Previous Article | Next Article 
Infection and Immunity, August 2000, p. 4598-4603, Vol. 68, No. 8
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Switching of Flagellar Motility in Helicobacter pylori
by Reversible Length Variation of a Short Homopolymeric Sequence
Repeat in fliP, a Gene Encoding a Basal Body
Protein
Christine
Josenhans,1,2
Kathryn A.
Eaton,3
Tracy
Thevenot,3 and
Sebastian
Suerbaum1,2,*
Institute of Hygiene and Microbiology, University of
Würzburg, D-97080 Würzburg,1 and
Department of Medical Microbiology, Ruhr-Universität
Bochum, D-44780 Bochum,2 Germany, and
Department of Veterinary Biosciences, Ohio State
University, Columbus, Ohio3
Received 28 January 2000/Returned for modification 24 March
2000/Accepted 15 May 2000
 |
ABSTRACT |
The genome of Helicobacter pylori contains numerous
simple nucleotide repeats that have been proposed to have regulatory
functions and to compensate for the conspicuous dearth of master
regulatory pathways in this highly host-adapted bacterium. H. pylori strain 26695, whose genomic sequence was determined by The
Institute for Genomic Research (TIGR), contains a repeat of nine
cytidines in the fliP flagellar basal body gene that splits
the open reading frame in two parts. In this work, we demonstrate that
the 26695C9 strain with a split fliP gene as
sequenced by TIGR was nonflagellated and nonmotile. In contrast,
earlier isolates of strain 26695 selected by positive motility testing
as well as pig-passaged derivatives of 26695 were all flagellated and
highly motile. All of these motile strains had a C8 repeat
and consequently a contiguous fliP reading frame. By
screening approximately 50,000 colonies of 26695C9 for
motility in soft agar, a motile revertant with a C8 repeat could be isolated, proving that the described switch is reversible. The
fliP genes of 20 motile clinical H. pylori
isolates from different geographic regions possessed intact
fliP genes with repeats of eight cytidines or the sequence
CCCCACCC in its place. Isogenic fliP mutants of
a motile, C8 repeat isolate of strain 26695 were constructed by allelic exchange mutagenesis and found to be defective in flagellum biogenesis. Mutants produced only small amounts of flagellins, while the transcription of flagellin genes appeared unchanged. These results strongly suggest a unique mechanism regulating motility in H. pylori which relies on slipped-strand
mispairing-mediated mutagenesis of fliP.
 |
INTRODUCTION |
Helicobacter pylori, the
causative agent of gastritis and ulcer disease in humans, relies on its
high motility in viscous environments to colonize and persist in the
human stomach (14, 18). H. pylori carries a
unipolar bundle of sheathed flagella (19). Relatively little
is known about the regulation of flagellar biosynthesis in H. pylori (32, 33). The whole genome sequence of H. pylori strain 26695 (determined by The Institute for Genomic Research [TIGR]) has revealed a conspicuous lack of regulatory elements that are present in other eubacterial species (36). H. pylori does not possess a homolog of the flhCD
master operon which is at the top of the regulatory hierarchy coupling
cell division and motility functions in Salmonella enterica
serovar Typhimurium, Bacillus subtilis, and other
eubacteria (23). H. pylori also appears to lack a
homolog of the flgM gene that in other eubacteria codes for
an antagonist of the flagellar sigma factor,
28
(15). Except for the gene coding for the major H. pylori flagellin, flaA, most flagellar genes of
H. pylori are governed by
54- or
70-dependent promoters (28, 33, 34). Taken
together, the available data suggest that the regulation of flagellar
biogenesis and motility differs considerably between H. pylori and other bacteria.
The complete genome sequences of H. pylori strains 26695 and
J99 contain close to 30 genes with simple sequence repeats
(dinucleotide repeats or homopolymeric tracts), either within the
upstream regulatory regions or within the coding sequences (2,
36). Because of the abundance of such sequence repeats,
slipped-strand mispairing has been suggested to be involved in the
control of gene expression in H. pylori (31).
Simple nucleotide repeats are mutational hot spots because they reduce
the fidelity of both DNA replication and transcription. Changes of
repeat length due to slipped-strand mispairing (insertion or deletion
of repeat units) and consequent disruption of open reading frames by
premature stop codons occur at a much higher rate than mutations in
other areas of the chromosome. Slipped-strand mispairing plays a
regulatory role, on both transcriptional and translational levels, in
several other bacteria, mainly for the variation of surface-associated
proteins and related structures such as fimbriae, capsules, or
lipopolysaccharides (13, 25, 39; for a review, see
reference 38). Recently, slipped-strand mispairing
within fucosyltransferase genes of H. pylori has been demonstrated to play a role in the variation of lipopolysaccharide O-specific side chains (4, 40). Among the potentially
phase-variable genes of H. pylori, there is also one
motility-associated gene, fliP, the product of which is
involved in the flagellar export apparatus of eubacteria (27,
31).
In H. pylori strain 26695, whose genome has been sequenced
completely, fliP contains a repeat of nine cytidines
(C9) within its coding region (36). This repeat
causes a frameshift and splits the gene in two parts (HP0684 and
HP0685). In the second complete genome sequence of an H. pylori strain (J99), fliP is a contiguous open reading
frame with a C8 repeat (2).
We therefore wanted to know if the C9 repeat in
fliP might in fact be involved in motility regulation in
H. pylori and if the motility phenotype of the organism is
dependent on expression of a full-length FliP protein. We have studied
the fliP locus in different motile and nonmotile variants of
strain 26695 and in different clinical isolates of H. pylori. In addition, we constructed and characterized isogenic
fliP mutants of different H. pylori strains. The
results make a convincing case for slipped-strand mispairing within the
fliP locus as a novel regulatory feature of H. pylori motility.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and growth conditions.
H.
pylori strains N6 (11) and 88-3887, a motile
pig-passaged variant of H. pylori 26695 (36), and
the mouse colonizing strain SS1 (21) were used for the
construction of fliP mutants. fliP sequences were
determined for various motile and nonmotile variants of 26695, for N6,
SS1, the nonmotile strain Tx30a (22), and for 20 clinical
isolates from Germany, South Africa, and Singapore (1, 35).
