Previous Article | Next Article 
Infection and Immunity, August 2000, p. 4706-4713, Vol. 68, No. 8
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Ultrastructure of Rickettsia rickettsii
Actin Tails and Localization of Cytoskeletal Proteins
Levi S.
Van Kirk,1
Stanley F.
Hayes,2 and
Robert A.
Heinzen1,*
Department of Molecular Biology, University
of Wyoming, Laramie, Wyoming 82071-3944,1 and
Microscopy Branch, Rocky Mountain Laboratories, National
Institute of Allergy and Infectious Diseases, Hamilton, Montana
598402
Received 19 January 2000/Returned for modification 17 March
2000/Accepted 8 May 2000
 |
ABSTRACT |
Actin-based motility (ABM) is a mechanism for intercellular spread
that is utilized by vaccinia virus and the invasive bacteria within the
genera Rickettsia, Listeria, and
Shigella. Within the Rickettsia, ABM is
confined to members of the spotted fever group (SFG), such as
Rickettsia rickettsii, the agent of Rocky Mountain spotted
fever. Infection by each agent induces the polymerization of host cell
actin to form the typical F (filamentous)-actin comet tail. Assembly of the actin tail propels the pathogen through the host
cytosol and into cell membrane protrusions that can be engulfed by
neighboring cells, initiating a new infectious cycle. Little is known
about the structure and morphogenesis of the Rickettsia rickettsii actin tail relative to Shigella
and Listeria actin tails. In this study we
examined the ultrastructure of the rickettsial actin tail by confocal,
scanning electron, and transmission electron microscopy. Confocal
microscopy of rhodamine phalloidin-stained infected Vero cells revealed
the typhus group rickettsiae, Rickettsia prowazekii and
Rickettsia typhi, to have no actin tails and short (~1-
to 3-µm) straight or hooked actin tails, respectively. The SFG
rickettsia, R. rickettsii, displayed long actin tails (>10 µm) that were frequently comprised of multiple, distinct actin bundles, wrapping around each other in a helical fashion. Transmission electron microscopy, in conjunction with myosin S1 subfragment decoration, revealed that the individual actin filaments of R. rickettsii tails are >1 µm long, arranged roughly parallel to one another, and oriented with the fast-growing barbed end towards the
rickettsial pole. Scanning electron microscopy of intracellular rickettsiae demonstrated R. rickettsii to have polar
associations of cytoskeletal material and R. prowazekii to
be devoid of cytoskeletal interactions. By indirect immunofluorescence,
both R. rickettsii and Listeria monocytogenes
actin tails were shown to contain the cytoskeletal proteins
vasodilator-stimulated phosphoprotein profilin, vinculin, and filamin.
However, rickettsial tails lacked ezrin, paxillin, and
tropomyosin, proteins that were associated with actin tails of
cytosolic or protrusion-bound Listeria. The unique ultrastructural and compositional characteristics of the R. rickettsii actin tail suggest that rickettsial ABM is
mechanistically different from previously described microbial ABM systems.
 |
INTRODUCTION |
Members of the genus
Rickettsia are obligate intracellular bacteria that grow
within the cytoplasm of their eucaryotic host cell (13).
They are the etiologic agents of a variety of serious human diseases
such as Rocky Mountain spotted fever and epidemic typhus and are
transmitted to their mammalian hosts exclusively by arthropod vectors
that include ticks, fleas, lice, and mites (13). Rickettsiae
display a tropism for the endothelium, where they invade and spread to
cause vascular permeability (47).
Because of experimental limitations imposed by the obligate
intracellular nature of rickettsiae and the lack of workable genetic systems, little is known about specific virulence determinants utilized
by these organisms. However, there is a cursory understanding of some
rickettsia-host interactions. Studies employing the typhus group
rickettsia, Rickettsia prowazekii, demonstrate that
internalization requires adherence to an unidentified plasma membrane
receptor by viable, metabolically active organisms (49).
Uptake of rickettsiae ensues by a microfilament-dependent process
(48). Collectively, the two processes have been termed
parasite-induced phagocytosis (48). Evidence suggests that
internalized rickettsiae are initially bound within a phagocytic
vacuole (12, 40). An increase in phospholipase
A2 activity occurs concomitantly with rickettsial entry and
presumably facilitates rickettsial access to the host cytoplasm
(36, 49, 52). Once in the intracytoplasmic milieu, rickettsiae are free to exploit the nutrient-rich environment and
interact with host structural components.
A suspected virulence mechanism unique to spotted fever group (SFG)
rickettsiae, such as Rickettsia rickettsii, is the
utilization of an intracellular actin-based motility (ABM) system to
promote direct cell-to-cell spread (12, 15, 16). This
mechanism of pathogenesis is also exploited by the facultative
intracellular bacteria Listeria monocytogenes and
Shigella flexneri (9) as well as vaccinia virus
(50). Using the propulsive force supplied by
parasite-directed polymerization of host cell actin, motile bacteria
move into plasma membrane-bound protrusions that can be subsequently
engulfed by neighboring cells. Escape from the double-membrane vacuole
allows infection of the newly encountered cytoplasm (45).
