IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Van Kirk, L. S.
Right arrow Articles by Heinzen, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Van Kirk, L. S.
Right arrow Articles by Heinzen, R. A.

 Previous Article  |  Next Article 

Infection and Immunity, August 2000, p. 4706-4713, Vol. 68, No. 8
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Ultrastructure of Rickettsia rickettsii Actin Tails and Localization of Cytoskeletal Proteins

Levi S. Van Kirk,1 Stanley F. Hayes,2 and Robert A. Heinzen1,*

Department of Molecular Biology, University of Wyoming, Laramie, Wyoming 82071-3944,1 and Microscopy Branch, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases, Hamilton, Montana 598402

Received 19 January 2000/Returned for modification 17 March 2000/Accepted 8 May 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Actin-based motility (ABM) is a mechanism for intercellular spread that is utilized by vaccinia virus and the invasive bacteria within the genera Rickettsia, Listeria, and Shigella. Within the Rickettsia, ABM is confined to members of the spotted fever group (SFG), such as Rickettsia rickettsii, the agent of Rocky Mountain spotted fever. Infection by each agent induces the polymerization of host cell actin to form the typical F (filamentous)-actin comet tail. Assembly of the actin tail propels the pathogen through the host cytosol and into cell membrane protrusions that can be engulfed by neighboring cells, initiating a new infectious cycle. Little is known about the structure and morphogenesis of the Rickettsia rickettsii actin tail relative to Shigella and Listeria actin tails. In this study we examined the ultrastructure of the rickettsial actin tail by confocal, scanning electron, and transmission electron microscopy. Confocal microscopy of rhodamine phalloidin-stained infected Vero cells revealed the typhus group rickettsiae, Rickettsia prowazekii and Rickettsia typhi, to have no actin tails and short (~1- to 3-µm) straight or hooked actin tails, respectively. The SFG rickettsia, R. rickettsii, displayed long actin tails (>10 µm) that were frequently comprised of multiple, distinct actin bundles, wrapping around each other in a helical fashion. Transmission electron microscopy, in conjunction with myosin S1 subfragment decoration, revealed that the individual actin filaments of R. rickettsii tails are >1 µm long, arranged roughly parallel to one another, and oriented with the fast-growing barbed end towards the rickettsial pole. Scanning electron microscopy of intracellular rickettsiae demonstrated R. rickettsii to have polar associations of cytoskeletal material and R. prowazekii to be devoid of cytoskeletal interactions. By indirect immunofluorescence, both R. rickettsii and Listeria monocytogenes actin tails were shown to contain the cytoskeletal proteins vasodilator-stimulated phosphoprotein profilin, vinculin, and filamin. However, rickettsial tails lacked ezrin, paxillin, and tropomyosin, proteins that were associated with actin tails of cytosolic or protrusion-bound Listeria. The unique ultrastructural and compositional characteristics of the R. rickettsii actin tail suggest that rickettsial ABM is mechanistically different from previously described microbial ABM systems.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Members of the genus Rickettsia are obligate intracellular bacteria that grow within the cytoplasm of their eucaryotic host cell (13). They are the etiologic agents of a variety of serious human diseases such as Rocky Mountain spotted fever and epidemic typhus and are transmitted to their mammalian hosts exclusively by arthropod vectors that include ticks, fleas, lice, and mites (13). Rickettsiae display a tropism for the endothelium, where they invade and spread to cause vascular permeability (47).

Because of experimental limitations imposed by the obligate intracellular nature of rickettsiae and the lack of workable genetic systems, little is known about specific virulence determinants utilized by these organisms. However, there is a cursory understanding of some rickettsia-host interactions. Studies employing the typhus group rickettsia, Rickettsia prowazekii, demonstrate that internalization requires adherence to an unidentified plasma membrane receptor by viable, metabolically active organisms (49). Uptake of rickettsiae ensues by a microfilament-dependent process (48). Collectively, the two processes have been termed parasite-induced phagocytosis (48). Evidence suggests that internalized rickettsiae are initially bound within a phagocytic vacuole (12, 40). An increase in phospholipase A2 activity occurs concomitantly with rickettsial entry and presumably facilitates rickettsial access to the host cytoplasm (36, 49, 52). Once in the intracytoplasmic milieu, rickettsiae are free to exploit the nutrient-rich environment and interact with host structural components.

A suspected virulence mechanism unique to spotted fever group (SFG) rickettsiae, such as Rickettsia rickettsii, is the utilization of an intracellular actin-based motility (ABM) system to promote direct cell-to-cell spread (12, 15, 16). This mechanism of pathogenesis is also exploited by the facultative intracellular bacteria Listeria monocytogenes and Shigella flexneri (9) as well as vaccinia virus (50). Using the propulsive force supplied by parasite-directed polymerization of host cell actin, motile bacteria move into plasma membrane-bound protrusions that can be subsequently engulfed by neighboring cells. Escape from the double-membrane vacuole allows infection of the newly encountered cytoplasm (45). The ability of pathogens to spread within the host tissues, using ABM to directly transit from one cell to another, allows evasion of the host humoral immune response.

The bacterial surface proteins ActA and IcsA are necessary and sufficient for ABM by Listeria (8, 18) and Shigella (2, 21), respectively. The viral protein A36R is essential for vaccinia virus ABM (11). Rickettsial protein synthesis is required for ABM, but the identity of the necessary protein(s) is unknown (16). A number of host cytoskeletal proteins are also necessary or suspected modulators of bacterial ABM and protrusion formation. These were initially identified by immunolocalization studies and include proteins involved in F (filamentous)-actin cross-linking, side binding, severing, capping, depolymerizing, and nucleating (3, 9). Direct biochemical evidence for roles in Listeria ABM has been established for vasodilator-stimulated phosphoprotein (VASP) (5, 22, 25, 38), the complex of actin-related proteins 2 and 3 (Arp2-Arp3) (22, 51), gelsolin (19), profilin (22, 32, 38, 42), alpha -actinin (7, 22), actin depolymerization factor (also called cofilin) (4, 22, 31), and capping protein (22). Using a reconstitution assay, Loisel et al. (22) have recently determined that actin, Arp2-Arp3 complex, cofilin, and capping protein are minimally required for in vitro ABM by Listeria. The Arp2-Arp3 complex is stimulated by interaction with ActA to nucleate the production of new actin filaments (22, 51). Capping protein stops the growth of existing actin tail filaments by binding to their fast-growing barbed ends, thus possibly funneling available G (globular)-actin to the production of new filaments at the bacterium-tail interface (22). Cofilin stimulates the release of G-actin from the slow-growing pointed ends of filaments, thereby increasing the local concentration of G-actin for use in new filament assembly (4, 22, 31). Listerial ABM is more efficient if profilin (a G-actin sequestering protein), VASP (a focal adhesion point protein and a ligand of profilin), and alpha -actinin (an F-actin cross-linking protein) are present (22). Additional host proteins may be necessary or stimulatory in vivo. Other than actin, the cellular proteins necessary for R. rickettsii intracellular motility are completely unknown.