Culture conditions for H. pylori strains were as described
elsewhere (34).
DNA manipulation, PCR, and nucleotide sequencing.
DNA
manipulations were done according to standard protocols
(30). H. pylori genomic DNA for sequence
determination was prepared with a QiaAmp tissue kit (Qiagen Inc.,
Hilden, Germany). Plasmid DNA was purified with the Qiagen Midi column
plasmid purification kit. DNA restriction fragments or PCR products
were purified from agarose gels with a QiaQuick DNA purification kit
(Qiagen). Nucleotide sequences were determined by direct sequencing of
PCR products generated using the primers OLHPFliP1
(CCTCATTTGCCCTTTAATATGC) and OLHPFliP2
(GGCAGAGAAATCATTACAGG). PCR consisted of 35 cycles as
follows: denaturation, 94°C for 1 min; annealing, 50°C for 1 min;
and extension, 72°C for 1 min; 75-ng aliquots of PCR products purified using the QiaQuick PCR purification kit (Qiagen) were used in
cycle sequencing reactions from both strands with an ABI Prism dye
terminator cycle sequencing kit (Applied Biosystems), using the same
primers and independent PCR products for each strand. Sequences were
aligned using Seqlab and Pileup from the Wisconsin Package, version 9.1 (Genetics Computer Group, Madison, Wis.). All sequences were reduced to
a common length of 480 nucleotides.
Construction of isogenic fliP mutants of H. pylori.
The complete fliP gene from the motile 26695 variant 88-3887 (fliPC8) including additional
upstream and downstream sequences (1,622 bp) was amplified by PCR with
the primers OLHPFliP3s (TATGGATCCCATAACCTTTAGGGTCAGC) and OLHPFliP4s (TTAGGATCCGACTTTTGGTATTAGCAGC),
which both contained BamHI sites, and cloned into
vectors pILL570 (20) and pUC18 cut with BamHI to
give plasmids pCJ53 and pCJ51, respectively. Subsequently, the cloned
fliP gene was disrupted by insertion of a cassette that
contains a kanamycin resistance gene (aphA-3 [37]). The cassette was inserted in two different
positions. In plasmid pCJ55, a direct derivative of pCJ53, the cassette
was introduced into a natural EcoRI restriction site at
nucleotide position 360 of the fliP locus in H. pylori KE26695, which is 151 nucleotides downstream of the
C8 repeat and 96 nucleotides downstream of the stop codon.
To construct a plasmid where the insertion was located exactly at the
same position of the premature stop codon in C9 strains,
the following strategy was used. Inverse PCR with primers OLHPFliP5s
(TTAAGATCTCTATGATACAGGGATTAAGC) and OLHPFliP6s
(ATTAGATCTCGAGACTAAAATTTGAGTGG) and plasmid pCJ51
(fliP insert in pUC18) as the template was used to generate
a 50-bp deletion in fliP and to introduce a BglII
restriction site at this deletion site just 18 nucleotides downstream
of the C8 repeat. The deletion (nucleotides 229 to 279 of
fliP) includes the stop codon generated by the
fliPC9 locus in 26695 (the TIGR strain). The
aphA-3 cassette (cut from pILL600 with BamHI) was
ligated into this construct, yielding plasmid pCJ57. Since
fliP is not part of an operon and the two genes downstream
of fliP are transcribed in the opposite direction of
fliP, polar effects of these disruptions were extremely
unlikely. Nevertheless, in both plasmids pCJ55 and pCJ57, the
aphA-3 cassette, which has a strong promoter and no
transcription terminator, was inserted in the same transcriptional orientation with respect to fliP, further reducing the
possibility of polar effects. Plasmids pCJ55 and pCJ57 were used to
generate allelic replacement mutants of H. pylori strains
SS1 and N6 and the motile 26695 variant 88-3887 by natural
transformation. Natural transformation of H. pylori was
performed as described elsewhere (6). After natural
transformation, the bacteria were grown on nonselective plates for a
period of 24 h and then transferred to plates containing kanamycin
(20 mg/liter). Recombinant colonies were selected after 3 to 5 days of
growth. The correct genotype of the kanamycin-resistant mutants was
verified by PCRs with primers binding to the target gene and primers
binding to the aphA-3 cassette as previously described
(34) (data not shown).
SDS-PAGE and Western blotting.
Whole-cell lysates of
Helicobacter cells were obtained by sonication, while
flagellar filament proteins were partially purified by mechanical
shearing and ultracentrifugation as described elsewhere (12). Sodium dodecyl sulfate-polyacrylamide gel
electrophoresis and Western blotting were performed as described
elsewhere (32). The blots were incubated with a mixture of
antisera raised against purified recombinant FlaA and FlaB flagellins
of H. pylori, each diluted 1:1,500. Bound antibodies were
visualized with a peroxidase-coupled goat anti-rabbit antibody (diluted
1:3,000; Jackson Biologicals Laboratory, West Grove, Pa.).
Electron microscopy and motility testing.
Transmission
electron microscopy of negatively stained bacteria was performed as
described elsewhere (17). Motility testing of H. pylori strains was performed either in wet mounts or in 0.3%
motility agar plates as described elsewhere (7, 17). Motility plates were incubated for 5 days.
Preparation of RNA from H. pylori.
RNA from H. pylori was prepared by the RNEasy Midi-Prep procedure (Qiagen) or
using a CsCl centrifugation method described by Spohn and Scarlato
(33). RNA was prepared from bacteria grown on two blood agar
plates for 24 h or from 25 ml of liquid culture grown to an
optical density at 600 nm of about 1.0 (mid-log phase, approximately
1010 bacteria). RNA slot blotting was done with a Bio-Dot
slot blotting apparatus (Bio-Rad). The amount of specific mRNA was
detected by hybridization with digoxigenin (DIG)-labeled DNA probes
(flaA, flaB, flgE, and
fliP; PCR-generated fragments; probes were generated with a
DIG-labeling kit from Boehringer/Roche); 2-µg aliquots of RNA were
analyzed on the blots. In all strains, the hybridization signal with a
fliP probe was too weak to be evaluated, even when 5 µg of
RNA was used. Control hybridizations using the four different probes on
an Escherichia coli DH5
RNA gave no detectable background signal. The sequences of the primers used to generate the probes by PCR
are available upon request.