The ability of pathogens to spread within the host tissues, using ABM
to directly transit from one cell to another, allows evasion of the
host humoral immune response.
The bacterial surface proteins ActA and IcsA are necessary and
sufficient for ABM by Listeria (8, 18) and
Shigella (2, 21), respectively. The viral protein
A36R is essential for vaccinia virus ABM (11). Rickettsial
protein synthesis is required for ABM, but the identity of the
necessary protein(s) is unknown (16). A number of host
cytoskeletal proteins are also necessary or suspected modulators of
bacterial ABM and protrusion formation. These were initially identified
by immunolocalization studies and include proteins involved in F
(filamentous)-actin cross-linking, side binding, severing, capping,
depolymerizing, and nucleating (3, 9). Direct biochemical
evidence for roles in Listeria ABM has been established for
vasodilator-stimulated phosphoprotein (VASP) (5, 22, 25,
38), the complex of actin-related proteins 2 and 3 (Arp2-Arp3)
(22, 51), gelsolin (19), profilin (22, 32,
38, 42),
-actinin (7, 22), actin depolymerization factor (also called cofilin) (4, 22, 31), and capping
protein (22). Using a reconstitution assay, Loisel et al.
(22) have recently determined that actin, Arp2-Arp3 complex,
cofilin, and capping protein are minimally required for in vitro ABM by
Listeria. The Arp2-Arp3 complex is stimulated by interaction
with ActA to nucleate the production of new actin filaments (22,
51). Capping protein stops the growth of existing actin tail
filaments by binding to their fast-growing barbed ends, thus possibly
funneling available G (globular)-actin to the production of new
filaments at the bacterium-tail interface (22). Cofilin
stimulates the release of G-actin from the slow-growing pointed ends of
filaments, thereby increasing the local concentration of G-actin for
use in new filament assembly (4, 22, 31). Listerial ABM is
more efficient if profilin (a G-actin sequestering protein), VASP (a
focal adhesion point protein and a ligand of profilin), and
-actinin
(an F-actin cross-linking protein) are present (22).
Additional host proteins may be necessary or stimulatory in vivo. Other
than actin, the cellular proteins necessary for R. rickettsii intracellular motility are completely unknown.
Elegant transmission electron microscopy (TEM) studies (33,
43-45), have elucidated the ultrastructural characteristics of listerial actin tails and allowed initial formulation of mechanical models for how actin might provide the propulsive force needed to move
the bacterium through the viscous cytosol. Studies using fixation
protocols optimized to preserve filamentous actin structures and myosin
S1 subfragment to decorate individual actin filaments demonstrate that
listerial actin tails are comprised of a cross-linked meshwork of short
(~0.2-µm) actin filaments (43-45). Tails associated with protrusion-bound Listeria have a different
ultrastructure; in addition to containing random short filaments, they
contain long (>1-µm) filaments that lie parallel with the protrusion
axis (33).
To gain insight into the mechanism of rickettsial ABM, we examined
R. rickettsii actin tail ultrastructure and composition. Identification of host cytoskeletal proteins associated with the rickettsial actin tail was accomplished by immunofluorescence localization with specific antibodies. TEM and scanning electron microscopy (SEM) were utilized to examine actin tail structure and
rickettsia-containing protrusions. In addition, the polarity of F-actin
filaments comprising rickettsial actin tails was determined by myosin
S1 subfragment decoration and TEM.
 |
MATERIALS AND METHODS |
Organisms.
R. rickettsii (HLP strain),
Rickettsia typhi (Wilmington strain), and R. prowazekii (Madrid E strain) were propagated in African green
monkey kidney (Vero) fibroblasts (CCL-81; American Type Culture
Collection) and were purified by Renografin density gradient centrifugation as previously described (14). L. monocytogenes 1043S was a generous gift of Dan Portnoy, University
of California at Berkeley, and was cultivated overnight in 3.7% brain
heart infusion (BHI) broth (Difco Laboratories, Detroit, Mich.).
Infection of Vero cells.
Twelve-millimeter-diameter glass
coverslips in 24-well plates were seeded with Vero cells to
semiconfluency and cultivated overnight at 37°C in M199 medium (Life
Technologies, Grand Island, N.Y.) supplemented with 10% fetal bovine
serum (FBS) (Life Technologies) and gentamicin (20 µg/ml; Life
Technologies). Rickettsiae suspended in 3.7% BHI broth (Difco
Laboratories) were used to infect monolayers at a multiplicity of
infection of 0.1 to 1.0 for 45 min. The inoculum was removed, the cells
were washed once, M199 medium supplemented with 2% FBS was added, and
incubation continued at 34°C. For infection of Vero cells with
L. monocytogenes, an overnight culture of
Listeria in BHI broth was pelleted, washed once, and
suspended in twice the culture volume of Hanks buffered saline solution
(Life Technologies). Suspended bacteria (200 to 300 µl) were added to
each tissue culture plate well and incubated for 1 h at room
temperature. Vero cells were then washed three times with Hanks
buffered saline solution and M199 with 2% FBS and gentamicin sulfate
(20 µg/ml) were added to culture wells. For TEM, cells were grown in
35-mm-diameter Thermanox petri dishes (Nunc Inc., Naperville, Ill.).