Elegant transmission electron microscopy (TEM) studies (33, 43-45), have elucidated the ultrastructural characteristics of listerial actin tails and allowed initial formulation of mechanical models for how actin might provide the propulsive force needed to move the bacterium through the viscous cytosol. Studies using fixation protocols optimized to preserve filamentous actin structures and myosin S1 subfragment to decorate individual actin filaments demonstrate that listerial actin tails are comprised of a cross-linked meshwork of short (~0.2-µm) actin filaments (43-45). Tails associated with protrusion-bound Listeria have a different ultrastructure; in addition to containing random short filaments, they contain long (>1-µm) filaments that lie parallel with the protrusion axis (33).

To gain insight into the mechanism of rickettsial ABM, we examined R. rickettsii actin tail ultrastructure and composition. Identification of host cytoskeletal proteins associated with the rickettsial actin tail was accomplished by immunofluorescence localization with specific antibodies. TEM and scanning electron microscopy (SEM) were utilized to examine actin tail structure and rickettsia-containing protrusions. In addition, the polarity of F-actin filaments comprising rickettsial actin tails was determined by myosin S1 subfragment decoration and TEM.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Organisms. R. rickettsii (HLP strain), Rickettsia typhi (Wilmington strain), and R. prowazekii (Madrid E strain) were propagated in African green monkey kidney (Vero) fibroblasts (CCL-81; American Type Culture Collection) and were purified by Renografin density gradient centrifugation as previously described (14). L. monocytogenes 1043S was a generous gift of Dan Portnoy, University of California at Berkeley, and was cultivated overnight in 3.7% brain heart infusion (BHI) broth (Difco Laboratories, Detroit, Mich.).

Infection of Vero cells. Twelve-millimeter-diameter glass coverslips in 24-well plates were seeded with Vero cells to semiconfluency and cultivated overnight at 37°C in M199 medium (Life Technologies, Grand Island, N.Y.) supplemented with 10% fetal bovine serum (FBS) (Life Technologies) and gentamicin (20 µg/ml; Life Technologies). Rickettsiae suspended in 3.7% BHI broth (Difco Laboratories) were used to infect monolayers at a multiplicity of infection of 0.1 to 1.0 for 45 min. The inoculum was removed, the cells were washed once, M199 medium supplemented with 2% FBS was added, and incubation continued at 34°C. For infection of Vero cells with L. monocytogenes, an overnight culture of Listeria in BHI broth was pelleted, washed once, and suspended in twice the culture volume of Hanks buffered saline solution (Life Technologies). Suspended bacteria (200 to 300 µl) were added to each tissue culture plate well and incubated for 1 h at room temperature. Vero cells were then washed three times with Hanks buffered saline solution and M199 with 2% FBS and gentamicin sulfate (20 µg/ml) were added to culture wells. For TEM, cells were grown in 35-mm-diameter Thermanox petri dishes (Nunc Inc., Naperville, Ill.).

Construction of GFP-profilin. The human profilin gene was amplified from a HeLa cell cDNA library (Stratagene, La Jolla, Calif.) using PCR. The 5' oligonucleotide GGATCCATGGCCGGGTGGAACGCCTAC contains a BamHI site and the profilin ATG start codon. The 3' oligonucleotide TCTAGATCAGTACTGGGAACGCCGAAGG contains an XbaI site and the profilin stop codon. The resulting 434-bp PCR product was cloned into pCR2.1 (Invitrogen Corp., Carlsbad, Calif.). The profilin-encoding insert was then excised by digestion with BamHI and XbaI, and the profilin reading frame was directionally cloned in frame with the 3' end of gfp carried by pEGFP-C1 (Clontech Laboratories, Inc., Palo Alto, Calif.). Nucleotide sequencing of the resulting clone (pEGFP-C1/profilin) confirmed the cloning procedure.

Fluorescence microscopy. All fixation and staining procedures were carried out at room temperature. Infected cells on coverslips were fixed and permeabilized as previously described (16). Fixed cells were then washed three times in 25 mM sodium phosphate-150 mM sodium chloride (pH 7.4) (PBS) containing 0.5% bovine serum albumin (PBSA). The primary antibodies used in indirect immunofluorescence labeling of intracellular bacteria were the monoclonal antibody 13-2 directed against the rOmpB protein (1) or rabbit anti-R. rickettsii serum for R. rickettsii, rabbit anti-R. prowazekii serum for R. typhi and R. prowazekii, and rabbit anti-Listeria serum (Biodesign International, Kennebunk, Maine) for L. monocytogenes. Bacteria were subsequently labeled with an anti-mouse immunoglobulin G (IgG) Texas Red conjugate (Jackson ImmunoResearch Laboratories, Inc., West Grove, Pa.), an anti-rabbit IgG fluorescein conjugate (Pierce, Rockford, Ill.), or an anti-rabbit IgG rhodamine conjugate (Pierce). Following staining of bacteria, coverslips were washed three times in PBSA and F-actin stained by incubating with rhodamine phalloidin (Molecular Probes, Eugene, Oreg.) at 10 U/ml for 20 min. Other cytoskeletal proteins were labeled by indirect immunofluorescence using monoclonal antibodies. Antibodies directed against VASP (clone 43), ezrin (clone 18), and paxillin (clone 349) were purchased from Transduction Laboratories (Lexington, Ky.); antibodies directed against tropomyosin (clone TM311) and vinculin were purchased from Sigma (St. Louis, Mo.); and a filamin-specific monoclonal antibody was purchased from Chemicon International, Inc. (Temecula, Calif.). Proteins were subsequently labeled with either an anti-mouse IgG Texas Red conjugate or an anti-mouse IgG fluorescein conjugate. Coverslips were mounted onto glass slides using Vectashield mounting medium (Vector Laboratories, Inc., Burlingame, Calif.) and observed with a Leica laser-scanning confocal microscope equipped with a krypton-argon laser illuminator. Collected images were processed with Adobe Photoshop 3.0.