Nucleotide sequence accession number.
The nucleotide
sequences described in this paper have been submitted to the GenBank
database (accession no. AJ404379 to AJ404400).
 |
RESULTS |
H. pylori 26695C9 (the TIGR strain) is
nonmotile and lacks flagella.
Because the genome sequence of
H. pylori 26695C9 does not contain a full-length
fliP gene, we analyzed whether this strain carried flagella
and was motile. H. pylori 26695C9 was studied by
electron microscopy, and no flagella were detected (data not shown).
Bacteria were completely nonspreading in motility agar, and no motility
was visible by direct microscopy of wet mounts (Fig.
1).

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 1.
Motility tests of H. pylori
26695C9 and the pig-passaged variant, 88-3887. The
nonmotile 26695C9 strain shows only pinpoint colonies
without spreading, while the majority of 88-3887 colonies have a
spreading phenotype. The inset in the upper left corner shows a
magnification of the area of the plate marked by the square.
|
|
Different fliP genotypes in motile and nonmotile
variants of strain 26695.
Previous studies have shown that
motility is essential for the ability of H. pylori and other
Helicobacter spp. to colonize the gastric mucosa (3, 9,
16). It was therefore surprising that a virulent isolate of
H. pylori was nonmotile. H. pylori 26695 was
received by one of us in 1986. It was noted that colonies of highly
motile and nonmotile bacteria could be identified in soft agar, and
both variants were isolated and frozen (8).
To clarify whether the motility of different 26695 variants depended on
the length of the
fliP repeat sequence, a 642-bp fragment
of
fliP that contained the homopolymeric repeat was amplified
by PCR and sequenced directly from both strands for 26695
C9
as
well as several motile and nonmotile variant strains (Table
1).
26695
C9 contained a
C
9 repeat and a premature stop codon in
fliP 53 nucleotides downstream of the repeat, as reported by Tomb et
al.
(
36) (Fig.
2). An original motile variant (26C) that had
been selected because it formed large spreading colonies in motility
agar had eight cytidine residues and a continuous
fliP gene,
while
a nonmotile variant (26B) had nine cytidines (Table
1; Fig.
2).
We also analyzed six strains each
that had been obtained from
initial motile or nonmotile variant strains
by repeatedly passaging
them in vitro without selection for or against
motility (up to
10 passages). No changes in the repeat length were
detectable
in those passaged strains. Three strains (for example,
strain
88-3887) that had been reisolated from piglets that had been
experimentally
infected with the original (mixed)
H. pylori
26695 were fully
motile and possessed the
fliPC8
genotype.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Schematic representation of H. pylori
fliP and positions of the poly(C) repeat (arrow) and insertion
points of the kanamycin resistance cassette in plasmids pCJ55
(triangle; insertion into EcoRI site) and pCJ57 (trapezoid;
50-bp deletion). (B) Nucleotide sequences and deduced translation (in
three-letter code) of the region surrounding the poly(C) repeat in a
motile and a nonmotile variant of H. pylori 26695, in the
nonmotile strain Tx30a, and in H. pylori N6. The repeat is
located 315 nucleotides downstream of the fliP start
codon.
|
|
Isolation of motile revertants of 26695C9.
To
demonstrate that the switch from motile (C8) to nonmotile
(C9) was reversible, we isolated a motile revertant of
26695C9. The bacteria were diluted in motility agar and
poured into petri dishes. Approximately 50,000 colonies were screened
before a spreading colony was detected. The spreading colony was
isolated and purified through a second round of motility testing. As
expected, the motile revertant (26695-R1) had a C8 repeat.
A second revertant (26BH) was isolated from strain 26B (C9) by growing
a stab preparation of 26B in motility agar for 4 days, swabbing the
edge of the streak, and culturing that in broth. That broth produced
117 motile colonies (of 152 total), one of which was colony purified
and became 26BH. Like 26695-R1, 26BH had a C8 repeat.
fliP sequence comparison of different H. pylori strains.
To determine if the poly(C) repeat within
fliP was conserved between different H. pylori
strains, we evaluated fliP sequences (480 nucleotides) from
17 clinical isolates of H. pylori and from four widely used
laboratory strains of H. pylori (SS1, NCTC11637, NCTC11639,
and Tx30a [Table 1; Fig. 2]). With the exception of strain Tx30a,
which, consistent with previous reports (7), was nonmotile
and lacked flagella, all strains analyzed were motile and carried
flagella. Strain Tx30a possessed a C7 stretch instead of
the C8 sequence of the motile wild-type strains. All motile strains had a continuous fliP gene; 13 out of the 22 motile
strains had an adenine instead of the fifth cytidine within the repeat (CCCCACCC). All five strains from Asia had the
CCCCACCC-type allele, while only one out of six strains from
the Cape Coloured population in South Africa had that allele.
Construction and characterization of isogenic fliP
mutants.
To prove that the premature stop of FliP translation in
the strains with a fliPC9 or
fliPC7 sequence was sufficient to cause the loss
of motility and flagellation observed in 26695C9 and Tx30a,
isogenic fliP mutants of three different motile H. pylori strains (the mouse-colonizing strains SS1 and N6 and the
piglet-passaged motile variant 88-3887 of strain 26695) were
constructed by disruption of fliP with an aphA-3
cassette at two different positions, both close to the position of the
premature stop codon in fliPC9 strains (Fig.
2A). For each of the wild-type strains, two different fliP mutants were constructed by natural transformation with pCJ55 or pCJ57.
Prior to transformation, the wild-type strains were again checked for
motility and the presence of flagella to ensure that motility had not
accidentally been lost by repeated in vitro passage.
The
fliP region of all mutant strains obtained by allelic
exchange mutagenesis was resequenced to exclude that the repeat
length
had changed during the mutant selection process. All mutants
had
retained the C
8 repeat and had integrated the
aphA-3 cassette
into their genome at the predetermined
sites. In all mutant strains,
independent of the parent strain, the
sequenced part of
fliP was
identical to the 26695
fliP sequence, because during the double-crossover
event,
the wild-type
fliP sequences had been replaced by the 26695
sequences flanking the
aphA-3 cassette in the suicide
plasmids.
