Previous Article | Next Article ![]()
Infection and Immunity, August 2000, p. 4452-4461, Vol. 68, No. 8
Department of Microbiology and Immunology,
University of Kentucky, Lexington, Kentucky
Received 18 February 2000/Returned for modification 17 April
2000/Accepted 1 May 2000
One prerequisite for the virulence of Yersinia pestis,
causative agent of bubonic plague, is the yersiniabactin (Ybt)
siderophore-dependent iron transport system that is encoded within a
high-pathogenicity island (HPI) within the pgm locus of the
Y. pestis chromosome. Several gene products within the HPI
have demonstrated functions in the synthesis or transport of Ybt. Here
we examine the roles of ybtU and ybtT. In-frame
mutations in ybtT or ybtU yielded strains defective in siderophore production. Mutant strains were unable to grow
on iron-deficient media at 37°C but could be cross-fed by culture
supernatants from a Ybt-producing strain of Y. pestis. The
ybtU mutant failed to express four indicator Ybt proteins (HMWP1, HMWP2, YbtE, and Psn), a pattern similar to those for other
ybt biosynthetic mutants. In contrast, strains carrying mutations in ybtT or ybtS (a previously
identified gene required for Ybt biosynthesis) produced all four
proteins at wild-type levels under iron-deprived conditions. To assess
the effects of ybtT, -U, and -S
mutations on transcription of ybt genes, reporter plasmids
with ybtP or psn promoters controlling
lacZ expression were introduced into these mutants. Normal
iron-regulated To cause infections, pathogenic
bacteria must be able to remove iron, an essential trace nutrient, from
host iron- and/or heme-chelating proteins (12, 43, 65).
Yersinia pestis, the causative agent of bubonic and
pneumonic plague, possesses an ATP-binding cassette (ABC) hemoprotein
transport system (Hmu) that allows it to use a variety of host
hemoproteins (36, 64). The organism also contains one
putative and two known inorganic iron transport systems. The Yfu system
was identified by a search of the Y. pestis KIM10+ genome
database (www.genome.wisc.edu) and belongs to a family of ABC iron
transporters present in Yersinia enterocolitica (Yfu),
Neisseria spp. (Fbp), Haemophilus influenzae (Hit), Actinobacillus pleuropneumoniae (Afu), and
Serratia marcescens (Sfu) (7). Whether this
system is functional in Y. pestis is currently unknown. The
Y. pestis Yfe system belongs to a family of
cation-transporting ABC systems and transports both iron and manganese.
This system appears to function to acquire iron during the later stages
of plague (3, 4).
The third inorganic iron transport system synthesizes the siderophore
yersiniabactin (Ybt), which is composed of a phenolate, a thiazoline,
and a thiazolidine ring (15, 19, 47) and which has
considerable similarity to the siderophores pyochelin and anguibactin
produced by Pseudomonas aeruginosa and Vibrio
anguillarum, respectively (18, 38). The Ybt iron
acquisition system is essential for the virulence of Y. pestis during the early stages of infection in mice
(3). Ybt biosynthetic, regulatory, and transport genes are
encoded within a high-pathogenicity island (HPI) that is present in
highly pathogenic isolates of Y. pestis, Yersinia
pseudotuberculosis, and Y. enterocolitica, as well as several types of pathogenic Escherichia coli (8, 9, 13, 29, 33, 50, 56). In Y. pestis, HPI resides within the pgm locus, a 102-kb region of chromosomal DNA subject to
high-frequency deletion (9, 10, 26, 29, 32, 41).
The genes encoding the Ybt systems of Y. pestis (see Fig. 1)
and Y. enterocolitica have been completely sequenced and
show >97% sequence identity (10, 29, 46, 50). One notable
exception to this sequence identity is the unique insertion of a 125-bp ERIC sequence (enterobacterial repetitive intergenic consensus sequence; also called an intergenic repeated unit) within the promoter region of ybtA of Y. enterocolitica
(50). ybtA encodes a transcriptional activator of
ybt genes (22). Although this suggests possible
differences in regulatory responses, some of the Ybt biosynthetic genes
appear to be functionally interchangeable among the three pathogenic
yersiniae: Y. pestis, Y. pseudotuberculosis, and
Y. enterocolitica (14, 47).
Iron from Fe-Ybt is transported into the cell via an outer membrane
(OM) receptor (termed Psn in Y. pestis and FyuA in Y. enterocolitica) in conjunction with an ABC transport system
encoded by ybtP and ybtQ. Psn, which likely binds
the Fe-Ybt complex, also binds the bacteriocin pesticin (23-25,
34, 40, 51). Translocation of the substrate across the OM is TonB
dependent (21, 34). YbtP and YbtQ resemble inner-membrane
permeases that are each fused to an ATP-binding domain. Both proteins
are required for use of iron from Ybt. No periplasmic binding protein has been identified for the Ybt system (23, 29).
Ybt production occurs via a mixed polyketide synthase-nonribosomal
peptide synthetase (NRPS) strategy that assembles the siderophore in
modular fashion from salicylate, a linker group derived from malonyl-coenzyme A, three molecules of cysteine, and three methyl groups donated by S-adenosylmethionine (29). The
requirement of three gene products (high-molecular-weight protein 2 [HMWP2], YbtE, and YbtS) for Ybt synthesis has been clearly
demonstrated genetically. YbtS is likely required for the final steps
in salicylate biosynthesis (2, 29). YbtE adenylates
salicylate and transfers this activated compound to HMWP2
(30). HMWP2, encoded by irp2, possesses domains
involved in nonribosomal peptide synthesis and likely participates in
the initial cyclization and condensation reactions involving salicylate
and two cysteine molecules (29-31, 62). HMWP1, encoded by
irp1, contains polyketide/fatty acid synthase and modified
NRPS domains that add the branched isobutyryl-alcohol linker and the
last thiazoline moiety. Phosphopantetheinylation of a peptidyl carrier
protein domain of HMWP1 (PCP3) has been demonstrated (29).
The roles of the remaining ybt genes (ybtX, ybtT, and ybtU) contained within the HPI were
undetermined or uncertain. The product encoded by ybtX is
predicted to be extremely hydrophobic. However, a strain carrying a
deletion in ybtX had no discernible in vitro phenotype
(23). While YbtT contains a thioesterase domain (2,
29), a definitive role for YbtT in Ybt biosynthesis has not been
demonstrated. YbtU has no significant homology to proteins in the
database that have defined enzymatic or regulatory functions
(29), nor has a function for YbtU in Ybt production or
utilization been determined. In this study, we report that in-frame
deletions in ybtU and ybtT abolish Ybt siderophore synthesis. Similar to mutations in other Ybt biosynthetic genes, the ybtU mutation downregulates expression of
ybt genes; however, mutations in ybtT and
ybtS did not have this regulatory effect.