Electron microscopy. SEM using the dry cleave method was conducted essentially as described by Prevost et al. (26). Briefly, infected Vero cells were rinsed in PHEM buffer (60 mM piperazine-N,N'-bis[2-ethanesulfonic acid] [PIPES], 23 mM HEPES, 10 mM EGTA, 2 mM MgCl2 [pH 6.9]) and then treated with PHEM containing 0.5% saponin for 5 min at room temperature. Cells were then fixed in 2.5% glutaraldehyde in PHEM for 30 min, rinsed with PHEM, and postfixed with 0.5% osmium tetroxide in PHEM for 90 min. Cells were rinsed with distilled water and dehydrated in a graded series of alcohol. Cells were then treated with hexamethyldisilazane and air dried. Cell interiors were exposed by dry cleaving the monolayer via application and removal of cellophane tape. Cells were then sputter-coated with gold-palladium. To visualize intact pseudopodia, infected cells were similarly processed, except the saponin membrane solubilization and dry cleave steps were omitted. Samples were examined with a Hitachi S-570 scanning electron microscope.

TEM was conducted on Vero cells infected for 4 days with R. rickettsii. For preservation of filamentous actin structures, cells were quick fixed in situ by the method of Tilney and Tilney (46). Cells in 35-mm-diameter Thermanox petri dishes were fixed for 30 min with a solution containing 1% glutaraldehyde, 1% osmium tetroxide, and 50 mM phosphate buffer (pH 6.3) on ice. Fixed cells were washed with distilled water three times for 5 min and stained overnight with 0.5% uranyl acetate. Cells were dehydrated in a graded series of ethanol and embedded in Epon, and sections were cut and poststained with uranyl acetate and lead citrate. Myosin S1 decoration was conducted according to the method of Tilney et al. (44). All procedures prior to dehydration were conducted on ice. R. rickettsii-infected cells in Thermanox petri dishes were washed with PHEM buffer. Membranes were then solubilized for 10 min with 50 mM phosphate buffer (pH 6.8) containing 1% Triton X-100 and 3 mM MgCl2. Cells were washed two times with 0.1 M phosphate buffer (pH 6.8), and this was followed by incubation for 30 min in phosphate buffer containing myosin S1 subfragment (5 mg/ml; Sigma). This solution was decanted, and the cells were washed in 100 mM phosphate (pH 6.8) buffer; this was followed by fixation for 30 min in 50 mM phosphate buffer (pH 6.8) containing 1% glutaraldehyde and 2% tannic acid. Cells were washed again in 50 mM phosphate buffer (pH 6.8) and subsequently postfixed in 1% osmium tetroxide in 0.1 M phosphate buffer (pH 6.3). Fixed cells were washed with distilled water three times for 5 min and stained overnight with 0.5% uranyl acetate. Cells were dehydrated in a graded series of ethanol and embedded in Epon, and sections were cut and poststained with uranyl acetate and lead citrate. Samples were examined using a Hitachi HU-11E-1 electron microscope.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Laser scanning confocal microscopy of actin tails. Laser scanning confocal microscopy was conducted on rhodamine phalloidin-stained Vero cells infected with species of Rickettsia that display the 3 representative actin tail phenotypes (16): long tails (R. rickettsii), short tails (R. typhi), and no tails (R. prowazekii). We employed L. monocytogenes as a comparative control in this procedure. The prototypic long actin tails of R. rickettsii (Fig. 1A and B) were morphologically distinct from those associated with L. monocytogenes (Fig. 1E). R. rickettsii actin tails were straighter and longer (average length, 16.7 µm) than those of Listeria (average length, 6.7 µm). Occasionally rickettsial tails with dramatic curves were observed, usually in association with organisms that had obviously collided with the plasma membrane. This occurrence has also been observed by time-lapse video microscopy (15). In contrast to listerial tails, where actin staining results in a relatively uniform gradient of fluorescence throughout the tail length, R. rickettsii tails were often comprised of two or more distinct actin bundles (Fig. 1A and B). These bundles often twisted around each other in a helical fashion to form nonfluorescent gaps in the tail structure. The truncated actin tails of R. typhi were small (~3 µm) and usually hook shaped and did not exhibit the gapped appearance of the R. rickettsii tail (Fig. 1C). R. prowazekii displayed a null actin tail phenotype as illustrated by the absence of actin tail appendages (Fig. 1D).


View larger version (116K):
[in this window]
[in a new window]
 
FIG. 1.   Actin tail phenotypes of rickettsiae and comparison to tails of L. monocytogenes. Dual fluorescent staining of intracellular bacteria and F-actin was conducted on Vero cells. F-actin was stained with rhodamine phalloidin (red), and intracellular bacteria were stained by indirect immunofluorescence (green). Cells were visualized by laser scanning confocal microscopy. (A) R. rickettsii showing long actin tails that are frequently comprised of multiple, twisting, distinct F-actin bundles. (B) High magnification of an R. rickettsii actin tail in panel A comprised of two F-actin bundles. (C) Truncated hook-shaped tail of R. typhi (arrow). (D) R. prowazekii with no actin tails. (E) Actin comet tails of L. monocytogenes. Bars, 5 µm.

Electron microscopy of actin tails and protrusions. Using SEM and a dry cleave procedure to reveal the host cell interior, we observed R. rickettsii in association with a polar stalk of cytoskeletal material, presumably F-actin (26) (Fig. 2A). R. rickettsii organisms were randomly dispersed at low numbers throughout the cell cytoplasm. Occasionally R. rickettsii existed as clumps of two or more organisms, with the cytoskeletal stalk usually associated with one organism (unpublished observations). With organisms undergoing binary fission, the cytoskeletal stalk was associated with one pole of a single forming daughter cell (Fig. 2B). A similar behavior has previously been observed for actin tails associated with a dividing rickettsia by TEM (16) and rhodamine phalloidin staining (15). In contrast to R. rickettsii, R. prowazekii existed as dense groups of organisms without obvious polar cytoskeletal associations (Fig. 2C).