Construction of GFP-profilin.
The human profilin gene was
amplified from a HeLa cell cDNA library (Stratagene, La Jolla, Calif.)
using PCR. The 5' oligonucleotide GGATCCATGGCCGGGTGGAACGCCTAC
contains a BamHI site and the profilin ATG start
codon. The 3' oligonucleotide TCTAGATCAGTACTGGGAACGCCGAAGG contains an XbaI site and the profilin stop codon.
The resulting 434-bp PCR product was cloned into pCR2.1 (Invitrogen
Corp., Carlsbad, Calif.). The profilin-encoding insert was then excised
by digestion with BamHI and XbaI, and the
profilin reading frame was directionally cloned in frame with the 3'
end of gfp carried by pEGFP-C1 (Clontech Laboratories, Inc.,
Palo Alto, Calif.). Nucleotide sequencing of the resulting clone
(pEGFP-C1/profilin) confirmed the cloning procedure.
Fluorescence microscopy.
All fixation and staining
procedures were carried out at room temperature. Infected cells on
coverslips were fixed and permeabilized as previously described
(16). Fixed cells were then washed three times in 25 mM
sodium phosphate-150 mM sodium chloride (pH 7.4) (PBS) containing
0.5% bovine serum albumin (PBSA). The primary antibodies used in
indirect immunofluorescence labeling of intracellular bacteria were the
monoclonal antibody 13-2 directed against the rOmpB protein
(1) or rabbit anti-R. rickettsii
serum for R. rickettsii, rabbit anti-R.
prowazekii serum for R. typhi and R. prowazekii, and rabbit anti-Listeria serum (Biodesign
International, Kennebunk, Maine) for L. monocytogenes.
Bacteria were subsequently labeled with an anti-mouse immunoglobulin G
(IgG) Texas Red conjugate (Jackson ImmunoResearch Laboratories,
Inc., West Grove, Pa.), an anti-rabbit IgG fluorescein conjugate
(Pierce, Rockford, Ill.), or an anti-rabbit IgG rhodamine conjugate
(Pierce). Following staining of bacteria, coverslips were washed three
times in PBSA and F-actin stained by incubating with rhodamine
phalloidin (Molecular Probes, Eugene, Oreg.) at 10 U/ml for 20 min.
Other cytoskeletal proteins were labeled by indirect immunofluorescence
using monoclonal antibodies. Antibodies directed against VASP (clone
43), ezrin (clone 18), and paxillin (clone 349) were purchased from
Transduction Laboratories (Lexington, Ky.); antibodies directed against
tropomyosin (clone TM311) and vinculin were purchased from Sigma (St.
Louis, Mo.); and a filamin-specific monoclonal antibody was purchased from Chemicon International, Inc. (Temecula, Calif.). Proteins were
subsequently labeled with either an anti-mouse IgG Texas Red conjugate
or an anti-mouse IgG fluorescein conjugate. Coverslips were mounted
onto glass slides using Vectashield mounting medium (Vector
Laboratories, Inc., Burlingame, Calif.) and observed with a Leica
laser-scanning confocal microscope equipped with a krypton-argon laser
illuminator. Collected images were processed with Adobe Photoshop 3.0.
Electron microscopy.
SEM using the dry cleave method was
conducted essentially as described by Prevost et al. (26).
Briefly, infected Vero cells were rinsed in PHEM buffer (60 mM
piperazine-N,N'-bis[2-ethanesulfonic acid]
[PIPES], 23 mM HEPES, 10 mM EGTA, 2 mM MgCl2 [pH 6.9])
and then treated with PHEM containing 0.5% saponin for 5 min at room temperature. Cells were then fixed in 2.5% glutaraldehyde in PHEM for
30 min, rinsed with PHEM, and postfixed with 0.5% osmium tetroxide in
PHEM for 90 min. Cells were rinsed with distilled water and dehydrated
in a graded series of alcohol. Cells were then treated with
hexamethyldisilazane and air dried. Cell interiors were exposed by dry
cleaving the monolayer via application and removal of cellophane tape.
Cells were then sputter-coated with gold-palladium. To visualize intact
pseudopodia, infected cells were similarly processed, except the
saponin membrane solubilization and dry cleave steps were omitted.
Samples were examined with a Hitachi S-570 scanning electron microscope.
TEM was conducted on Vero cells infected for 4 days with R. rickettsii. For preservation of filamentous actin structures, cells were quick fixed in situ by the method of Tilney and Tilney (46). Cells in 35-mm-diameter Thermanox petri dishes were
fixed for 30 min with a solution containing 1% glutaraldehyde, 1%
osmium tetroxide, and 50 mM phosphate buffer (pH 6.3) on ice. Fixed
cells were washed with distilled water three times for 5 min and
stained overnight with 0.5% uranyl acetate. Cells were dehydrated in a graded series of ethanol and embedded in Epon, and sections were cut
and poststained with uranyl acetate and lead citrate. Myosin S1
decoration was conducted according to the method of Tilney et al.