Bacterial strains, media, and culture conditions.
All
relevant characteristics of strains used in this study are presented in
Table 1. All the Y. pestis
strains used in this study were derived from KIM6+, an avirulent strain
that possesses all of the known Y. pestis virulence
determinants except for pCD1, a 70.5-kb plasmid encoding the
low-calcium response (Lcr) stimulon (26, 59). The Lcr
virulence regulon is unrelated to the Pgm+ phenotype and
has no demonstrable role in iron metabolism (48, 49).
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Yersinia pestis YbtU and YbtT Are
Involved in Synthesis of the Siderophore Yersiniabactin but Have
Different Effects on Regulation

![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-galactosidase activity was observed in the
ybtT and ybtS mutants, whereas a significant
loss of expression occurred in the
ybtU strain. These results show that ybtT and ybtU genes are
involved in the biosynthesis of the Ybt siderophore and that a
ybtU mutation but not ybtT or ybtS
mutations affects transcription from the ybtP and
psn promoters.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Bacterial strains and plasmidsa
20°C in phosphate-buffered glycerol.
Y. pestis cells were grown routinely at 30°C on Congo red agar (63) from glycerol stocks and then grown in heart
infusion broth (Difco Laboratories) or on tryptose-blood agar base
(Difco). For iron-deficient growth, Y. pestis cells were
grown in the chemically defined medium PMH, which had been extracted
prior to use with Chelex 100 resin (Bio-Rad Laboratories)
(61). The residual iron that was not removed from deferrated
PMH by the resin was precipitated by the addition of 0.5 mM
NaCO3-0.01 mM MnCl2-4.0 mM CaCl2
(PMH-S) or chelated by supplementation with 2,2'-dipyridyl (PMH-DIP) at a concentration of 100 µM. PMH-S and PMH-DIP plates were solidified with 1% agarose. PMH-S and PMH-DIP plates were subsequently used in
cross-feeding experiments or to determine the growth characteristics of
the ybt mutants at 37°C as previously described
(24). For iron-replete growth, Y. pestis strains
were cultivated in PMH supplemented with 10 µM FeCl3.
All glassware used for iron-restricted studies was soaked overnight in
chromic/sulfuric acid (46.3 g of
K2Cr2O7 per liter of 12 M sulfuric
acid) or ScotClean (OWL Scientific, Inc.) to remove contaminating iron
and copiously rinsed in deionized water. E. coli cells were
grown in Luria broth. Where appropriate, ampicillin (100 µg/ml),
spectinomycin (100 µg/ml), tetracycline (6.25 µg/ml), streptomycin
(50 µg/ml), and kanamycin (50 µg/ml) were added to cultures.
Plasmids, sequencing, and recombinant DNA techniques. All the plasmids used in this study are listed in Table 1. Plasmids were purified from overnight cultures by alkaline lysis (6) and further purified when necessary by polyethylene glycol precipitation (37). Standard cloning and recombinant DNA methods (53) were used to construct the various plasmids in Table 1. A standard CaCl2 procedure was used to introduce plasmids into E. coli (53). Y. pestis cells were transformed by electroporation as previously described (24). Plasmid DNA was sequenced by the dideoxynucleotide chain termination method (54) using Sequenase, version 2.0 (Amersham Pharmacia Biotech), 35S-dATP (New England Nuclear/Dupont), and 7-deaza-dGTP. Synthetic oligonucleotide primers purchased from Integrated DNA Technologies were used to extend the sequence. Samples were electrophoresed at 70 W on 6% polyacrylamide gels containing Tris-borate-EDTA buffer and 8.3 M urea. Gels were fixed in a 10% ethanol-10% acetic acid solution, dried, and exposed to Kodak BioMax MR film at room temperature.
Generating ybtU and ybtT mutant strains
and expression plasmids.
All Y. pestis mutant strains
were generated by homologous recombination using mutated DNA fragments
cloned into suicide vectors carrying the sacB gene and an
R6K origin of replication. For construction of an in-frame
ybtT strain (KIM6-2072), we first subcloned an ~3.9-kb
SphI fragment of plasmid pPSN3 into the SphI site
of pACYC184 to yield pYbtTU1. Removal of a 438-bp PvuI
fragment from pYbtTU1 resulted in plasmid pYbtT1. Subcloning an
~3.5-kb SphI fragment from pYbtT1 into the SphI
site of the suicide plasmid pSUC1 generated pYbtT1.1.
ybtU mutant (strain KIM6-2071),
a 526-bp EagI/EcoRV fragment of plasmid pYbtTU1
was subcloned into the corresponding sites in pBluescript II KS+
(Stratagene) to yield pYbtU1. A 467-bp PvuII fragment was
removed from pYbtTU1 and ligated into the EcoRV site of the
plasmid pYbtU1, generating pYbtU2. The orientation of the insert was
determined by DNA sequencing. We then subcloned an ~1-kb
SacI/SalI fragment of pYbtU2 into the SacI/SalI sites in pSUC1 to yield pYbtU2.1. Gene
replacement attempts with pYbtU2.1 did not yield the desired
chromosomal integrants. Therefore, we constructed an alternate suicide
plasmid, pYbtU2.2, by subcloning a SalI/SmaI
fragment of pYbtU2.1 into the SalI/SmaI sites in pKNG101.