View larger version (97K):
[in this window]
[in a new window]
 
FIG. 2.   SEM of Vero cells infected with R. rickettsii or R. prowazekii. Cells were fixed and dry cleaved to expose the cell interior. (A and B) R. rickettsii with a polar stalk of cytoskeletal material. Note the organism undergoing binary fission with only one daughter cell associated with cytoskeletal material (B). (C) R. prowazekii devoid of polar cytoskeletal stalks. Bars, 0.5 µm.

TEM was conducted on infected cells using a fixation technique optimized for preservation of F-actin structures (46). R. rickettsii actin tails existed as long, parallel-arranged actin filaments that appeared to be minimally cross-linked (Fig. 3A). In most instances, filaments were absent from the extreme pole of the organism, which is consistent with the gapped tail appearance in Fig. 1. Myosin S1 subfragment decoration further demonstrated the linearity of rickettsial actin tail filaments (Fig. 3B). Although a precise measurement of the length of individual actin filaments was difficult to achieve, close inspection of Fig. 3A and B suggests that they are at least 1 µm in length. A high-magnification image of S1 decorated F-actin immediately adjacent to the bacterium shows the fast-growing barbed ends of individual actin filaments oriented towards the rickettsial surface (Fig. 3C).


View larger version (106K):
[in this window]
[in a new window]
 
FIG. 3.   Ultrastructure of the R. rickettsii actin tail as viewed by TEM. (A) Sections of Vero cells infected with R. rickettsii showing a bilateral association of bundles of long actin filaments that appear to be minimally cross-linked. (B) Myosin S1 subfragment decoration of the rickettsial actin tail depicting long, parallel actin filaments. (C) High magnification of myosin S1 subfragment decorated tail filaments showing the fast-growing barbed ends of filaments oriented towards the rickettsial surface. A decorated actin filament, designated with an asterisk at the barbed end, is shown in the inset. Individual S1 subunits are demarcated with white lines to highlight the directional binding of this protein. Bars, 0.5 µm.

Formation of bacterium-containing protrusions is prerequisite for cell-to-cell spread by L. monocytogenes (30) and S. flexneri (17). R. rickettsii was similarly found in protrusions ~3 to 5 µm in length. Figure 4A depicts a rickettsia-containing protrusion that is apparently in the process of uptake by a neighboring uninfected cell. The plasma membranes of the infected and adjacent uninfected cell are clearly visible. Protrusions containing more than one rickettsia were also observed. Figure 4B depicts a short protrusion containing two rickettsiae with an accompanying actin tail extending into the Vero cell cytoplasm. F-actin of comprising tails of protrusion- bound rickettsia appeared more compressed than that of cytosolic bacteria. Protrusions were also observed by SEM. Fig. 4C shows a short membrane-bound protrusion that has collapsed to the cell surface and consists of a bulbous head harboring the organism, and a sphinctered stalk containing a condensed actin tail.


View larger version (64K):
[in this window]
[in a new window]
 
FIG. 4.   Protrusion formation and cell-to-cell spread by R. rickettsii in Vero cells. (A) Thin section of rickettsia-containing protrusion. The plasma membrane of the infected cell and the adjacent uninfected cell are clearly visible. The actin tail has been grazed in this thin section. (B) Protrusion containing two rickettsiae that extends a few micrometers from the cell surface. The cup-shaped beginning of the accompanying actin tail is designated with an arrow. (C) SEM of R. rickettsii in a short protrusion that has collapsed to the cell surface. Bars, 0.5 µm.

Fluorescence localization of cytoskeletal proteins. A number of host cytoskeletal proteins are associated with actin tail and/or protrusion formation by Listeria and Shigella (9). Employing L. monocytogenes as a comparative control, we conducted confocal laser scanning microscopy to determine the location of cytoskeletal proteins in R. rickettsii-infected Vero cells. VASP and profilin are accelerators of the actin-based motor of Listeria (22). By indirect immunofluorescence, VASP was diffusely dispersed throughout rickettsial actin tails as shown in Fig. 5A. A rickettsia in this figure was apparently captured in the process of entering the nucleus while still tethered to its actin tail, suggesting that the mechanism of entry by rickettsia into this intracellular compartment is an active process driven by actin polymerization. In contrast to R. rickettsii, VASP localized only to the actin-polymerizing pole of Listeria where, as previously reported, it binds directly to the proline-rich region of the listerial surface protein ActA (Fig. 5A) (5, 25). VASP is a ligand for profilin, a G-actin-sequestering protein (27). GFP-profilin, when introduced into infected Vero cells by transfection, also localized throughout the R. rickettsii actin tail, possibly via direct binding to VASP (Fig. 5A). This confocal image shows at least two distinct clumps of rickettsiae within the nucleus that are associated with one branching actin tail. We have previously observed the clumping of intranuclear rickettsiae and their associated actin tails by time-lapse video microscopy (15). GFP-profilin was primarily localized to one pole of Listeria and the beginning of their actin tails, as described by others (42).


View larger version (127K):
[in this window]
[in a new window]
 
FIG. 5.   Fluorescence localization of the cytoskeletal proteins VASP, profilin, vinculin, filamin, tropomyosin, ezrin, and paxillin in fixed Vero cells infected with R. rickettsii (R. r.) or L. monocytogenes (L. m.). Images were collected using a confocal laser scanning microscope. Cytoskeletal proteins, with the exception of profilin, were labeled by indirect immunofluorescence by using specific monoclonal antibodies. Profilin was localized by transiently expressing GFP-profilin in infected cells as described in Materials and Methods. Intracellular bacteria were counterstained by indirect immunofluorescence. (A) VASP labeling (red) is diffusely dispersed throughout the actin tail of R. rickettsii (green), whereas labeling is concentrated to one pole of Listeria (green). (Note the rickettsiae apparently in the process of penetrating the nuclear membrane.) GFP-profilin (green) is similarly dispersed throughout the actin tail of R. rickettsii (red), in this case intranuclear rickettsiae, whereas GFP-profilin is primarily localized to one pole of Listeria (red) and the beginning of the actin tails. (B) Vinculin and filamin (green) were detected throughout the length of tails of R. rickettsii (red) and Listeria (red). Tropomyosin, ezrin, and paxillin (green) were detected in tails of cytoplasmic or protrusion-bound Listeria (green) but not tails of R. rickettsii (red). Bars, 5 µm.