(44). All procedures prior to dehydration were conducted on
ice. R. rickettsii-infected cells in Thermanox petri dishes were washed with PHEM buffer. Membranes were then solubilized for 10 min with 50 mM phosphate buffer (pH 6.8) containing 1% Triton X-100
and 3 mM MgCl2. Cells were washed two times with 0.1 M
phosphate buffer (pH 6.8), and this was followed by incubation for 30 min in phosphate buffer containing myosin S1 subfragment (5 mg/ml;
Sigma). This solution was decanted, and the cells were washed in 100 mM
phosphate (pH 6.8) buffer; this was followed by fixation for 30 min in
50 mM phosphate buffer (pH 6.8) containing 1% glutaraldehyde and 2%
tannic acid. Cells were washed again in 50 mM phosphate buffer (pH 6.8)
and subsequently postfixed in 1% osmium tetroxide in 0.1 M phosphate
buffer (pH 6.3). Fixed cells were washed with distilled water three
times for 5 min and stained overnight with 0.5% uranyl acetate. Cells
were dehydrated in a graded series of ethanol and embedded in Epon, and
sections were cut and poststained with uranyl acetate and lead citrate. Samples were examined using a Hitachi HU-11E-1 electron microscope.
 |
RESULTS |
Laser scanning confocal microscopy of actin tails.
Laser
scanning confocal microscopy was conducted on rhodamine
phalloidin-stained Vero cells infected with species of
Rickettsia that display the 3 representative actin tail
phenotypes (16): long tails (R. rickettsii),
short tails (R. typhi), and no tails (R. prowazekii). We employed L. monocytogenes as a
comparative control in this procedure. The prototypic long actin tails
of R. rickettsii (Fig. 1A and
B) were morphologically distinct from those associated with L. monocytogenes (Fig. 1E). R. rickettsii actin tails were
straighter and longer (average length, 16.7 µm) than those of
Listeria (average length, 6.7 µm). Occasionally rickettsial tails with dramatic curves were observed, usually in
association with organisms that had obviously collided with the plasma
membrane. This occurrence has also been observed by time-lapse video
microscopy (15). In contrast to listerial tails, where actin
staining results in a relatively uniform gradient of fluorescence
throughout the tail length, R. rickettsii tails were often
comprised of two or more distinct actin bundles (Fig. 1A and B). These
bundles often twisted around each other in a helical fashion to form
nonfluorescent gaps in the tail structure. The truncated actin tails of
R. typhi were small (~3 µm) and usually hook shaped and
did not exhibit the gapped appearance of the R. rickettsii
tail (Fig. 1C). R. prowazekii displayed a null actin tail
phenotype as illustrated by the absence of actin tail appendages (Fig.
1D).

View larger version (116K):
[in this window]
[in a new window]
|
FIG. 1.
Actin tail phenotypes of rickettsiae and comparison to
tails of L. monocytogenes. Dual fluorescent staining of
intracellular bacteria and F-actin was conducted on Vero cells. F-actin
was stained with rhodamine phalloidin (red), and intracellular bacteria
were stained by indirect immunofluorescence (green). Cells were
visualized by laser scanning confocal microscopy. (A) R. rickettsii showing long actin tails that are frequently comprised
of multiple, twisting, distinct F-actin bundles. (B) High magnification
of an R. rickettsii actin tail in panel A comprised of two
F-actin bundles. (C) Truncated hook-shaped tail of R. typhi
(arrow). (D) R. prowazekii with no actin tails. (E) Actin
comet tails of L. monocytogenes. Bars, 5 µm.
|
|
Electron microscopy of actin tails and protrusions.
Using SEM
and a dry cleave procedure to reveal the host cell interior, we
observed R. rickettsii in association with a polar stalk of
cytoskeletal material, presumably F-actin (26) (Fig. 2A). R. rickettsii organisms
were randomly dispersed at low numbers throughout the cell cytoplasm.
Occasionally R. rickettsii existed as clumps of two or more
organisms, with the cytoskeletal stalk usually associated with one
organism (unpublished observations). With organisms undergoing binary
fission, the cytoskeletal stalk was associated with one pole of a
single forming daughter cell (Fig. 2B). A similar behavior has
previously been observed for actin tails associated with a dividing
rickettsia by TEM (16) and rhodamine phalloidin staining
(15). In contrast to R. rickettsii, R. prowazekii existed as dense groups of organisms without obvious polar cytoskeletal associations (Fig. 2C).

View larger version (97K):
[in this window]
[in a new window]
|
FIG. 2.
SEM of Vero cells infected with R. rickettsii
or R. prowazekii. Cells were fixed and dry cleaved to expose
the cell interior. (A and B) R. rickettsii with a polar
stalk of cytoskeletal material. Note the organism undergoing binary
fission with only one daughter cell associated with cytoskeletal
material (B). (C) R. prowazekii devoid of polar cytoskeletal
stalks. Bars, 0.5 µm.
|
|
TEM was conducted on infected cells using a fixation technique
optimized for preservation of F-actin structures (
46).
R. rickettsii actin tails existed as long,
parallel-arranged actin
filaments that appeared to be minimally
cross-linked (Fig.
3A).
In most
instances, filaments were absent from the extreme pole
of the organism,
which is consistent with the gapped tail appearance
in Fig.