To generate hexahistidine fusion proteins, the ybtT and
ybtU gene coding regions were amplified with Pfu
polymerase (Stratagene) from pPSN345 by PCR using primers ybtT-1
(5'-TGATGGCGCCTCTGTGACGCAATCTGCAATG-3') and M13 reverse
(5'-AGCGGATAACAATTTCA-3') and ybtU-1
(GGAATTCTTATGATGCCGTCCGCCTCC) and ybtU-2
(CGGGATCCTCACAGCGCCTCCTTATC), respectively. Reaction mixtures contained 0.2 mM deoxynucleoside triphosphates and 0.2 µM primers, and reactions consisted of 20 s at 94°C, 20 s
at 50°C, and 90 s at 72°C for 30 cycles, followed by a single
cycle at 72°C for 10 min for ybtT. Amplification
conditions for ybtU were 45 s at 94°C, 30 s at
50°C, and 2 min at 72°C for 30 cycles followed by a single cycle at
72°C for 10 min. The ybtS coding region was amplified with
Pfu polymerase (Stratagene) from pSDR498.1 using primers
ybtS-1 (5'-GGAATTCTTATGAAAATCAGTGAATTT-3') and ybtS-2 (5'-CGGGATCCCTACACCATTAAATAGGG-3'). Amplification conditions
for ybtS consisted of 45 s at 94°C, 30 s at
45°C, and 2 min at 72°C for 30 cycles followed by a single cycle at
72°C for 10 min. The 827-, 1,305-, and 1,100-bp products of
ybtT, ybtS, and ybtU, respectively, were purified from low-melting-point agarose and digested with KasI/EcoRI (for ybtT) or with
BamHI/EcoRI (for ybtS and
ybtU), followed by ligation into the corresponding sites of
pPROEX1, yielding pYbtT-H6, pYbtS-H6, and pYbtU-H6. Ligated products
were transformed into DH5
cells. Positive clones containing the
desired inserts were identified by restriction enzyme digests and
verified by PCR using a set of nested primers specific for the
ybtS, ybtT, and ybtU coding regions.
Expression of all three gene products was verified in the positive
clones by IPTG (isopropyl-
-D-thiogalactopyranoside) induction of Luria broth minicultures followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis (data
not shown). pYbtT-H6, pYbtS-H6, and pYbtU-H6 were electroporated into
ybtT,
ybtS, and
ybtU mutants,
respectively. Growth stimulation in these three strains was tested by
bioassay on PMH-DIP as described above.
Protein analyses. To label cellular proteins, whole cells of Y. pestis strains acclimated to growth under iron-deficient or iron-sufficient conditions by serial passage in PMH, with or without FeCl3 (10 µM), for a total of approximately six generations, were labeled with 35S-amino acids (DuPont NEN Research Products) for 1 h as previously described (25). To analyze the effect of Ybt on protein synthesis, purified Ybt from Y. pestis KIM6+ was added to cells, acclimated to iron starvation, at the same time as 35S-amino acids. An equivalent number of counts was electrophoresed on 7.5% polyacrylamide gels containing SDS. Dried gels were exposed to Kodak BioMax MR film at room temperature.
Ybt bioassay. Culture supernatants were obtained from ybt mutants inoculated into deferrated PMH and grown for a total of six to nine generations at 37°C as previously described (24). The cells were pelleted by centrifugation, and the supernatant was filtered through a 0.45-µm-pore-size filter. For growth responses, PMH-S or PMH-DIP plates were overlayered with 0.04 optical density (at 620 nm) units of KIM6-2046.1 (irp2::kan2046.1) cells grown in deferrated PMH and 25 µl of filtered supernatants from iron-deficient ybt mutant cultures were added to wells in the plates.
The ybtU and ybtT mutants were also tested for their ability to promote the growth of KIM6-2046.1 at 37°C by streaking the mutants adjacent to KIM6-2046.1 on PMH-S or PMH-DIP plates. Prior to streaking, the mutants were adapted to iron-deficient growth conditions as described above. Y. pestis strains that do not produce Ybt are unable to grow on PMH-S or PMH-DIP at 37°C but can be cross-fed by Ybt-producing strains.
-Galactosidase assays.
Lysates were prepared from cells
carrying the ybtP::lacZ or
psn::lacZ reporter plasmid and grown in
PMH in the presence or absence of iron through two transfers for a
total of approximately six generations, as previously described
(60).
-Galactosidase activities were measured
spectrophotometrically following cleavage of ONPG
(4-nitro-phenyl-
-D-galactopyranoside). Activity is
expressed in Miller units (44).
Ybt detection and purification. Y. pestis KIM6+, KIM6-2071, and KIM6-2072 were grown at 37°C in 100 ml of deferrated PMH for approximately eight generations. The supernatant of each culture was filtered through a 0.45-µm-pore-size filter. The presence of the Ybt siderophore was determined using methods modified from Chambers et al. (15) and Drechsel et al. (19) as previously described (47). Three C18-SEP-PAK cartridges were used in a preliminary purification step. The sample, in 50% methanol, was then applied to an analytical C-18 high-pressure liquid chromatography (HPLC) column and eluted with 100% methanol. The Ybt siderophore was detected by its absorbance maximum at 385 nm (19) and by bioassay.
| |
RESULTS |
|---|
|
|
|---|
Mutation of ybtU or ybtT causes loss of
siderophore production.
Most biosynthetic enzymes for the
synthesis of Ybt are encoded within a large, putative operon of five
genes: irp2, irp1, ybtU,
ybtT, and ybtE (Fig.
1). The likely functions of HMWP1, HMWP2,
and YbtE in the synthesis of Ybt have been described previously (29, 30, 62). To study the functions of YbtT and YbtU in Ybt
production or utilization, we constructed in-frame deletions in both
genes (Fig. 1). We have been unable to identify the YbtU and YbtT
products by SDS-PAGE. However, when grown under appropriate conditions,
both the YbtT
and YbtU
mutants express YbtE
(Fig. 2), the product of the final,
downstream gene of the operon, indicating that both mutations are
in-frame deletions.
|
|
ybtU) nor KIM6-2072
(
ybtT) grew at 37°C on the iron-chelated media (Table
2), indicating that the mutated strains
lost the ability to either synthesize or utilize Ybt. Supernatants from
iron-deficient cultures of KIM6-2071 and KIM6-2072 were unable to
stimulate the growth of a Y. pestis strain (KIM6-2046.1)
defective in Ybt synthesis (Table 2). However, culture supernatant from
KIM6+, a yersiniabactin-producing strain of Y. pestis,
allowed the growth of KIM6-2046.1 as well as the YbtU
and
YbtT
mutants under these conditions. Similar results were
obtained with KIM6-2070.1
(
ybtS::kan2070.1) (Table 2), a
strain previously demonstrated to be defective in Ybt synthesis
(29). These results suggest that the YbtU
and
YbtT
mutants are defective in synthesis of the Ybt
siderophore. To clearly demonstrate that Ybt was not produced at
significant levels, we attempted to purify Ybt from 100 ml of
iron-deficient culture supernatant of each mutant, as well as the KIM6+
parental strain. Although a significant amount of Ybt was produced by
KIM6+ as determined by HPLC analysis, we were not able to detect any
Ybt production by the YbtU
, YbtT
, and
YbtS
mutants (data not shown).
|
The
ybtU2071 mutation results in decreased
expression of ybt operons.