In addition to VASP and profilin, we localized by indirect immunofuorescence other cytoskeletal proteins implicated as modulators of bacterial ABM and protrusion formation (Fig. 5B). Vinculin, filamin, ezrin, and paxillin are cytoskeletal proteins that are enriched in plasma membrane focal adhesion points (23, 24). Tropomyosin is an actin side binding protein (3). In keeping with previous studies, filamin (7), vinculin (7), ezrin (10, 33, 39), and tropomyosin (6) were detected in actin tails of cytoplasmic or protrusion-bound Listeria. In contrast to a previous study (10), we additionally detected paxillin in the listerial tail. Only vinculin and filamin were detected in the R. rickettsii tail. Vinculin labeling is associated with the actin tail of clumped intranuclear rickettsia (Fig. 5B).


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

In comparison to free-living facultative intracellular bacteria, our current understanding of rickettsial virulence factors that allow entry and intercellular spread in cultured cells is fragmentary. By analogy to ABM mutants of Listeria (8, 18) and Shigella (2, 21), which display attenuated virulence in animal models, it is logical to assume that recruitment and polymerization of host cell actin by SFG rickettsiae to allow intracellular motility and direct cell-to-cell spread represent a rickettsial virulence determinant. Although the general process of rickettsial ABM appears similar to that described for Listeria and Shigella, in this report we have demonstrated that rickettsial actin tails are compositionally and ultrastructurally different from tails produced by these bacteria.

The R. rickettsii actin tail is frequently comprised of two or more distinct, coiled actin bundles. We suggested in a previous report (15) that the coiling of actin tail bundles may be a manifestation of the rickettsial pole harboring multiple, fixed, asymmetrically opposed polymerization zones. The resultant asymmetry in polymerization may provide a rotational force that spins the organism as it moves through the cytosol.

Elegant electron microscopy studies, primarily by Tilney and coworkers (43-45), have defined the ultrastructure of listerial actin tails. They demonstrated that tails of cytosolic Listeria are comprised of a network of short (~0.2-µm) cross-linked actin filaments having their fast-growing barbed ends oriented towards the bacterial surface (43-45). Actin tails of protrusion-bound Listeria are compositionally and ultrastructurally different from those associated with cytosolic bacteria. For example, they lack alpha -actinin, an F-actin cross-linking protein that is observed in tails of cytosolic Listeria and may be required for maintenance of the bundled structure in this environment. They also have a lower percentage of short filaments and exhibit long (>1-µm) filaments. Tails of protrusion-bound Listeria gain ezrin, a membrane protein responsible for forming cytoskeleton-membrane associations, that has been postulated to stabilize the longer tail filaments (33).

In our original description of rickettsia-induced actin polymerization we employed a TEM fixation procedure that used ruthenium red as an F-actin stabilizer (16). These micrographs provided the first glimpse of R. rickettsii actin tails by electron microscopy and suggested that the tail consisted of long actin filaments. In this report we confirm our early observations by using quick-fix fixation (46) and myosin S1 subfragment decoration to demonstrate that the R. rickettsii actin tail consists of long (>1-µm), parallel-arranged filaments that appear to be minimally cross-linked. Like listerial tail filaments, rickettsial tail filaments are juxtaposed with the fast-growing barbed end oriented towards the rickettsial surface, suggesting that G-actin incorporation occurs at the rickettsial surface. Moreover, tail filaments of protrusion-bound rickettsiae display a more condensed architecture, as is observed for listerial tails (33). The short actin tail of R. typhi implies that the organism is deficient in actin recruitment and polymerization. Of interest would be to determine the polarity and length of R. typhi actin tail filaments and whether tail production confers intracellular motility.

The absence of a cytoskeletal stalk associated with one pole of R. prowazekii by dry cleave SEM is consistent with the absence of actin tails by TEM and phalloidin staining (16). The lack of ABM by R. prowazekii correlates with a reduced capacity to form plaques on cell monolayers. R. prowazekii also grows to high numbers in individual cells with little cytopathic effect (37). R. rickettsii are toxic to cells in small numbers, with cytopathological changes indicative of oxidative stress (for example, dilation of the rough endoplasmic reticulum) observed 2 days after infection (35). Elevated cellular levels of reactive oxygen species, such as superoxide anion and hydrogen peroxide, are observed concomitant with R. rickettsii infection (34). Movement of SFG rickettsiae by ABM likely results in frequent collisions with the plasma membrane, where the action of rickettsial phospholipase(s) may produce by-products capable of activating membrane-bound NADPH oxidase (or a similar enzyme) to produce superoxide anion (34).

Differential localization of cytoskeletal proteins was observed between R. rickettsii and L. monocytogenes actin tails. In contrast to Listeria, in which VASP and profilin are localized to the polymerizing end of the bacterium (5, 38), both proteins are distributed throughout the R. rickettsii actin tail. VASP is a substrate of cyclic AMP- and cyclic GMP-dependent protein kinases and is generally localized to focal adhesions and areas of high actin turnover (28). VASP is also a ligand for profilin (27), a G-actin-sequestering protein, and binds the proline-rich motif in the central region of Listeria ActA (5, 25). Although not essential for Listeria ABM, VASP and profilin accelerate the process, possibly by recruiting polymerization-competent actin monomers in the form of profilin-actin complexes to the unipolar polymerization zone of the bacterium (20, 22, 38, 42). One possible explanation for the distribution of VASP and profilin in rickettsial tails is that R. rickettsii secretes a protein that is incorporated into the tail and a ligand for VASP. Alternatively, VASP may localize to the R. rickettsii actin tail via association with vinculin, which is a known ligand of VASP (29) and also in the rickettsial tail. In this scenario vinculin may serve as an adapter protein between a rickettsial protein necessary for ABM and VASP. Whether VASP serves a functional role in accelerating rickettsial ABM by recruiting profilin-actin complexes to the polymerization zone requires further investigation.