1. Myosin
S1 subfragment decoration further demonstrated
the linearity of
rickettsial actin tail filaments (Fig.
3B). Although
a precise
measurement of the length of individual actin filaments
was difficult
to achieve, close inspection of Fig.
3A and B suggests
that they are at
least 1 µm in length. A high-magnification image
of S1 decorated
F-actin immediately adjacent to the bacterium
shows the fast-growing
barbed ends of individual actin filaments
oriented towards the
rickettsial surface (Fig.
3C).

View larger version (106K):
[in this window]
[in a new window]
|
FIG. 3.
Ultrastructure of the R. rickettsii actin
tail as viewed by TEM. (A) Sections of Vero cells infected with
R. rickettsii showing a bilateral association of bundles of
long actin filaments that appear to be minimally cross-linked. (B)
Myosin S1 subfragment decoration of the rickettsial actin tail
depicting long, parallel actin filaments. (C) High magnification of
myosin S1 subfragment decorated tail filaments showing the fast-growing
barbed ends of filaments oriented towards the rickettsial surface. A
decorated actin filament, designated with an asterisk at the barbed
end, is shown in the inset. Individual S1 subunits are demarcated with
white lines to highlight the directional binding of this protein. Bars,
0.5 µm.
|
|
Formation of bacterium-containing protrusions is prerequisite for
cell-to-cell spread by
L. monocytogenes (
30) and
S. flexneri (
17).
R. rickettsii was
similarly found in protrusions ~3 to
5 µm in length. Figure
4A depicts a rickettsia-containing
protrusion
that is apparently in the process of uptake by a neighboring
uninfected
cell. The plasma membranes of the infected and adjacent
uninfected
cell are clearly visible. Protrusions containing more than
one
rickettsia were also observed. Figure
4B depicts a short protrusion
containing two rickettsiae with an accompanying actin tail extending
into the Vero cell cytoplasm. F-actin of comprising tails of
protrusion-
bound rickettsia appeared more compressed than that of
cytosolic
bacteria. Protrusions were also observed by SEM. Fig.
4C
shows
a short membrane-bound protrusion that has collapsed to the cell
surface and consists of a bulbous head harboring the organism,
and a
sphinctered stalk containing a condensed actin tail.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 4.
Protrusion formation and cell-to-cell spread by R. rickettsii in Vero cells. (A) Thin section of
rickettsia-containing protrusion. The plasma membrane of the infected
cell and the adjacent uninfected cell are clearly visible. The actin
tail has been grazed in this thin section. (B) Protrusion containing
two rickettsiae that extends a few micrometers from the cell surface.
The cup-shaped beginning of the accompanying actin tail is designated
with an arrow. (C) SEM of R. rickettsii in a short
protrusion that has collapsed to the cell surface. Bars, 0.5 µm.
|
|
Fluorescence localization of cytoskeletal proteins.
A number
of host cytoskeletal proteins are associated with actin tail and/or
protrusion formation by Listeria and Shigella (9). Employing L. monocytogenes as a comparative
control, we conducted confocal laser scanning microscopy to determine
the location of cytoskeletal proteins in R. rickettsii-infected Vero cells. VASP and profilin are accelerators
of the actin-based motor of Listeria (22). By
indirect immunofluorescence, VASP was diffusely dispersed throughout
rickettsial actin tails as shown in Fig. 5A. A rickettsia in this figure was
apparently captured in the process of entering the nucleus while still
tethered to its actin tail, suggesting that the mechanism of entry by
rickettsia into this intracellular compartment is an active process
driven by actin polymerization. In contrast to R. rickettsii, VASP localized only to the actin-polymerizing pole of
Listeria where, as previously reported, it binds directly to
the proline-rich region of the listerial surface protein ActA (Fig. 5A)
(5, 25). VASP is a ligand for profilin, a
G-actin-sequestering protein (27). GFP-profilin, when
introduced into infected Vero cells by transfection, also localized
throughout the R. rickettsii actin tail, possibly via direct
binding to VASP (Fig. 5A). This confocal image shows at least two
distinct clumps of rickettsiae within the nucleus that are associated
with one branching actin tail. We have previously observed the clumping
of intranuclear rickettsiae and their associated actin tails by
time-lapse video microscopy (15). GFP-profilin was primarily
localized to one pole of Listeria and the beginning of their
actin tails, as described by others (42).

View larger version (127K):
[in this window]
[in a new window]
|
FIG. 5.