Both types of mutants in the different
H. pylori
strains were
characterized for motility and the presence of flagella,
and flagellin
expression was checked by Western blot analysis. The
phenotypes
of both types of
fliP mutants (pCJ55 and pCJ57)
were identical
in all strains and indistinguishable from the phenotype
of 26695
C9.
All
fliP mutants failed to form
flagella as determined by transmission
electron microscopy and were
nonmotile.
Whole-cell lysates and sheared flagellar material of selected wild-type
strains with different
fliP genotypes and isogenic
fliP mutant strains were analyzed for the presence of
flagellins
by Western blotting with antisera raised against
H. pylori FlaA
and FlaB flagellins (Fig.
3). Flagellin synthesis in
26695
C9 was
very low compared to motile
H. pylori wild-type strains, but FlaA
was present in whole-cell
lysates and, in much lower amounts,
in sheared material. To exclude
that free flagellin is released
into the medium by the nonmotile
strains, supernatants of strains
grown in liquid culture were
precipitated with trichloroacetic
acid and analyzed; they did not
contain significant amounts of
flagellin (data not shown).

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 3.
Western blot analysis of flagellin expression in
H. pylori strains with different fliP genotypes.
(Top) Whole-cell lysates; (bottom) partially purified flagella.
Material prepared from equal numbers of bacteria was loaded in each
lane of the gel. Blots were developed with antisera raised against
recombinant H. pylori flagellins. wt, wild type.
|
|
Transcriptional analyses of flagella-associated genes in nonmotile
H. pylori fliP mutant strains and in motile wild-type
strains.
Transcription of the flaA and flaB
flagellin genes and the hook gene, flgE, was measured by RNA
slot blot hybridization in H. pylori 26695C9,
the motile variant of 26695 (88-3887; fliPC8), an isogenic fliP mutant of 88-3887, and the N6 wild-type
strain. In all strains with an interrupted fliP gene,
flaA-, flaB-, and flgE-specific mRNAs
were present in about the same amounts as in the motile wild-type
strains (Fig. 4). These data ruled out the possibility that the observed profound reduction in flagellin in
these strains was due to a downregulation of flagellin gene transcription.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 4.
Slot blot hybridization of RNA isolated from H. pylori strains with different fliP genotypes with DNA
probes specific for 16S rRNA (16S) and flaA-,
flaB-, or flgE-specific mRNA. Each slot contained
2 µg of total RNA. wt, wild type.
|
|
 |
DISCUSSION |
fliP genotypes and motility in H. pylori
26695.
The data presented here show that H. pylori can
use slipped-strand mispairing-mediated frameshifting in fliP
to switch the formation of flagella and hence motility off and on.
fliP encodes a component of the flagellar basal body and was
not previously known to be involved in flagellar regulation of any
bacterial species (24). fliP can be reversibly
inactivated by addition or deletion of a single cytidine which results
in a frameshift and introduces an early stop codon. The consequence of
fliP inactivation is a shutdown of flagellar assembly. The
observed reduction in the expression of flagellins was not due to
transcriptional regulation, because mRNA for major structural flagellar
components was present in unchanged amounts in fliP knockout
mutants and repeat length variants.
It has been known for a long time that
H. pylori loses its
motility after prolonged in vitro passage, but the mechanisms
responsible
for this loss of motility were not known. The
H. pylori genome
contains relatively few regulatory genes. A striking
example is
the absence of master regulatory genes (
flhCD and
flgM) from the
flagellar regulatory cascade that have
central roles in other
bacterial species. In agreement with this, a
lack of feedback
mechanisms coupling flagellar assembly to the
expression of late
flagellar genes has been observed in
H. pylori hook (
flgE) and
flagellin (
flaA and
flaB) mutants (
28,
34). The switching
mechanism
described here may compensate, at least in part, for
the lack of other
regulatory
elements.
The
fliP-based switching mechanism appears to be relatively
specific to
H. pylori. A manual search of all available
fliP sequences
in GenBank for homopolymeric tracts or
dinucleotide repeats was
performed. No homopolymeric tract was present
in the
fliP gene
of
Campylobacter jejuni, whose
flagellar system is otherwise quite
similar to that of
H. pylori, or the
fliP genes of any other bacterium
with
the notable exception of
Borrelia burgdorferi, where the
potentially frameshiftable sequence T
9AT
6 is
located only few
nucleotides downstream of the start codon of
fliP (GenBank accession
no.
L75945). It is tempting to
speculate that
B. burgdorferi,
which, like
H. pylori, has very few regulatory genes (e.g., only
two
two-component signal transduction systems) may employ a similar
strategy to switch off motility. Indeed, frameshifts in a
motility-associated
gene have only recently been shown for the first
time to be involved
in switching of flagellar biogenesis. Park et al.
(
29) showed
that a nonmotile variant of
Campylobacter
coli UA585 had an interrupted
flhA gene, which was due
to a length change in a short homopolymeric
T repeat. Motile revertants
had corrected the repeat length and
restored an intact
flhA
gene. No repeat was present in
C. jejuni flhA or in
H. pylori flhA (formerly
flbA) (
34).
fliP mutants.
The hypothesis that the nonmotile
phenotypes of H. pylori strains 26695 and Tx30a are caused
by the frameshifts in fliP was verified by the construction
of isogenic fliP knockout mutants of different motile
H. pylori strains. Polar effects of the cassette mutagenesis
were extremely unlikely, because fliP in H. pylori (unlike in salmonellae) is not part of an operon. The two
genes located downstream of fliP are transcribed in the
opposite direction. The phenotype of these mutants was
indistinguishable from that of 26695C9.
FliP and flagellar assembly.
In salmonellae, FliP is an early
flagellar protein on the second hierarchical level of flagellar
biogenesis and under the direct control of the flhCD master
operon, which is not present in H. pylori (27).
FliP, of which in salmonellae there are about five subunits per
flagellum, is considered a component of the flagellar type III export
system in the flagellar basal body (10). It is highly likely
that fliP mutants are no longer able to export flagellar
components (27). In the H. pylori nonmotile
wild-type strains as well as the isogenic fliP mutants,
small amounts of flagellin were detected in the cytoplasmic fraction of
the bacteria, showing that translation still takes place. In contrast
to what was described for H. pylori flgE mutants
(28), there was no accumulation of intracellular flagellin,
suggesting that flagellin stability is reduced in fliP mutants.