Both R. rickettsii and L. monocytogenes actin tails contained filamin, but rickettsial tails lacked tropomyosin, ezrin, and paxillin. Filamin is an actin cross-linking protein found in focal adhesions and stress fibers (24) and may play a role in bundling rickettsial tail filaments. The lack of tropomyosin, ezrin, and paxillin in rickettsial tails may explain the short length of rickettsial protrusions relative to those induced by Listeria. These proteins all integrate with the actin cytoskeleton and play roles in the formation of cell surface extensions, such as filopodia (23). By TEM and SEM we observed rickettsia in short protrusions (3 to 5 µm) considerably shorter than those reported for Listeria. Depending on the cell type, Listeria-containing protrusions can exceed 100 µm in length (33). The short R. rickettsii protrusions in Vero cells may reflect an inability of rickettsial tail filaments to interact and become stabilized by plasma membrane cytoskeletal proteins.

The results of this study are in close agreement with the recently published findings of Gouin et al. (12) in their study of a related organism, Rickettsia conorii, the agent of Mediterranean spotted fever. Like R. rickettsii tails, R. conorii actin tails were found to be comprised of long, minimally cross-linked actin filaments with the fast-growing barbed end of the filaments oriented towards the organism. In addition to lacking ezrin, they reported the absence of Arp3, cofilin, and capping protein (CapZ) in R. conorii tails. The unique ultrastructural and compositional differences between rickettsial and listerial tails may explain the different ABM behavior and kinetics in the two genera (12, 15). Both R. conorii and R. rickettsii move considerably slower than Listeria within cells (12, 15), and the actin filaments that comprise the R. rickettsii tail are approximately three times more stable than those of listerial tails (15). The lack of Arp3, cofilin, and capping protein may partially explain the low rate of rickettsial ABM relative to that of Listeria. These proteins affect actin nucleation (22, 51) or G-actin acquisition (22, 41) and are required for listerial actin tail formation. The lower rate of rickettsial ABM and longer half-life of tail filaments may also be reflective of the tail containing fewer pointed ends for depolymerization factors to act upon. The absence of Arp3 is particularly interesting, as the Arp complex is required for nucleation of new actin filaments in actin-based movements of Listeria (22, 51), Shigella (22), and presumably vaccinia virus (10). This leads to the possibility that rickettsiae synthesize a protein that confers actin nucleating activity rather than recruiting a nucleating factor from the host.

Our results differ from those of Gouin and coworkers (12) in detecting vinculin within the R. rickettsii tail. Furthermore, they did not observe coiled, distinct actin bundles in R. conorii tails, and tail production was observed only after 24 to 36 h of infection. In a previous study we detected R. rickettsii tail formation 30 min postinfection, with F-actin-coated rickettsiae observed as early as 15 min postinfection (16), suggesting that some R. rickettsii organisms enter host cells preloaded with a functional protein(s) necessary for ABM. This is unlike Listeria, in which bacterial cell division and ActA processing is required for ABM (30).

The results of this study suggest that R. rickettsii has evolved to exploit host actin pools in a manner biologically distinct from Listeria and Shigella. Additional studies are needed to clearly define the roles of host cytoskeletal proteins in rickettsial ABM. Of great interest to the field is the identity of the essential rickettsial protein(s) necessary for ABM. A candidate protein may be identified upon completion of the R. conorii genomic sequencing project currently under way by Genoscope (htpp://www.genoscope.cns.fr/).


    ACKNOWLEDGMENTS

We thank Scott Boitano, Shelly Robertson, and Scott Grieshaber for review of the manuscript, and Lorraine Barrows for technical assistance.

This work was supported by National Institutes of Health grant AI-43502-01 (R.A.H.).


    FOOTNOTES

* Corresponding author. Mailing address: Department of Molecular Biology, University of Wyoming, Laramie, WY 82071-3944. Phone: (307) 766-5458. Fax: (307) 766-3875. E-mail: rheinzen{at}uwyo.edu.