Total
35S-labeled proteins synthesized by cells grown under
iron-sufficient and iron-deficient conditions were analyzed by SDS-PAGE to determine the effect, if any, of the
ybtU2071 mutation
on the expression of other iron-regulated proteins. Previously, we showed that mutations causing loss of siderophore production lower expression of other Ybt biosynthetic genes (those encoding HMWP1, HMWP2, and YbtE) as well as the Ybt receptor (Psn) (2, 22). The analysis of whole-cell extracts of strains grown in iron-deficient media revealed that the YbtU
mutant had a pattern of
protein expression similar to that of a
irp2-2046.3
mutant that is defective in siderophore biosynthesis. In the absence of
iron, the levels of expression of HMWP1, HMWP2, YbtE, and Psn proteins
were greatly reduced in KIM6-2071 (
ybtU2071) and
KIM6-2046.3 (
irp2-2046.3) cells (Fig. 2, lanes 4 and 7)
compared to those in the parental strain, KIM6+ (Fig. 2, lane 1). Cells grown in the presence of iron do not express detectable levels of these
proteins (Fig. 2, lanes 3, 6, 9, 12, and 15).
and
HMWP2 mutants expressed
wild-type levels of HMWP1, HMWP2, Psn, and YbtE (Fig. 2, lanes 5 and 8).
To test the effect of the ybtU2071 mutation on gene
transcription, we used two well-characterized reporter plasmids with
promoters that have been demonstrated to be regulated by Fur, iron,
YbtA, and the Ybt siderophore: pEUYbtP, a ybtP promoter
fusion to lacZ, and pEUPP1, a psn promoter fusion
to lacZ. Both reporter genes were cloned into the
low-copy-number plasmid pEU730 (2, 22, 23, 27). Because our
Y. pestis strains are phenotypically
-galactosidase
negative, any
-galactosidase activity is due to the presence of the
reporter plasmid (61). The
-galactosidase activities of
cells bearing these plasmids and grown in deferrated PMH, in the
presence or absence of added iron, are presented in Table
3. As expected for KIM6+, which contains
all the genes needed for Ybt synthesis and utilization, expression of
lacZ from the ybtP promoter is iron regulated;
there is a 23-fold repression of
-galactosidase activity in cells
grown in the presence of surplus iron compared to those cultured under
iron-deficient conditions. Expression of the
ybtP::lacZ reporter in the
YbtU
mutant, KIM6-2071, was still somewhat iron regulated
(12-fold repression); however the overall expression was greatly
reduced (Table 3). The ybtP promoter was more active than
the psn promoter during iron deficiency in the
Ybt+ strain: a 23-fold versus a 14-fold induction. However,
the effects of the ybtU mutation on the two promoters were
similar, reducing expression to ~2,000 Miller units, a 16-fold
reduction for the ybtP promoter and an 11-fold reduction for
the psn promoter (Table 3). These studies suggest that loss
of expression of HMWP1, HMWP2, YbtE, and Psn in the YbtU
mutant results from decreased transcription from the relevant ybt promoters.
|
10 region that
reduces its similarity to the consensus and could decrease overall
transcriptional efficiency (data not shown). A similar mutation might
have caused the lower expression values reported previously
(22). The pEUPP1 plasmid used in this study does not contain
this mutation.
The ybtT2072 and ybtS2070.1 mutations do
not affect expression of ybt operons.
We also
performed analyses of iron-repressible protein expression by
YbtT
and YbtS
mutants of Y. pestis. Expression of HMWP1, HMWP2, YbtE, and Psn by these two
mutants was iron repressible with patterns similar to that of the
parental strain, KIM6+ (Fig. 2). In contrast to the YbtU
and
HMWP2 mutants, the YbtT
and YbtS
mutants produced all four proteins at wild-type levels under iron-deprived conditions (Fig. 2, lanes 10 and 13) and the addition of
purified Ybt during growth of these mutants did not increase expression
of these four proteins (Fig. 2, lanes 11 and 14).
-galactosidase activities
from strains KIM6-2072 (
ybtT) and KIM6-2070.1
(
ybtS) carrying either pEUYbtP or pEUPP1 were essentially the same as that observed with KIM6+ cells carrying these reporter plasmids (Table 3). These results indicate that the
ybtT2072 and
ybtS2070.1 mutations do not
affect the transcription of the ybtPQXS or psn
operons or expression of Ybt proteins. This is in sharp contrast to the
previous three Ybt biosynthetic mutants, which all decreased expression
of the Ybt system (this study; 2, 22, 23, 47).
| |
DISCUSSION |
|---|
|
|
|---|
While there are some differences among the HPIs of the pathogenic yersiniae, all encode an essentially identical and interchangeable siderophore-iron transport system (Ybt). The ybt genes appear to be organized into four operons: (i) psn, (ii) irp2-irp1-ybtU-ybtT-ybtE, (iii) ybtA, and (iv) ybtP-ybtQ-ybtX-ybtS (10, 23, 24, 29, 46, 47) (Fig. 1). In Y. pestis, it has previously been shown that the OM receptor Psn and an ABC transporter composed of YbtP and YbtQ are essential for use of the Ybt siderophore (23, 24). YbtA is an AraC-type activator for the other ybt operons and represses its own transcription (22). The role of YbtX is unclear since a mutation disrupting ybtX had no demonstrable effect on Ybt synthesis or iron uptake (23). HMWP1 and HMWP2 (encoded by irp1 and irp2, respectively), YbtE, and YbtS have demonstrated roles in siderophore synthesis (2, 29, 30). Here we have determined that the two remaining genes, ybtU and ybtT, also appear to be required for Ybt siderophore synthesis. Thus, cells with mutations in ybtU or ybtT were unable to grow on iron-deficient medium at 37°C and culture supernatants from these mutants could not stimulate the growth of a Ybt biosynthetic mutant and did not contain detectable levels of siderophore. However, the ybtU and ybtT mutants could grow on iron-deficient medium at 37°C when provided with exogenous Ybt. These results suggest that the ybtU and ybtT mutants can use Ybt but are unable to produce the siderophore.