Frequency of motility switching.
The switching frequencies of
the motility phenotype had previously been determined to be 1.6 × 10
4 for the motile-to-nonmotile switch and less than
10
7 for the inverse event (8). We could not
measure the rate of the fliP off switch, because when motile
strains of H. pylori are tested in soft agar, many colonies
appear nonmotile (such as the pinpoint colonies in the left panel of
Fig. 1). Most of these either still express flagellins or, if they do
not, still have a C8 genotype (data not shown). Thus,
frameshifting in fliP does not seem to be the only mechanism
responsible for loss of motility in H. pylori. With more
than 50 genes involved in motility and flagellar biosynthesis, there
are many different possible events that could cause a nonmotile
phenotype. We succeeded in detecting the fliP on switch.
Screening of a fliPC9 strain for back-mutation
to C8 yielded two independent revertants with two different
screening approaches. However, this event was so infrequent (1 revertant in 50,000 colonies screened) that it was impossible to
determine an exact switching frequency.
Since nonmotile mutants of
H. pylori are not able to
colonize in animal models, a strong selective pressure for motility
must
favor a motile phenotype in vivo, as has previously been shown
in
animal experiments (
8). On the other hand, loss of this
pressure

such as when bacteria are grown in vitro

leads to a frequent
loss of this energy-consuming property. It is not clear which
role this
propensity for a relatively frequent switch to a nonmotile
phenotype by
mutation in
fliP or by other mechanisms might play
in vivo.
It is conceivable that there is a niche for a proportion
of the
H. pylori bacteria where motility is no longer needed.
In
certain parts of the stomach mucosa not directly exposed to
the
shedding forces of mucus production or peristalsis, the energy-saving
loss of motility might be advantageous for a lifestyle of low
nutrient
requirements, continuous slow growth, and tight adherence
to
cells.
Sequence polymorphisms and recombination in fliP.
Thirteen out of 22 motile strains studied had an adenosine residue in
the fifth position of the repeat. This mutation would greatly reduce
the probability of slipped-strand mispairing mutagenesis. The relevance
of this polymorphism in the repeat sequence is not known. Since
motility is essential for colonization, it seems unlikely that a
hypermutatable nucleotide sequence that renders the motility system
more susceptible to functional inactivation would occur so frequently
unless this had biological significance. However, the occurrence of the
CCCCACCC sequence in more than half of the strains analyzed,
including all of the Asian strains, shows that the presence of the
C8 repeat is not essential, at least not in all hosts. It
is conceivable that there are subgroups of strains or strains in
particular hosts where loss of motility is particularly detrimental,
and strains with a CCCCACCC sequence therefore have a
selective advantage. Given the frequency of recombination in H. pylori (35), this mutation in the repeat sequence would not have to be a dead end for a given strain because the C8
repeat could be reacquired by recombination. Analysis of the
fliP sequences with the Homoplasy test (26) shows
that fliP has been involved in frequent recombination events
(data not shown). Finally, it has recently been shown in
Neisseria meningitidis that the frequency of slipped-strand
mispairing-mediated phase variation of capsule biosynthesis is strongly
dependent on the presence or absence of the mutator gene dam
(5). Although nothing is yet known about the occurrence of
mutator phenotypes in H. pylori, it is possible that similar
differences of mutation frequencies exist in H. pylori, and
these might strongly affect the frequency of fliP-mediated
motility switching.
 |
ACKNOWLEDGMENTS |
We gratefully acknowledge expert technical assistance by Susanne
Friedrich, Doris Jaromin, and Barbara Beuerle. We thank M. Heep and N. Lehn for the strains from Singapore and E. Kunstmann and P. van Helden
for strains from South Africa. We thank Chi Aizawa for critical reading
of the manuscript.
The work in S.S.'s laboratory was supported by grants SU 133/2-3
(Gerhard Hess award) and SU 133/3-1 from the Deutsche
Forschungsgemeinschaft. Work in K.A.E.'s laboratory was supported by
Public Health Service grants R01 AI43643 and R29 DK-45340 from the NIH.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Hygiene and Microbiology, University of Würzburg,
Josef-Schneider-Str. 2, D-97080 Würzburg, Germany. Phone:
49 931 201 3949. Fax: 49 931 201 3445. E-mail:
ssuerbaum{at}hygiene.uni-wuerzburg.de.
Editor:
J. T. Barbieri
 |
REFERENCES |
| 1.
|
Achtman, M.,
T. Azuma,
D. E. Berg,
Y. Ito,
G. Morelli,
Z. J. Pan,
S. Suerbaum,
S. A. Thompson,
A. van der Ende, and L. J. van Doorn.
1999.
Recombination and clonal groupings within Helicobacter pylori from different geographic regions.
Mol. Microbiol.
32:459-470[CrossRef][Medline].
|
| 2.
|
Alm, R. A.,
L. S. Ling,
D. T. Moir,
B. L. King,
E. D. Brown,
P. C. Doig,
D. R. Smith,
B. Noonan,
B. C. Guild,
B. L. deJonge,
G. Carmel,
P. J. Tummino,
A. Caruso,
M. Uria-Nickelsen,
D. M. Mills,
C. Ives,
R. Gibson,
D. Merberg,
S. D. Mills,
Q. Jiang,
D. E. Taylor,
G. F. Vovis, and T. J. Trust.
1999.
Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori.
Nature
397:176-180[CrossRef][Medline].
|
| 3.
|
Andrutis, K. A.,
J. G. Fox,
D. B. Schauer,
R. P. Marini,
X. Li,
L. Yan,
C. Josenhans, and S. Suerbaum.
1997.
Infection of the ferret stomach by isogenic flagellar mutant strains of Helicobacter mustelae.
Infect. Immun.
65:1962-1966[Abstract].
|
| 4.
|
Appelmelk, B. J.,
S. L. Martin,
M. A. Monteiro,
C. A. Clayton,
A. A. McColm,
P. Zheng,
T. Verboom,
J. J. Maaskant,
D. H. van den Eijnden,
C. H. Hokke,
M. B. Perry,
C. M. Vandenbroucke-Grauls, and J. G. Kusters.
1999.