Editor:   A. D. O'Brien


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Anacker, R. L., R. E. Mann, and C. Gonzales. 1987. Reactivity of monoclonal antibodies to Rickettsia rickettsii with spotted fever and typhus group rickettsiae. J. Clin. Microbiol. 25:167-171[Abstract/Free Full Text].
2. Bernardini, M. L., J. Mounier, H. d'Hauteville, M. Coquis-Rondon, and P. J. Sansonetti. 1989. Identification of icsA, a plasmid locus of Shigella flexneri that governs bacterial intra- and intercellular spread through interaction with F-actin. Proc. Natl. Acad. Sci. USA 86:3867-3871[Abstract/Free Full Text].
3. Bershadsky, A. D., and J. M. Vasiliev (ed.). 1988. Cytoskeleton. Plenum Publishing Corp., New York, N.Y.
4. Carlier, M. F., V. Laurent, J. Santolini, R. Melki, D. Didry, G. X. Xia, Y. Hong, N. H. Chua, and D. Pantaloni. 1997. Actin depolymerizing factor (ADF/cofilin) enhances the rate of filament turnover: implication in actin-based motility. J. Cell Biol. 136:1307-1322[Abstract/Free Full Text].
5. Chakraborty, T., F. Ebel, E. Domann, K. Niebuhr, B. Gerstel, S. Pistor, C. J. Temm-Grove, B. M. Jockusch, M. Reinhard, U. Walter, and J. Wehland. 1995. A focal adhesion factor directly linking intracellularly motile Listeria monocytogenes and Listeria ivanovii to the actin-based cytoskeleton of mammalian cells. EMBO J. 14:1314-1321[Medline].
6. Dabiri, G. A., J. M. Sanger, D. A. Portnoy, and F. S. Southwick. 1990. Listeria monocytogenes moves rapidly through the host-cell cytoplasm by inducing directional actin assembly. Proc. Natl. Acad. Sci. USA 87:6068-6072[Abstract/Free Full Text].
7. Dold, F. G., J. M. Sanger, and J. W. Sanger. 1994. Intact alpha-actinin molecules are needed for both the assembly of actin into the tails and the locomotion of Listeria monocytogenes inside infected cells. Cell Motil. Cytoskeleton 28:97-107[CrossRef][Medline].
8. Domann, E., J. Wehland, M. Rohde, S. Pistor, M. Hartl, W. Goebel, M. Leimeister-Wachter, M. Wuenscher, and T. Chakraborty. 1992. A novel bacterial virulence gene in Listeria monocytogenes required for host cell microfilament interaction with homology to the proline-rich region of vinculin. EMBO J. 11:1981-1990[Medline].
9. Dramsi, S., and P. Cossart. 1998. Intracellular pathogens and the actin cytoskeleton. Annu. Rev. Cell Dev. Biol. 14:137-166[CrossRef][Medline].
10. Frischknecht, F., S. Cudmore, V. Moreau, I. Reckmann, S. Rottger, and M. Way. 1999. Tyrosine phosphorylation is required for actin-based motility of vaccinia but not Listeria or Shigella. Curr. Biol. 9:89-92[CrossRef][Medline].
11. Frischknecht, F., V. Moreau, S. Rottger, S. Gonfloni, I. Reckmann, G. Superti-Furga, and M. Way. 1999. Actin-based motility of vaccinia virus mimics receptor tyrosine kinase signalling. Nature 401:926-929[CrossRef][Medline].
12. Gouin, E., H. Gantelet, C. Egile, I. Lasa, H. Ohayon, V. Villiers, P. Gounon, P. J. Sansonetti, and P. Cossart. 1999. A comparative study of the actin-based motilities of the pathogenic bacteria Listeria monocytogenes, Shigella flexneri and Rickettsia conorii. J. Cell Sci. 112:1697-1708[Abstract].
13. Hackstadt, T. 1996. The biology of rickettsiae. Infect. Agents Dis. 5:127-143[Medline].
14. Hackstadt, T., R. Messer, W. Cieplak, and M. G. Peacock. 1992. Evidence for proteolytic cleavage of the 120-kilodalton outer membrane protein of rickettsiae: identification of an avirulent mutant deficient in processing. Infect. Immun. 60:159-165[Abstract/Free Full Text].
15. Heinzen, R. A., S. S. Grieshaber, L. S. Van Kirk, and C. J. Devin. 1999. Dynamics of actin-based movement by Rickettsia rickettsii in Vero cells. Infect. Immun. 67:4201-4207[Abstract/Free Full Text].
16. Heinzen, R. A., S. F. Hayes, M. G. Peacock, and T. Hackstadt. 1993. Directional actin polymerization associated with spotted fever group rickettsia infection of Vero cells. Infect. Immun. 61:1926-1935[Abstract/Free Full Text].
17. Kadurugamuwa, J. L., M. Rohde, J. Wehland, and K. N. Timmis. 1991. Intercellular spread of Shigella flexneri through a monolayer mediated by membranous protrusions and associated with reorganization of the cytoskeletal protein vinculin. Infect. Immun. 59:3463-3471[Abstract/Free Full Text].
18. Kocks, C., E. Gouin, M. Tabouret, P. Berche, H. Ohayon, and P. Cossart. 1992. L. monocytogenes-induced actin assembly requires the actA gene product, a surface protein. Cell 68:521-531[CrossRef][Medline].
19. Laine, R. O., K. L. Phaneuf, C. C. Cunningham, D. Kwiatkowski, T. Azuma, and F. S. Southwick. 1998. Gelsolin, a protein that caps the barbed ends and severs actin filaments, enhances the actin-based motility of Listeria monocytogenes in host cells. Infect. Immun. 66:3775-3782[Abstract/Free Full Text].
20. Lasa, I., V. David, E. Gouin, J. B. Marchand, and P. Cossart. 1995. The amino-terminal part of ActA is critical for the actin-based motility of Listeria monocytogenes; the central proline-rich region acts as a stimulator. Mol. Microbiol. 18:425-436[CrossRef][Medline].
21. Lett, M. C., C. Sasakawa, N. Okada, T. Sakai, S. Makino, M. Yamada, K. Komatsu, and M. Yoshikawa. 1989. virG, a plasmid-coded virulence gene of Shigella flexneri: identification of the VirG protein and determination of the complete coding sequence. J. Bacteriol. 171:353-359[Abstract/Free Full Text].
22. Loisel, T. P., R. Boujemaa, D. Pantaloni, and M. F. Carlier. 1999. Reconstitution of actin-based motility of Listeria and Shigella using pure proteins. Nature 401:613-616[CrossRef][Medline].
23. Luna, E. J., and A. L. Hitt. 1992. Cytoskeleton-plasma membrane interactions. Science 258:955-964[Abstract/Free Full Text].
24. Pavalko, F. M., C. A. Otey, and K. Burridge. 1989. Identification of a filamin isoform enriched at the ends of stress fibers in chicken embryo fibroblasts. J. Cell Sci. 94:109-118[Abstract/Free Full Text].
25. Pistor, S., T. Chakraborty, U. Walter, and J. Wehland. 1995. The bacterial actin nucleator protein ActA of Listeria monocytogenes contains multiple binding sites for host microfilament proteins. Curr. Biol. 5:517-525[CrossRef][Medline].