While our results indicate that YbtT and YbtU are required for Ybt
synthesis, the precise role of these proteins in the production of the
siderophore is unknown. YbtT has a thioesterase domain with the
G(Y/W/H)SxG signature motif (amino acids [aa] 102 to 106 in YbtT) and
a distal GxH conserved sequence (aa 134 to 136 in YbtT) (2, 29,
58). The four highest homologies to YbtT in the database (3 January 2000) are to external putative thioesterases; NrpT in
Proteus mirabilis is part of a NRPS/polyketide synthase system involved in swarming (39.7% identity and 56.6% similarity), AngT is encoded within the anguibactin siderophore gene cluster in
V. anguillarum (36.7% identity and 57.7% similarity),
PikAV is required for macrolide antibiotic biosynthesis in
Streptomyces venezuelae (33% identity and 50.9%
similarity), and Srf4 (or SrfA-TE; 26.2% identity and 50.6%
similarity) of Bacillus subtilis is needed for surfactin
biogenesis (17, 20, 28, 66, 67). PchC, a putative
thioesterase of the pyochelin siderophore system of P. aeruginosa (57), has 29.6% identity and 47.2%
homology to YbtT. Many bacterial NRPS systems possess a C-terminal
thioesterase domain as part of the NRPS in addition to a separate gene
encoding an external thioesterase. In most systems, the biochemical
function of the external thioesterase is unknown. However, it is
thought to serve an editing function by removing aberrant structures on mischarged NRPSs caused by nonspecific thioesterification (11, 42,
55). Thus, loss of AngT expression reduced anguibactin synthesis
to 30 to 40% of wild-type levels (66) and deletion of the
gene encoding SrfA-TE caused a sixfold drop in synthesis of surfactin
(55). Deletion of tylO, encoding an external
putative thioesterase in Streptomyces fradiae, reduced
tylosin synthesis by 85% (11). Our bioassay detects Ybt in
iron-deficient culture supernatants diluted 1:16 (data not shown).
Thus, if any Ybt siderophore is produced by the YbtT
mutant, it is at less than 6% of wild-type levels. Therefore, loss of
the YbtT putative external thioesterase appears to have a slightly
greater effect on product synthesis than do mutations in external
thioesterase genes in other systems. In this regard the
YbtT
mutant resembles the S. venezuelae pikAV
mutant where biosynthesis of three macrolide antibiotics was reduced to
less than 5%. The S. venezuelae macrolide biosynthesis gene
cluster has no product containing an internal thioesterase domain
(67). A thioesterase domain, present in the C terminus of
HMWP1, is hypothesized to release the completed Ybt siderophore from
the enzyme complex (29). Experiments to test the role of the
HMWP1 thioesterase domain in Ybt production are in progress.
Our results show that a
ybtU mutation affects Ybt
synthesis and regulation. The YbtU
mutant had greatly
reduced transcription from the psn and ybtP promoters and reduced levels of HMWP1, HMWP2, YbtE, and Psn proteins. However, it is unlikely that YbtU is a direct regulator; the regulatory effects of the
ybtU mutation and polar mutations in the
upstream genes irp1 and irp2 are corrected by the
addition of the Ybt siderophore (2, 47). This suggests that
the regulatory effects in these mutants are caused by loss of
siderophore synthesis. The role of YbtU in siderophore synthesis is
unknown. Protein motif and homology searches have not provided insight
into the function of this protein. TopPred2 and DAS
(http://www/biohemi.su.se) predict that YbtU has one potential
transmembrane domain with a significant score (Fig.
3). YbtU is predicted by PSORT
(45) to be an inner membrane protein. The two highest
homologies in the database (3 January 2000) are to PchG of P. aeruginosa (pyochelin biosynthesis) and NrpU of P. mirabilis (swarming phenotype) (28, 57) (Fig. 3 shows
the alignment), whose functions are also unknown.
|
In Y. pestis, we proposed that Ybt functions as a signal
molecule by binding to the AraC-type regulator YbtA. The Ybt-YbtA complex then activates transcription of other genes in the Ybt system
and represses transcription of ybtA. Thus mutants in
ybtA had reduced
-galactosidase activity from a
psn::lacZ reporter plasmid but elevated
expression from a ybtA::lacZ reporter
(22). In addition, strains bearing mutations in
irp2 or ybtE, both genes encoding products
involved in Ybt synthesis, had significantly reduced expression of
HMWP1, HMWP2, and Psn (2). Curiously, mutations in
psn (encoding the OM receptor for Ybt) and ybtP
(encoding a putative ABC transporter involved in Ybt uptake) do not
affect regulation of gene transcription or the levels of Ybt proteins (2, 22, 24, 47). This is in contrast to results obtained with Y. enterocolitica, where a strain with a mutant OM
receptor, designated FyuA, exhibited reduced levels of HMWP2,
suggesting the involvement of FyuA in regulation. However, despite a
reduction in HMWP2, a key component in Ybt biosynthesis, this mutant
has been described as a Ybt overproducer (46, 51). Psn and
FyuA are 98% identical at the deduced amino acid level, making it
unlikely that sequence differences would account for the observed
regulatory discrepancies between Y. enterocolitica and
Y. pestis (24, 51). An ERIC sequence is present
in the ybtA promoter region of Y. enterocolitica
IB strains (52) but absent from Y. pestis KIM6+ (29). The effect of this insertion on expression of YbtA has not been experimentally determined (52). Alternatively, the dissimilarity between Y. pestis and Y. enterocolitica Ybt receptor mutants could be due to differential
permeation of Ybt through the OM. Bengoechea et al. (5)
concluded that the OM of Y. pestis was more permeable to
small hydrophobic molecules than the OM of Y. enterocolitica. Thus Y. enterocolitica FyuA may be
required to translocate Ybt to the periplasm because of the increased
OM impermeability.
The effects of a
ybtU2071 mutation on expression of
ybt genes are similar to those observed with other Ybt
biosynthetic mutants (irp1, irp2, and
ybtE) and support the hypothesis that the siderophore functions as a regulatory molecule. However, the lack of regulatory effects caused by
ybtT2072 and
ybtS::kan2070.1 appears to contradict this since neither mutant made detectable levels of Ybt. YbtT is a
potential proofreading thioesterase, while YbtS is hypothesized to
synthesize salicylate, the first moiety activated to initiate chain
elongation and Ybt synthesis (29). YbtE catalyzes the adenylation of salicylate and transfer of this activated group to the
N-terminal aryl carrier protein domain of HMWP2. Albeit at a much lower
efficiency, YbtE also adenylates 2,3-dihydroxybenzoate (30).
Thus, in the YbtS
mutant YbtE may activate
2,3-dihydroxybenzoate or another phenolate compound to initiate
synthesis of an aberrant Ybt molecule. The low efficiency of
YbtE-catalyzed activation or chain elongation from the altered
phenolate moiety may lead to low levels of the altered siderophore that
might interact with YbtA and thus allow normal regulation of the Ybt
system. Similarly, YbtT
mutants may produce an aberrant
compound(s) that can function as an inducer(s) in concert with YbtA.
The altered Ybt molecule must either be produced at low levels or be
retained within the bacterial cells since this molecule was not
detected by our HPLC analysis. Alternatively, it is possible that small
amounts of Ybt are synthesized by the YbtT
mutant and are
sufficient for normal regulation but not for growth stimulation.
Further experiments will be necessary to determine the nature of the
signal molecule in Ybt+ cells as well as in
YbtT
and YbtS
mutants.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by Public Health Service grant AI42738 from the National Institutes of Health.
We thank Scott W. Bearden for assistance with some sequence analyses and construction of pPSN345.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology and Immunology, MS415 Medical Center, University of Kentucky, Lexington, KY 40536-0084. Phone: (859) 323-6341. Fax: (859) 257-8994. E-mail: rperry{at}pop.uku.edu.
Formerly Valérie A. Coulanges.
Editor: J. T. Barbieri
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1987. Current protocols in molecular biology. John Wiley & Sons, New York, N.Y. |
| 2. | Bearden, S. W., J. D. Fetherston, and R. D. Perry. 1997. Genetic organization of the yersiniabactin biosynthetic region and construction of avirulent mutants in Yersinia pestis. Infect. Immun. 65:1659-1668[Abstract]. |
| 3. | Bearden, S. W., and R. D. Perry. 1999. The Yfe system of Yersinia pestis transports iron and manganese and is required for full virulence of plague. Mol. Microbiol. 32:403-414[CrossRef][Medline]. |
| 4. |
Bearden, S. W.,
T. M. Staggs, and R. D. Perry.
1998.
An ABC transporter system of Yersinia pestis allows utilization of chelated iron by Escherichia coli SAB11.
J. Bacteriol.
180:1135-1147 |
| 5. |
Bengoechea, J.-A.,
K. Brandenburg,
U. Seydel,
R. Díaz, and I. Moriyón.
1998.
Yersinia pseudotuberculosis and Yersinia pestis show increased outer membrane permeability to hydrophobic agents which correlates with lipopolysaccharide acyl-chain fluidity.
Microbiology
144:1517-1526 |
| 6. |
Birnboim, H. C., and J. Doly.
1979.
A rapid alkaline extraction procedure for screening recombinant plasmid DNA.
Nucleic Acids Res.
7:1513-1523 |
| 7. | Braun, V., K. Hantke, and W. Köster. 1998. Bacterial iron transport: mechanisms, genetics, and regulation. Met. Ions Biol. Syst. 35:67-145[Medline]. |
| 8. | Buchrieser, C., R. Brosch, S. Bach, A. Guiyoule, and E. Carniel. 1998. The high-pathogenicity island of Yersinia pseudotuberculosis can be inserted into any of the three chromosomal asn tRNA genes. Mol. Microbiol. 30:965-978[CrossRef][Medline]. |
| 9. |
Buchrieser, C.,
M. Prentice, and E. Carniel.
1998.
The 102-kilobase unstable region of Yersinia pestis comprises a high-pathogenicity island linked to a pigmentation segment which undergoes internal rearrangement.
J. Bacteriol.
180:2321-2329 |
| 10. |
Buchrieser, C.,
C. Rusniok,
L. Frangeul,
E. Couve,
A. Billault,
F. Kunst,
E. Carniel, and P. Glaser.
1999.
The 102-kilobase pgm locus of Yersinia pestis: sequence analysis and comparison of selected regions among different Yersinia pestis and Yersinia pseudotuberculosis strains.
Infect. Immun.
67:4851-4861 |
| 11. | Butler, A. R., N. Bate, and E. Cundliffe. 1999. Impact of thioesterase activity on tylosin biosynthesis in Streptomyces fradiae. Chem. Biol. 6:287-292[CrossRef][Medline]. |
| 12. | Byers, B. R., and E. L. Arceneaux. 1998. Microbial iron transport: iron acquisition by pathogenic microorganisms. Met. Ions Biol. Syst. 35:37-66[Medline]. |
| 13. |
Carniel, E.,
I. Guilvout, and M. Prentice.
1996.
Characterization of a large chromosomal "high-pathogenicity island" in biotype 1B Yersinia enterocolitica.
J. Bacteriol.
178:6743-6751 |
| 14. | Carniel, E., A. Guiyoule, I. Guilvout, and O. Mercereau-Puijalon. 1992. Molecular cloning, iron-regulation and mutagenesis of the irp2 gene encoding HMWP2, a protein specific for the highly pathogenic Yersinia. Mol. Microbiol. 6:379-388[Medline]. |
| 15. | Chambers, C. E., D. D. McIntyre, M. Mouck, and P. A. Sokol. 1996. Physical and structural characterization of yersiniophore, a siderophore produced by clinical isolates of Yersinia enterocolitica. Biometals. 9:157-167[Medline]. |
| 16. |
Chang, A. C. Y., and S. N. Cohen.
1978.
Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.
J. Bacteriol.
134:1141-1156 |
| 17. | Cosmina, P., R. Rodriguez, F. de Ferra, G. Grandi, M. Perego, G. Venema, and D. van Sinderen. 1993. Sequence and analysis of the genetic locus responsible for surfactin synthesis in Bacillus subtilis. Mol. Microbiol. 8:821-831[CrossRef][Medline]. |
| 18. |
Cox, C. D.,
K. L. Rinehart, Jr.,
M. L. Moore, and C. J. Cook, Jr.
1981.
Pyochelin: novel structure of an iron-chelating growth promoter for Pseudomonas aeruginosa.
Proc. Natl. Acad. Sci. USA
78:4256-4260 |
| 19. | Drechsel, H., H. Stephan, R. Lotz, H. Haag, H. Zähner, K. Hantke, and G. Jung. 1995. Structure elucidation of yersiniabactin, a siderophore from highly virulent Yersinia strains. Liebigs Ann. 1995:1727-1733[CrossRef]. |
| 20. | Farrell, D. H., P. Mikesell, L. A. Actis, and J. H. Crosa. 1990. A regulatory gene, angR, of the iron uptake system of Vibrio anguillarum: similarity with phage P22 cro and regulation by iron. Gene 86:45-51[CrossRef][Medline]. |
| 21. |
Ferber, D. M.,
J. M. Fowler, and R. R. Brubaker.
1981.
Mutations to tolerance and resistance to pesticin and colicins in Escherichia coli.
J. Bacteriol.
146:506-511 |
| 22. | Fetherston, J. D., S. W. Bearden, and R. D. Perry. 1996. YbtA, an AraC-type regulator of the Yersinia pestis pesticin/yersiniabactin receptor. Mol. Microbiol. 22:315-325[CrossRef][Medline]. |
| 23. | Fetherston, J. D., V. J. Bertolino, and R. D. Perry. 1999. YbtP and YbtQ: two ABC transporters required for iron uptake in Yersinia pestis. Mol. Microbiol. 32:289-299[CrossRef][Medline]. |
| 24. |
Fetherston, J. D.,
J. W. Lillard, Jr., and R. D. Perry.
1995.
Analysis of the pesticin receptor from Yersinia pestis: role in iron-deficient growth and possible regulation by its siderophore.
J. Bacteriol.
177:1824-1833 |
| 25. | Fetherston, J. D., and R. D. Perry. 1994. The pigmentation locus of Yersinia pestis KIM6+ is flanked by an insertion sequence and includes the structural genes for pesticin sensitivity and HMWP2. Mol. Microbiol. 13:697-708[Medline]. |
| 26. | Fetherston, J. D., P. Schuetze, and R. D. Perry. 1992. Loss of the pigmentation phenotype in Yersinia pestis is due to the spontaneous deletion of 102 kb of chromosomal DNA which is flanked by a repetitive element. Mol. Microbiol. 6:2693-2704[Medline]. |
| 27. |
Froehlich, B.,
L. Husmann,
J. Caron, and J. R. Scott.
1994.
Regulation of rns, a positive regulatory factor for pili of enterotoxigenic Escherichia coli.
J. Bacteriol.
176:5385-5392 |
| 28. | Gaisser, S., and C. Hughes. 1997. A locus coding for putative non-ribosomal peptide/polyketide synthase functions is mutated in a swarming-defective Proteus mirabilis strain. Mol. Gen. Genet. 253:415-427[CrossRef][Medline]. |
| 29. | Gehring, A. M., E. DeMoll, J. D. Fetherston, I. Mori, G. F. Mayhew, F. R. Blattner, C. T. Walsh, and R. D. Perry. 1998. Iron acquisition in plague: modular logic in enzymatic biogenesis of yersiniabactin by Yersinia pestis. Chem. Biol. 5:573-586[CrossRef][Medline]. |
| 30. | Gehring, A. M., I. Mori, R. D. Perry, and C. T. Walsh. 1998. The nonribosomal peptide synthetase HMWP2 forms a thiazoline ring during biogenesis of yersiniabactin, an iron-chelating virulence factor of Yersinia pestis. Biochemistry 37:11637-11650[CrossRef][Medline]. |
| 31. |
Guilvout, I.,
O. Mercereau-Puijalon,
S. Bonnefoy,
A. P. Pugsley, and E. Carniel.
1993.
High-molecular-weight protein 2 of Yersinia enterocolitica is homologous to AngR of Vibrio anguillarum and belongs to a family of proteins involved in nonribosomal peptide synthesis.
J. Bacteriol.
175:5488-5504 |
| 32. |
Hare, J. M., and K. A. McDonough.
1999.
High-frequency RecA-dependent and -independent mechanisms of Congo red binding mutations in Yersinia pestis.
J. Bacteriol.
181:4896-4904 |
| 33. | Hare, J. M., A. K. Wagner, and K. A. McDonough. 1999. Independent acquisition and insertion into different chromosomal locations of the same pathogenicity island in Yersinia pestis and Yersinia pseudotuberculosis. Mol. Microbiol. 31:291-303[CrossRef][Medline]. |
| 34. | Heesemann, J., K. Hantke, T. Vocke, E. Saken, A. Rakin, I. Stojiljkovic, and R. Berner. 1993. Virulence of Yersinia enterocolitica is closely associated with siderophore production, expression of an iron-repressible outer membrane polypeptide of 65 000 Da and pesticin sensitivity. Mol. Microbiol. 8:397-408[CrossRef][Medline]. |
| 35. | Hohn, B., and J. Collins. 1980. A small cosmid for efficient cloning of large DNA fragments. Gene 11:291-298[CrossRef][Medline]. |
| 36. | Hornung, J. M., H. A. Jones, and R. D. Perry. 1996. The hmu locus of Yersinia pestis is essential for utilization of free haemin and haem-protein complexes as iron sources. Mol. Microbiol. 20:725-739[CrossRef][Medline]. |
| 37. | Humphreys, G. O., G. A. Willshaw, and E. S. Anderson. 1975. A simple method for the preparation of large quantities of pure plasmid DNA. Biochim. Biophys. Acta 383:457-463[Medline]. |
| 38. | Jalal, M. A. F., M. B. Hossain, D. van der Helm, J. Sanders-Loehr, L. A. Actis, and J. H. Crosa. 1989. Structure of anguibactin, a unique plasmid-related bacterial siderophore from the fish pathogen Vibrio anguillarum. J. Am. Chem. Soc. 111:292-296[CrossRef]. |
| 39. | Kaniga, K., I. Delor, and G. R. Cornelis. 1991. A wide-host-range suicide vector for improving reverse genetics in Gram-negative bacteria: inactivation of the blaA gene of Yersinia enterocolitica. Gene 109:137-141[CrossRef][Medline]. |
| 40. | Kutyrev, V. V., A. A. Filippov, O. S. Oparina, and O. A. Protsenko. 1992. Analysis of Yersinia pestis chromosomal determinants Pgm+ and PstS associated with virulence. Microb. Pathog. 12:177-186[CrossRef][Medline]. |
| 41. |
Lucier, T. S., and R. R. Brubaker.
1992.
Determination of genome size, macrorestriction pattern polymorphism, and nonpigmentation-specific deletion in Yersinia pestis by pulsed-field gel electrophoresis.
J. Bacteriol.
174:2078-2086 |
| 42. | Marahiel, M. A., T. Stachelhaus, and H. D. Mootz. 1997. Modular peptide synthetases involved in nonribosomal peptide synthesis. Chem. Rev. 97:2651-2673[CrossRef][Medline]. |
| 43. | Mietzner, T. A., and S. A. Morse. 1994. The role of iron-binding proteins in the survival of pathogenic bacteria. Annu. Rev. Nutr. 14:471-493[CrossRef][Medline]. |
| 44. | Miller, J. H. 1992. A short course in bacterial genetics. A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 45. | Nakai, K., and M. Kanehisa. 1991. Expert system for predicting protein localization sites in Gram-negative bacteria. Proteins 11:95-110[CrossRef][Medline]. |
| 46. |
Pelludat, C.,
A. Rakin,
C. A. Jacobi,
S. Schubert, and J. Heesemann.
1998.
The yersiniabactin biosynthetic gene cluster of Yersinia enterocolitica: organization and siderophore-dependent regulation.
J. Bacteriol.
180:538-546 |
| 47. |
Perry, R. D.,
P. B. Balbo,
H. A. Jones,
J. D. Fetherston, and E. DeMoll.
1999.
Yersiniabactin from Yersinia pestis: biochemical characterization of the siderophore and its role in iron transport and regulation.
Microbiology
145:1181-1190 |
| 48. |
Perry, R. D., and J. D. Fetherston.
1997.
Yersinia pestis etiologic agent of plague.
Clin. Microbiol. Rev.
10:35-66[Abstract].
|
| 49. |
Perry, R. D.,
S. C. Straley,
J. D. Fetherston,
D. J. Rose,
J. Gregor, and F. R. Blattner.
1998.
DNA sequencing and analysis of the low-Ca2+-response plasmid pCD1 of Yersinia pestis KIM5.
Infect. Immun.
66:4611-4623 |
| 50. |
Rakin, A.,
C. Noelting,
S. Schubert, and J. Heesemann.
1999.
Common and specific characteristics of the high-pathogenicity island of Yersinia enterocolitica.
Infect. Immun.
67:5265-5274 |
| 51. | Rakin, A., E. Saken, D. Harmsen, and J. Heesemann. 1994. The pesticin receptor of Yersinia enterocolitica: a novel virulence factor with dual function. Mol. Microbiol. 13:253-263[Medline]. |
| 52. | Rakin, A., S. Schubert, C. Pelludat, D. Brem, and J. Heesemann. 1999. The high-pathogenicity island of yersiniae, p. 77-90. In J. B. Kaper, and J. Hacker (ed.), Pathogenicity islands and other mobile virulence elements. American Society for Microbiology, Washington, D.C. |
| 53. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 54. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 55. | Schneider, A., and M. A. Marahiel. 1998. Genetic evidence for a role of thioesterase domains, integrated in or associated with peptide synthetases, in non-ribosomal peptide biosynthesis in Bacillus subtilis. Arch. Microbiol. 169:404-410[CrossRef][Medline]. |
| 56. |
Schubert, S.,
A. Rakin,
H. Karch,
E. Carniel, and J. Heesemann.
1998.
Prevalence of the "high-pathogenicity island" of Yersinia species among Escherichia coli strains that are pathogenic to humans.
Infect. Immun.
66:480-485 |
| 57. |
Serino, L.,
C. Reimann,
P. Visca,
M. Beyeler,
V. Della Chiesa, and D. Haas.
1997.
Biosynthesis of pyochelin and dihydroaeruginoic acid requires the iron-regulated pchDCBA operon in Pseudomonas aeruginosa.
J. Bacteriol.
179:248-257 |
| 58. | Shaw-Reid, C., N. Kelleher, H. C. Losey, A. M. Gehring, C. Berg, and C. T. Walsh. 1999. Assembly line enzymology by multimodular nonribosomal peptide synthetases: the thioesterase domain of Escherichia coli EntF catalyzes both elongation and cyclolactonization. Chem. Biol. 6:385-400[CrossRef][Medline]. |
| 59. |
Sikkema, D. J., and R. R. Brubaker.
1987.
Resistance to pesticin, storage of iron, and invasion of HeLa cells by yersiniae.
Infect. Immun.
55:572-578 |
| 60. |
Staggs, T. M.,
J. D. Fetherston, and R. D. Perry.
1994.
Pleiotropic effects of a Yersinia pestis fur mutation.
J. Bacteriol.
176:7614-7624 |
| 61. |
Staggs, T. M., and R. D. Perry.
1991.
Identification and cloning of a fur regulatory gene in Yersinia pestis.
J. Bacteriol.
173:417-425 |
| 62. | Suo, Z., C. T. Walsh, and D. A. Miller. 1999. Tandem heterocyclization activity of the multidomain 230 kDa HMWP2 subunit of Yersinia pestis yersiniabactin synthetase: interaction of the 1-1382 and 1383-2035 fragments. Biochemistry 38:14023-14035[CrossRef][Medline]. |
| 63. | Surgalla, M. J., and E. D. Beesley. 1969. Congo red-agar plating medium for detecting pigmentation in Pasteurella pestis. Appl. Microbiol. 18:834-837[Medline]. |
| 64. |
Thompson, J. M.,
H. A. Jones, and R. D. Perry.
1999.
Molecular characterization of the hemin uptake locus (hmu) from Yersinia pestis and analysis of hmu mutants for hemin and hemoprotein utilization.
Infect. Immun.
67:3879-3892 |
| 65. | Weinberg, E. D., and G. A. Weinberg. 1995. The role of iron in infection. Curr. Opin. Infect. Dis. 8:164-169[CrossRef]. |
| 66. |
Wertheimer, A. M.,
W. Verweij,
Q. Chen,
L. M. Crosa,
M. Nagasawa,
M. E. Tolmasky,
L. A. Actis, and J. H. Crosa.
1999.
Characterization of the angR gene of Vibrio anguillarum: essential role in virulence.
Infect. Immun.
67:6496-6509 |
| 67. |
Xue, Y.,
L. Zhao,
H. Liu, and D. H. Sherman.
1998.
A gene cluster for macrolide antibiotic biosynthesis in Streptomyces venezuelae: architecture of metabolic diversity.
Proc. Natl. Acad. Sci. USA
95:12111-12116 |
| 68. | Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»