Phase variation in Helicobacter pylori lipopolysaccharide due to changes in the lengths of poly(C) tracts in 3-fucosyltransferase genes.
Infect. Immun.
67:5361-5366[Abstract/Free Full Text].
|
| 5.
|
Bucci, C.,
A. Lavitola,
P. Salvatore,
L. Del Giudice,
D. R. Massardo,
C. B. Bruni, and P. Alifano.
1999.
Hypermutation in pathogenic bacteria: frequent phase variation in meningococci is a phenotypic trait of a specialized mutator biotype.
Mol. Cell
3:435-445[CrossRef][Medline].
|
| 6.
|
Copass, M.,
G. Grandi, and R. Rappuoli.
1997.
Introduction of unmarked mutations in the Helicobacter pylori vacA gene with a sucrose sensitivity marker.
Infect. Immun.
65:1949-1952[Abstract].
|
| 7.
|
Eaton, K. A.,
D. R. Morgan, and S. Krakowka.
1989.
Campylobacter pylori virulence factors in gnotobiotic piglets.
Infect. Immun.
57:1119-1125[Abstract/Free Full Text].
|
| 8.
|
Eaton, K. A.,
D. R. Morgan, and S. Krakowka.
1992.
Motility as a factor in the colonisation of gnotobiotic piglets by Helicobacter pylori.
J. Med. Microbiol.
37:123-127[Abstract/Free Full Text].
|
| 9.
|
Eaton, K. A.,
S. Suerbaum,
C. Josenhans, and S. Krakowka.
1996.
Colonization of gnotobiotic piglets by Helicobacter pylori deficient in two flagellin genes.
Infect. Immun.
64:2445-2448[Abstract].
|
| 10.
|
Fan, F.,
K. Ohnishi,
N. R. Francis, and R. M. Macnab.
1997.
The FliP and FliR proteins of Salmonella typhimurium, putative components of the type III flagellar export apparatus, are located in the flagellar basal body.
Mol. Microbiol.
26:1035-1046[CrossRef][Medline].
|
| 11.
|
Ferrero, R. L.,
V. Cussac,
P. Courcoux, and A. Labigne.
1992.
Construction of isogenic urease-negative mutants of Helicobacter pylori by allelic exchange.
J. Bacteriol.
174:4212-4217[Abstract/Free Full Text].
|
| 12.
|
Geis, G.,
H. Leying,
S. Suerbaum,
U. Mai, and W. Opferkuch.
1989.
Ultrastructure and chemical analysis of Campylobacter pylori flagella.
J. Clin. Microbiol.
27:436-441[Abstract/Free Full Text].
|
| 13.
|
Hammerschmidt, S.,
R. Hilse,
J. P. van Putten,
R. Gerardy-Schahn,
A. Unkmeir, and M. Frosch.
1996.
Modulation of cell surface sialic acid expression in Neisseria meningitidis via a transposable genetic element.
EMBO J.
15:192-198[Medline].
|
| 14.
|
Hazell, S. L.,
A. Lee,
L. Brady, and W. Hennessy.
1986.
Campylobacter pyloridis and gastritis: association with intercellular spaces and adaptation to an environment of mucus as important factors in colonization of the gastric epithelium.
J. Infect. Dis.
153:658-663[Medline].
|
| 15.
|
Hughes, K. T., and K. Mathee.
1998.
The anti-sigma factors.
Annu. Rev. Microbiol.
52:231-286[CrossRef][Medline].
|
| 16.
|
Josenhans, C.,
R. L. Ferrero,
A. Labigne, and S. Suerbaum.
1999.
Cloning and allelic exchange mutagenesis of two flagellin genes from Helicobacter felis.
Mol. Microbiol.
33:350-362[CrossRef][Medline].
|
| 17.
|
Josenhans, C.,
A. Labigne, and S. Suerbaum.
1995.
Comparative ultrastructural and functional studies of Helicobacter pylori and Helicobacter mustelae flagellin mutants: both flagellin subunits, FlaA and FlaB, are necessary for full motility in Helicobacter species.
J. Bacteriol.
177:3010-3020[Abstract/Free Full Text].
|
| 18.
|
Karim, Q. N.,
R. P. Logan,
J. Puels,
A. Karnholz, and M. L. Worku.
1998.
Measurement of motility of Helicobacter pylori, Campylobacter jejuni, and Escherichia coli by real time computer tracking using the Hobson BacTracker.
J. Clin. Pathol.
51:623-628[Abstract].
|
| 19.
|
Kostrzynska, M.,
J. D. Betts,
J. W. Austin, and T. J. Trust.
1991.
Identification, characterization, and spatial localization of two flagellin species in Helicobacter pylori flagella.
J. Bacteriol.
173:937-946[Abstract/Free Full Text].
|
| 20.
|
Labigne, A.,
V. Cussac, and P. Courcoux.
1991.
Shuttle cloning and nucleotide sequences of Helicobacter pylori genes responsible for urease activity.
J. Bacteriol.
173:1920-1931[Abstract/Free Full Text].
|
| 21.
|
Lee, A.,
J. O'Rourke,
M. C. De Ungria,
B. Robertson,
G. Daskalopoulos, and M. F. Dixon.
1997.
A standardized mouse model of Helicobacter pylori infection: introducing the Sydney strain.
Gastroenterology
112:1386-1397[CrossRef][Medline].
|
| 22.
|
Leunk, R. D.,
P. T. Johnson,
B. C. David,
W. G. Kraft, and D. R. Morgan.
1988.
Cytotoxic activity in broth-culture filtrates of Campylobacter pylori.
J. Med. Microbiol.
26:93-99[Abstract/Free Full Text].
|
| 23.
|
Liu, X., and P. Matsumura.
1994.
The FlhD/FlhC complex, a transcriptional activator of the Escherichia coli flagellar class II operons.
J. Bacteriol.
176:7345-7351[Abstract/Free Full Text].
|
| 24.
|
Malakooti, J.,
B. Ely, and P. Matsumura.
1994.
Molecular characterization, nucleotide sequence, and expression of the fliO, fliP, fliQ, and fliR genes of Escherichia coli.
J. Bacteriol.
176:189-197[Abstract/Free Full Text].
|
| 25.
|
Maskell, D. J.,
M. J. Szabo,
P. D. Butler,
A. E. Williams, and E. R. Moxon.
1991.
Phase variation of lipopolysaccharide in Haemophilus influenzae.
Res. Microbiol.
142:719-724[Medline].
|
| 26.
|
Maynard Smith, J., and N. H. Smith.
1998.
Detecting recombination from gene trees.
Mol. Biol. Evol.
15:590-599[Abstract].
|
| 27.
|
Minamino, T., and R. M. Macnab.
1999.
Components of the Salmonella flagellar export apparatus and classification of export substrates.
J. Bacteriol.
181:1388-1394[Abstract/Free Full Text].
|
| 28.
|
O'Toole, P. W.,
M. Kostrzynska, and T. J. Trust.
1994.
Non-motile mutants of Helicobacter pylori and Helicobacter mustelae defective in flagellar hook production.
Mol. Microbiol.
14:691-703[CrossRef][Medline].
|
| 29.
|
Park, S. F.,
D. Purdy, and S. Leach.
2000.
Localized reversible frameshift mutation in the flhA gene confers phase variability to flagellin gene expression in Campylobacter coli.
J. Bacteriol.
182:207-210[Abstract/Free Full Text].
|
| 30.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 31.
|
Saunders, N. J.,
J. F. Peden,
D. W. Hood, and E. R. Moxon.
1998.
Simple sequence repeats in the Helicobacter pylori genome.
Mol. Microbiol.
27:1091-1098[CrossRef][Medline].
|
| 32.
|
Schmitz, A.,
C. Josenhans, and S. Suerbaum.
1997.
Cloning and characterization of the Helicobacter pylori flbA gene, which codes for a membrane protein involved in coordinated expression of flagellar genes.
J. Bacteriol.
179:987-997[Abstract/Free Full Text].
|
| 33.
|
Spohn, G., and V. Scarlato.
1999.
Motility of Helicobacter pylori is coordinately regulated by the transcriptional activator FlgR, an NtrC homolog.
J. Bacteriol.
181:593-599[Abstract/Free Full Text].
|
| 34.
|
Suerbaum, S.,
C. Josenhans, and A. Labigne.
1993.
Cloning and genetic characterization of the Helicobacter pylori and Helicobacter mustelae flaB flagellin genes and construction of H. pylori flaA- and flaB- negative mutants by electroporation-mediated allelic exchange.
J. Bacteriol.
175:3278-3288[Abstract/Free Full Text].
|
| 35.
|
Suerbaum, S.,
J. Maynard Smith,
K. Bapumia,
G. Morelli,
N. H. Smith,
E. Kunstmann,
I. Dyrek, and M. Achtman.
1998.
Free recombination within Helicobacter pylori.
Proc. Natl. Acad. Sci. USA
95:12619-12624[Abstract/Free Full Text].
|
| 36.
|
Tomb, J.-F.,
O. White,
A. R. Kerlavage,
R. A. Clayton,
G. G. Sutton,
R. D. Fleischmann,
K. A. Ketchum,
H. P. Klenk,
S. Gill,
B. A. Dougherty,
K. Nelson,
J. Quackenbush,
L. Zhou,
E. F. Kirkness,
S. Peterson,
B. Loftus,
D. Richardson,
R. Dodson,
H. G. Khalak,
A. Glodek,
K. McKenney,
L. M. Fitzegerald,
N. Lee,
M. D. Adams,
E. K. Hickey,
D. E. Berg,
J. D. Gocayne,
T. R. Utterback,
J. D. Peterson,
J. M. Kelley,
M. D. Cotton,
J. M. Weidman,
C. Fujii,
C. Bowman,
L. Watthey,
E. Wallin,
W. S. Hayes,
M. Borodovsky,
P. D. Karp,
H. O. Smith,
C. M. Fraser, and J. C. Venter.
1997.
The complete genome sequence of the gastric pathogen Helicobacter pylori.
Nature
388:539-547[CrossRef][Medline].
|
| 37.
|
Trieu-Cuot, P.,
G. Gerbaud,
T. Lambert, and P. Courvalin.
1985.
In vivo transfer of genetic information between Gram-positive and Gram-negative bacteria.
EMBO J.
4:3583-3587[Medline].
|
| 38.
|
van Belkum, A.,
S. Scherer,
L. van Alphen, and H. Verbrugh.
1998.
Short-sequence DNA repeats in prokaryotic genomes.
Microbiol. Mol. Biol. Rev.
62:275-293[Abstract/Free Full Text].
|
| 39.
|
van Ham, S. M.,
L. van Alphen,
F. R. Mooi, and J. P. van Putten.
1993.
Phase variation of H. influenzae fimbriae: transcriptional control of two divergent genes through a variable combined promoter region.
Cell
73:1187-1196[CrossRef][Medline].
|
| 40.
|
Wang, G.,
D. A. Rasko,
R. Sherburne, and D. E. Taylor.
1999.
Molecular genetic basis for the variable expression of Lewis Y antigen in Helicobacter pylori: analysis of the alpha (1,2) fucosyltransferase gene.
Mol. Microbiol.
31:1265-1274[CrossRef][Medline].
|
Infection and Immunity, August 2000, p. 4598-4603, Vol. 68, No. 8
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Williams, S. M., Chen, Y.-T., Andermann, T. M., Carter, J. E., McGee, D. J., Ottemann, K. M.
(2007). Helicobacter pylori Chemotaxis Modulates Inflammation and Bacterium-Gastric Epithelium Interactions in Infected Mice. Infect. Immun.
75: 3747-3757
[Abstract]
[Full Text]
-
Sterzenbach, T., Lee, S. K., Brenneke, B., von Goetz, F., Schauer, D. B., Fox, J. G., Suerbaum, S., Josenhans, C.
(2007). Inhibitory Effect of Enterohepatic Helicobacter hepaticus on Innate Immune Responses of Mouse Intestinal Epithelial Cells. Infect. Immun.
75: 2717-2728
[Abstract]
[Full Text]
-
Andrzejewska, J., Lee, S. K., Olbermann, P., Lotzing, N., Katzowitsch, E., Linz, B., Achtman, M., Kado, C. I., Suerbaum, S., Josenhans, C.
(2006). Characterization of the Pilin Ortholog of the Helicobacter pylori Type IV cag Pathogenicity Apparatus, a Surface-Associated Protein Expressed during Infection.. J. Bacteriol.
188: 5865-5877
[Abstract]
[Full Text]
-
Croxen, M. A., Sisson, G., Melano, R., Hoffman, P. S.
(2006). The Helicobacter pylori Chemotaxis Receptor TlpB (HP0103) Is Required for pH Taxis and for Colonization of the Gastric Mucosa.. J. Bacteriol.
188: 2656-2665
[Abstract]
[Full Text]
-
Tan, S., Fraley, C. D., Zhang, M., Dailidiene, D., Kornberg, A., Berg, D. E.
(2005). Diverse Phenotypes Resulting from Polyphosphate Kinase Gene (ppk1) Inactivation in Different Strains of Helicobacter pylori. J. Bacteriol.
187: 7687-7695
[Abstract]
[Full Text]
-
Salaun, L., Ayraud, S., Saunders, N. J.
(2005). Phase variation mediated niche adaptation during prolonged experimental murine infection with Helicobacter pylori. Microbiology
151: 917-923
[Abstract]
[Full Text]
-
Ernst, F. D., Bereswill, S., Waidner, B., Stoof, J., Mader, U., Kusters, J. G., Kuipers, E. J., Kist, M., van Vliet, A. H. M., Homuth, G.
(2005). Transcriptional profiling of Helicobacter pylori Fur- and iron-regulated gene expression. Microbiology
151: 533-546
[Abstract]
[Full Text]
-
van den Broek, D., Chin-A-Woeng, T. F. C., Bloemberg, G. V., Lugtenberg, B. J. J.
(2005). Molecular Nature of Spontaneous Modifications in gacS Which Cause Colony Phase Variation in Pseudomonas sp. Strain PCL1171. J. Bacteriol.
187: 593-600
[Abstract]
[Full Text]
-
van der Woude, M. W., Baumler, A. J.
(2004). Phase and Antigenic Variation in Bacteria. Clin. Microbiol. Rev.
17: 581-611
[Abstract]
[Full Text]
-
Merkx-Jacques, A., Obhi, R. K., Bethune, G., Creuzenet, C.
(2004). The Helicobacter pylori flaA1 and wbpB Genes Control Lipopolysaccharide and Flagellum Synthesis and Function. J. Bacteriol.
186: 2253-2265
[Abstract]
[Full Text]
-
Salaun, L., Linz, B., Suerbaum, S., Saunders, N. J.
(2004). The diversity within an expanded and redefined repertoire of phase-variable genes in Helicobacter pylori. Microbiology
150: 817-830
[Abstract]
[Full Text]
-
Tan, S., Berg, D. E.
(2004). Motility of Urease-Deficient Derivatives of Helicobacter pylori. J. Bacteriol.
186: 885-888
[Abstract]
[Full Text]
-
Chisholm, S. A., Owen, R. J.
(2004). Frameshift mutations in frxA occur frequently and do not provide a reliable marker for metronidazole resistance in UK isolates of Helicobacter pylori. J Med Microbiol
53: 135-140
[Abstract]
[Full Text]
-
Dailidiene, D., Dailide, G., Ogura, K., Zhang, M., Mukhopadhyay, A. K., Eaton, K. A., Cattoli, G., Kusters, J. G., Berg, D. E.
(2004). Helicobacter acinonychis: Genetic and Rodent Infection Studies of a Helicobacter pylori-Like Gastric Pathogen of Cheetahs and Other Big Cats. J. Bacteriol.
186: 356-365
[Abstract]
[Full Text]
-
Hoffman, P. S., Vats, N., Hutchison, D., Butler, J., Chisholm, K., Sisson, G., Raudonikiene, A., Marshall, J. S., Veldhuyzen van Zanten, S. J. O.
(2003). Development of an Interleukin-12-Deficient Mouse Model That Is Permissive for Colonization by a Motile KE26695 Strain of Helicobacter pylori. Infect. Immun.
71: 2534-2541
[Abstract]
[Full Text]
-
Thompson, L. J., Merrell, D. S., Neilan, B. A., Mitchell, H., Lee, A., Falkow, S.
(2003). Gene Expression Profiling of Helicobacter pylori Reveals a Growth-Phase-Dependent Switch in Virulence Gene Expression. Infect. Immun.
71: 2643-2655
[Abstract]
[Full Text]
-
Mukhopadhyay, A. K., Jeong, J.-Y., Dailidiene, D., Hoffman, P. S., Berg, D. E.
(2003). The fdxA Ferredoxin Gene Can Down-Regulate frxA Nitroreductase Gene Expression and Is Essential in Many Strains of Helicobacter pylori. J. Bacteriol.
185: 2927-2935
[Abstract]
[Full Text]
-
Kavermann, H., Burns, B. P., Angermuller, K., Odenbreit, S., Fischer, W., Melchers, K., Haas, R.
(2003). Identification and Characterization of Helicobacter pylori Genes Essential for Gastric Colonization. JEM
197: 813-822
[Abstract]
[Full Text]
-
de Vries, N., Duinsbergen, D., Kuipers, E. J., Pot, R. G. J., Wiesenekker, P., Penn, C. W., van Vliet, A. H. M., Vandenbroucke-Grauls, C. M. J. E., Kusters, J. G.
(2002). Transcriptional Phase Variation of a Type III Restriction-Modification System in Helicobacter pylori. J. Bacteriol.
184: 6615-6623
[Abstract]
[Full Text]
-
McGEE, D. J., COKER, C., TESTERMAN, T. L., HARRO, J. M., GIBSON, S. V., MOBLEY, H. L. T.
(2002). The Helicobacter pylori flbA flagellar biosynthesis and regulatory gene is required for motility and virulence and modulates urease of H. pylori and Proteus mirabilis. J Med Microbiol
51: 958-970
[Abstract]
[Full Text]
-
Snyder, L. A. S., Butcher, S. A., Saunders, N. J.
(2001). Comparative whole-genome analyses reveal over 100 putative phase-variable genes in the pathogenic Neisseria spp.. Microbiology
147: 2321-2332
[Abstract]
[Full Text]