26. Prevost, M. C., M. Lesourd, M. Arpin, F. Vernel, J. Mounier, R. Hellio, and P. J. Sansonetti. 1992. Unipolar reorganization of F-actin layer at bacterial division and bundling of actin filaments by plastin correlate with movement of Shigella flexneri within HeLa cells. Infect. Immun. 60:4088-4099[Abstract/Free Full Text].
27. Reinhard, M., K. Giehl, K. Abel, C. Haffner, T. Jarchau, V. Hoppe, B. M. Jockusch, and U. Walter. 1995. The proline-rich focal adhesion and microfilament protein VASP is a ligand for profilins. EMBO J. 14:1583-1589[Medline].
28. Reinhard, M., M. Halbrugge, U. Scheer, C. Wiegand, B. M. Jockusch, and U. Walter. 1992. The 46/50 kDa phosphoprotein VASP purified from human platelets is a novel protein associated with actin filaments and focal contacts. EMBO J. 11:2063-2070[Medline].
29. Reinhard, M., M. Rudiger, B. M. Jockusch, and U. Walter. 1996. VASP interaction with vinculin: a recurring theme of interactions with proline-rich motifs. FEBS Lett. 399:103-107[CrossRef][Medline].
30. Robbins, J. R., A. I. Barth, H. Marquis, E. L. de Hostos, W. J. Nelson, and J. A. Theriot. 1999. Listeria monocytogenes exploits normal host cell processes to spread from cell to cell. J. Cell Biol. 146:1333-1350[Abstract/Free Full Text].
31. Rosenblatt, J., B. J. Agnew, H. Abe, J. R. Bamburg, and T. J. Mitchison. 1997. Xenopus actin depolymerizing factor/cofilin (XAC) is responsible for the turnover of actin filaments in Listeria monocytogenes tails. J. Cell Biol. 136:1323-1332[Abstract/Free Full Text].
32. Sanger, J. M., B. Mittal, F. S. Southwick, and J. W. Sanger. 1995. Listeria monocytogenes intracellular migration: inhibition by profilin, vitamin D-binding protein and DNase I. Cell Motil. Cytoskeleton 30:38-49[CrossRef][Medline].
33. Sechi, A. S., J. Wehland, and J. V. Small. 1997. The isolated comet tail pseudopodium of Listeria monocytogenes: a tail of two actin filament populations, long and axial and short and random. J. Cell Biol. 137:155-167[Abstract/Free Full Text].
34. Silverman, D. J. 1997. Oxidative cell injury and spotted fever group rickettsiae, p. 79-98. In B. Anderson, M. Bendinelli, and H. Friedman (ed.), Rickettsial infection and immunity. Plenum Publishing Corp., New York, N.Y.
35. Silverman, D. J. 1984. Rickettsia rickettsii-induced cellular injury of human vascular endothelium in vitro. Infect. Immun. 44:545-553[Abstract/Free Full Text].
36. Silverman, D. J., L. A. Santucci, N. Meyers, and Z. Sekeyova. 1992. Penetration of host cells by Rickettsia rickettsii appears to be mediated by a phospholipase of rickettsial origin. Infect. Immun. 60:2733-2740[Abstract/Free Full Text].
37. Silverman, D. J., C. L. Wisseman, Jr., and A. Waddell. 1980. In vitro studies of Rickettsia-host cell interactions: ultrastructural study of Rickettsia prowazekii-infected chicken embryo fibroblasts. Infect. Immun. 29:778-790[Abstract/Free Full Text].
38. Smith, G. A., J. A. Theriot, and D. A. Portnoy. 1996. The tandem repeat domain in the Listeria monocytogenes ActA protein controls the rate of actin-based motility, the percentage of moving bacteria, and the localization of vasodilator-stimulated phosphoprotein and profilin. J. Cell Biol. 135:647-660[Abstract/Free Full Text].
39. Temm-Grove, C. J., B. M. Jockusch, M. Rohde, K. Niebuhr, T. Chakraborty, and J. Wehland. 1994. Exploitation of microfilament proteins by Listeria monocytogenes: microvillus-like composition of the comet tails and vectorial spreading in polarized epithelial sheets. J. Cell Sci. 107:2951-2960[Abstract].
40. Teysseire, N., J. A. Boudier, and D. Raoult. 1995. Rickettsia conorii entry into Vero cells. Infect. Immun. 63:366-374[Abstract].
41. Theriot, J. A. 1997. Accelerating on a treadmill: ADF/cofilin promotes rapid actin filament turnover in the dynamic cytoskeleton. J. Cell Biol. 136:1165-1168[Free Full Text].
42. Theriot, J. A., J. Rosenblatt, D. A. Portnoy, P. J. Goldschmidt-Clermont, and T. J. Mitchison. 1994. Involvement of profilin in the actin-based motility of L. monocytogenes in cells and in cell-free extracts. Cell 76:505-517[CrossRef][Medline].
43. Tilney, L. G., P. S. Connelly, and D. A. Portnoy. 1990. Actin filament nucleation by the bacterial pathogen, Listeria monocytogenes. J. Cell Biol. 111:2979-2988[Abstract/Free Full Text].
44. Tilney, L. G., D. J. DeRosier, A. Weber, and M. S. Tilney. 1992. How Listeria exploits host cell actin to form its own cytoskeleton. II. Nucleation, actin filament polarity, filament assembly, and evidence for a pointed end capper. J. Cell Biol. 118:83-93[Abstract/Free Full Text].
45. Tilney, L. G., and D. A. Portnoy. 1989. Actin filaments and the growth, movement, and spread of the intracellular bacterial parasite, Listeria monocytogenes. J. Cell Biol. 109:1597-1608[Abstract/Free Full Text].
46. Tilney, L. G., and M. S. Tilney. 1994. Methods to visualize actin polymerization associated with bacterial invasion. Methods Enzymol. 236:476-481[Medline].
47. Walker, D. H. 1989. Rocky Mountain spotted fever: a disease in need of microbiological concern. Clin. Microbiol. Rev. 2:227-240[Abstract/Free Full Text].
48. Walker, T. S. 1984. Rickettsial interactions with human endothelial cells in vitro: adherence and entry. Infect. Immun. 44:205-210[Abstract/Free Full Text].
49. Walker, T. S., and H. H. Winkler. 1978. Penetration of cultured mouse fibroblasts (L cells) by Rickettsia prowazeki. Infect. Immun. 22:200-208[Abstract/Free Full Text].
50. Way, M. 1998. Interaction of vaccinia virus with the actin cytoskeleton. Folia Microbiol. 43:305-310.
51. Welch, M. D., J. Rosenblatt, J. Skoble, D. A. Portnoy, and T. J. Mitchison. 1998. Interaction of human Arp2/3 complex and the Listeria monocytogenes ActA protein in actin filament nucleation. Science 281:105-108[Abstract/Free Full Text].
52. Winkler, H. H., and E. T. Miller. 1982. Phospholipase A and the interaction of Rickettsia prowazekii and mouse fibroblast L-929 cells. Infect. Immun. 38:109-113[Abstract/Free Full Text].


Infection and Immunity, August 2000, p. 4706-4713, Vol. 68, No. 8
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Van Kirk, L. S.
Right arrow Articles by Heinzen, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Van Kirk, L. S.
Right arrow Articles by Heinzen, R. A.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals