Fuke,
S. Hitotsubashi,
Y. Fujii, and K. Okamoto.
1993.
Functional properties of pro region of Escherichia coli heat-stable enterotoxin.
Microbiol. Immunol.
37:195-205[Medline].
|
| 43.
|
Yamanaka, H.,
M. Kameyama,
T. Baba,
Y. Fujii, and K. Okamoto.
1994.
Maturation pathway of Escherichia coli heat-stable enterotoxin I: requirement of DsbA for disulfide bond formation.
J. Bacteriol.
176:2906-2913[Abstract/Free Full Text].
|
| 44.
|
Yamanaka, H.,
T. Nomura,
Y. Fujii, and K. Okamoto.
1997.
Extracellular secretion of Escherichia coli heat-stable enterotoxin I across the outer membrane.
J. Bacteriol.
179:3383-3390[Abstract/Free Full Text].
|
| 45.
|
Yang, Y.,
Z. Gao,
L.-M. Guzman-Verduzco,
K. Tachias, and Y. M. Kuperztoch.
1992.
Secretion of the STA3 heat-stable enterotoxin of Escherichia coli: extracellular delivery of pro-STA is accomplished by either pro or STA.
Mol. Microbiol.
6:3521-3529[CrossRef][Medline].
|
Infection and Immunity, July 2000, p. 4064-4074, Vol. 68, No. 7
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.