Fluorescence localization of the cytoskeletal proteins
VASP, profilin, vinculin, filamin, tropomyosin, ezrin, and paxillin in
fixed Vero cells infected with R. rickettsii (R. r.) or L. monocytogenes (L. m.). Images were
collected using a confocal laser scanning microscope. Cytoskeletal
proteins, with the exception of profilin, were labeled by indirect
immunofluorescence by using specific monoclonal antibodies. Profilin
was localized by transiently expressing GFP-profilin in infected cells
as described in Materials and Methods. Intracellular bacteria were
counterstained by indirect immunofluorescence. (A) VASP labeling (red)
is diffusely dispersed throughout the actin tail of R. rickettsii (green), whereas labeling is concentrated to one pole
of Listeria (green). (Note the rickettsiae apparently in the
process of penetrating the nuclear membrane.) GFP-profilin (green) is
similarly dispersed throughout the actin tail of R. rickettsii (red), in this case intranuclear rickettsiae, whereas
GFP-profilin is primarily localized to one pole of Listeria
(red) and the beginning of the actin tails. (B) Vinculin and filamin
(green) were detected throughout the length of tails of R. rickettsii (red) and Listeria (red). Tropomyosin,
ezrin, and paxillin (green) were detected in tails of cytoplasmic or
protrusion-bound Listeria (green) but not tails of R. rickettsii (red). Bars, 5 µm.
|
|
In addition to VASP and profilin, we localized by indirect
immunofuorescence other cytoskeletal proteins implicated as modulators
of bacterial ABM and protrusion formation (Fig.
5B). Vinculin,
filamin,
ezrin, and paxillin are cytoskeletal proteins that are
enriched in
plasma membrane focal adhesion points (
23,
24).
Tropomyosin
is an actin side binding protein (
3). In keeping
with
previous studies, filamin (
7), vinculin (
7),
ezrin
(
10,
33,
39), and tropomyosin (
6) were
detected in actin
tails of cytoplasmic or protrusion-bound
Listeria. In contrast
to a previous study (
10),
we additionally detected paxillin
in the listerial tail. Only vinculin
and filamin were detected
in the
R. rickettsii tail.
Vinculin labeling is associated with
the actin tail of clumped
intranuclear rickettsia (Fig.
5B).
 |
DISCUSSION |
In comparison to free-living facultative intracellular bacteria,
our current understanding of rickettsial virulence factors that allow
entry and intercellular spread in cultured cells is fragmentary. By
analogy to ABM mutants of Listeria (8, 18) and
Shigella (2, 21), which display attenuated
virulence in animal models, it is logical to assume that recruitment
and polymerization of host cell actin by SFG rickettsiae to allow intracellular motility and direct cell-to-cell spread represent a
rickettsial virulence determinant. Although the general process of
rickettsial ABM appears similar to that described for
Listeria and Shigella, in this report we have
demonstrated that rickettsial actin tails are compositionally and
ultrastructurally different from tails produced by these bacteria.
The R. rickettsii actin tail is frequently comprised of two
or more distinct, coiled actin bundles. We suggested in a previous report (15) that the coiling of actin tail bundles may be a manifestation of the rickettsial pole harboring multiple, fixed, asymmetrically opposed polymerization zones. The resultant asymmetry in
polymerization may provide a rotational force that spins the organism
as it moves through the cytosol.
Elegant electron microscopy studies, primarily by Tilney and coworkers
(43-45), have defined the ultrastructure of listerial actin
tails. They demonstrated that tails of cytosolic Listeria are comprised of a network of short (~0.2-µm) cross-linked actin filaments having their fast-growing barbed ends oriented towards the
bacterial surface (43-45). Actin tails of protrusion-bound Listeria are compositionally and ultrastructurally different
from those associated with cytosolic bacteria. For example, they lack
-actinin, an F-actin cross-linking protein that is observed in tails
of cytosolic Listeria and may be required for maintenance of
the bundled structure in this environment. They also have a lower
percentage of short filaments and exhibit long (>1-µm) filaments. Tails of protrusion-bound Listeria gain ezrin, a membrane
protein responsible for forming cytoskeleton-membrane associations,
that has been postulated to stabilize the longer tail filaments
(33).
In our original description of rickettsia-induced actin polymerization
we employed a TEM fixation procedure that used ruthenium red as an
F-actin stabilizer (16). These micrographs provided the
first glimpse of R. rickettsii actin tails by electron
microscopy and suggested that the tail consisted of long actin
filaments. In this report we confirm our early observations by using
quick-fix fixation (46) and myosin S1 subfragment decoration
to demonstrate that the R. rickettsii actin tail consists of
long (>1-µm), parallel-arranged filaments that appear to be
minimally cross-linked. Like listerial tail filaments, rickettsial tail
filaments are juxtaposed with the fast-growing barbed end oriented
towards the rickettsial surface, suggesting that G-actin incorporation
occurs at the rickettsial surface. Moreover, tail filaments of
protrusion-bound rickettsiae display a more condensed architecture, as
is observed for listerial tails (33). The short actin tail
of R. typhi implies that the organism is deficient in actin
recruitment and polymerization. Of interest would be to determine the
polarity and length of R. typhi actin tail filaments and
whether tail production confers intracellular motility.
The absence of a cytoskeletal stalk associated with one pole of
R. prowazekii by dry cleave SEM is consistent with the
absence of actin tails by TEM and phalloidin staining (16).
The lack of ABM by R. prowazekii correlates with a reduced
capacity to form plaques on cell monolayers. R. prowazekii
also grows to high numbers in individual cells with little cytopathic
effect (37). R. rickettsii are toxic to cells in
small numbers, with cytopathological changes indicative of oxidative
stress (for example, dilation of the rough endoplasmic reticulum)
observed 2 days after infection (35). Elevated cellular
levels of reactive oxygen species, such as superoxide anion and
hydrogen peroxide, are observed concomitant with R. rickettsii infection (34). Movement of SFG rickettsiae by ABM likely results in frequent collisions with the plasma membrane, where the action of rickettsial phospholipase(s) may produce
by-products capable of activating membrane-bound NADPH oxidase (or a
similar enzyme) to produce superoxide anion (34).
Differential localization of cytoskeletal proteins was observed between
R. rickettsii and L. monocytogenes actin tails.
In contrast to Listeria, in which VASP and profilin are
localized to the polymerizing end of the bacterium (5, 38),
both proteins are distributed throughout the R. rickettsii
actin tail. VASP is a substrate of cyclic AMP- and cyclic GMP-dependent
protein kinases and is generally localized to focal adhesions and areas of high actin turnover (28). VASP is also a ligand for
profilin (27), a G-actin-sequestering protein, and binds the
proline-rich motif in the central region of Listeria ActA
(5, 25). Although not essential for Listeria ABM,
VASP and profilin accelerate the process, possibly by recruiting
polymerization-competent actin monomers in the form of profilin-actin
complexes to the unipolar polymerization zone of the bacterium
(20, 22, 38, 42). One possible explanation for the
distribution of VASP and profilin in rickettsial tails is that R. rickettsii secretes a protein that is incorporated into the tail
and a ligand for VASP. Alternatively, VASP may localize to the R. rickettsii actin tail via association with vinculin, which
is a known ligand of VASP (29) and also in the rickettsial
tail. In this scenario vinculin may serve as an adapter protein
between a rickettsial protein necessary for ABM and VASP. Whether VASP
serves a functional role in accelerating rickettsial ABM by
recruiting profilin-actin complexes to the polymerization zone requires
further investigation.
Both R. rickettsii and L. monocytogenes actin
tails contained filamin, but rickettsial tails lacked tropomyosin,
ezrin, and paxillin. Filamin is an actin cross-linking protein found in
focal adhesions and stress fibers (24) and may play a role
in bundling rickettsial tail filaments. The lack of tropomyosin, ezrin,
and paxillin in rickettsial tails may explain the short length of rickettsial protrusions relative to those induced by
Listeria. These proteins all integrate with the actin
cytoskeleton and play roles in the formation of cell surface
extensions, such as filopodia (23). By TEM and SEM we
observed rickettsia in short protrusions (3 to 5 µm) considerably
shorter than those reported for Listeria. Depending on the
cell type, Listeria-containing protrusions can exceed 100 µm in length (33). The short R. rickettsii
protrusions in Vero cells may reflect an inability of rickettsial tail
filaments to interact and become stabilized by plasma membrane
cytoskeletal proteins.
The results of this study are in close agreement with the recently
published findings of Gouin et al. (12) in their study of a
related organism, Rickettsia conorii, the agent of
Mediterranean spotted fever. Like R. rickettsii tails,
R. conorii actin tails were found to be comprised of long,
minimally cross-linked actin filaments with the fast-growing barbed end
of the filaments oriented towards the organism. In addition to lacking
ezrin, they reported the absence of Arp3, cofilin, and capping protein
(CapZ) in R. conorii tails. The unique ultrastructural and
compositional differences between rickettsial and listerial tails may
explain the different ABM behavior and kinetics in the two genera
(12, 15). Both R. conorii and R. rickettsii move considerably slower than Listeria within cells (12, 15), and the actin filaments that comprise the R. rickettsii tail are approximately three times more
stable than those of listerial tails (15). The lack of Arp3,
cofilin, and capping protein may partially explain the low rate of
rickettsial ABM relative to that of Listeria. These proteins
affect actin nucleation (22, 51) or G-actin acquisition
(22, 41) and are required for listerial actin tail
formation. The lower rate of rickettsial ABM and longer half-life of
tail filaments may also be reflective of the tail containing fewer
pointed ends for depolymerization factors to act upon. The
absence of Arp3 is particularly interesting, as the Arp
complex is required for nucleation of new actin filaments in
actin-based movements of Listeria (22, 51),
Shigella (22), and presumably vaccinia virus
(10). This leads to the possibility that rickettsiae
synthesize a protein that confers actin nucleating activity rather than
recruiting a nucleating factor from the host.
Our results differ from those of Gouin and coworkers (12) in
detecting vinculin within the R. rickettsii tail.
Furthermore, they did not observe coiled, distinct actin bundles in
R. conorii tails, and tail production was observed only
after 24 to 36 h of infection. In a previous study we detected
R. rickettsii tail formation 30 min postinfection, with
F-actin-coated rickettsiae observed as early as 15 min postinfection
(16), suggesting that some R. rickettsii
organisms enter host cells preloaded with a functional protein(s)
necessary for ABM. This is unlike Listeria, in which
bacterial cell division and ActA processing is required for ABM
(30).
The results of this study suggest that R. rickettsii has
evolved to exploit host actin pools in a manner biologically distinct from Listeria and Shigella. Additional studies
are needed to clearly define the roles of host cytoskeletal proteins in
rickettsial ABM. Of great interest to the field is the identity of the
essential rickettsial protein(s) necessary for ABM. A
candidate protein may be identified upon completion of the
R. conorii genomic sequencing project currently under way by
Genoscope (htpp://www.genoscope.cns.fr/).
 |
ACKNOWLEDGMENTS |
We thank Scott Boitano, Shelly Robertson, and Scott Grieshaber
for review of the manuscript, and Lorraine Barrows for technical assistance.
This work was supported by National Institutes of Health grant
AI-43502-01 (R.A.H.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Biology, University of Wyoming, Laramie, WY 82071-3944. Phone: (307) 766-5458. Fax: (307) 766-3875. E-mail:
rheinzen{at}uwyo.edu.
Editor:
A. D. O'Brien
 |
REFERENCES |
| 1.
|
Anacker, R. L.,
R. E. Mann, and C. Gonzales.
1987.
Reactivity of monoclonal antibodies to Rickettsia rickettsii with spotted fever and typhus group rickettsiae.
J. Clin. Microbiol.
25:167-171[Abstract/Free Full Text].
|
| 2.
|
Bernardini, M. L.,
J. Mounier,
H. d'Hauteville,
M. Coquis-Rondon, and P. J. Sansonetti.
1989.
Identification of icsA, a plasmid locus of Shigella flexneri that governs bacterial intra- and intercellular spread through interaction with F-actin.
Proc. Natl. Acad. Sci. USA
86:3867-3871[Abstract/Free Full Text].
|
| 3.
|
Bershadsky, A. D., and J. M. Vasiliev (ed.).
1988.
Cytoskeleton.
Plenum Publishing Corp., New York, N.Y.
|
| 4.
|
Carlier, M. F.,
V. Laurent,
J. Santolini,
R. Melki,
D. Didry,
G. X. Xia,
Y. Hong,
N. H. Chua, and D. Pantaloni.
1997.
Actin depolymerizing factor (ADF/cofilin) enhances the rate of filament turnover: implication in actin-based motility.
J. Cell Biol.
136:1307-1322[Abstract/Free Full Text].
|
| 5.
|
Chakraborty, T.,
F. Ebel,
E. Domann,
K. Niebuhr,
B. Gerstel,
S. Pistor,
C. J. Temm-Grove,
B. M. Jockusch,
M. Reinhard,
U. Walter, and J. Wehland.
1995.
A focal adhesion factor directly linking intracellularly motile Listeria monocytogenes and Listeria ivanovii to the actin-based cytoskeleton of mammalian cells.
EMBO J.
14:1314-1321[Medline].
|
| 6.
|
Dabiri, G. A.,
J. M. Sanger,
D. A. Portnoy, and F. S. Southwick.
1990.
Listeria monocytogenes moves rapidly through the host-cell cytoplasm by inducing directional actin assembly.
Proc. Natl. Acad. Sci. USA
87:6068-6072[Abstract/Free Full Text].
|
| 7.
|
Dold, F. G.,
J. M. Sanger, and J. W. Sanger.
1994.
Intact alpha-actinin molecules are needed for both the assembly of actin into the tails and the locomotion of Listeria monocytogenes inside infected cells.
Cell Motil. Cytoskeleton
28:97-107[CrossRef][Medline].
|
| 8.
|
Domann, E.,
J. Wehland,
M. Rohde,
S. Pistor,
M. Hartl,
W. Goebel,
M. Leimeister-Wachter,
M. Wuenscher, and T. Chakraborty.
1992.
A novel bacterial virulence gene in Listeria monocytogenes required for host cell microfilament interaction with homology to the proline-rich region of vinculin.
EMBO J.
11:1981-1990[Medline].
|
| 9.
|
Dramsi, S., and P. Cossart.
1998.
Intracellular pathogens and the actin cytoskeleton.
Annu. Rev. Cell Dev. Biol.
14:137-166[CrossRef][Medline].
|
| 10.
|
Frischknecht, F.,
S. Cudmore,
V. Moreau,
I. Reckmann,
S. Rottger, and M. Way.
1999.
Tyrosine phosphorylation is required for actin-based motility of vaccinia but not Listeria or Shigella.
Curr. Biol.
9:89-92[CrossRef][Medline].
|
| 11.
|
Frischknecht, F.,
V. Moreau,
S. Rottger,
S. Gonfloni,
I. Reckmann,
G. Superti-Furga, and M. Way.
1999.
Actin-based motility of vaccinia virus mimics receptor tyrosine kinase signalling.
Nature
401:926-929[CrossRef][Medline].
|
| 12.
|
Gouin, E.,
H. Gantelet,
C. Egile,
I. Lasa,
H. Ohayon,
V. Villiers,
P. Gounon,
P. J. Sansonetti, and P. Cossart.
1999.
A comparative study of the actin-based motilities of the pathogenic bacteria Listeria monocytogenes, Shigella flexneri and Rickettsia conorii.
J. Cell Sci.
112:1697-1708[Abstract].
|
| 13.
|
Hackstadt, T.
1996.
The biology of rickettsiae.
Infect. Agents Dis.
5:127-143[Medline].
|
| 14.
|
Hackstadt, T.,
R. Messer,
W. Cieplak, and M. G. Peacock.
1992.
Evidence for proteolytic cleavage of the 120-kilodalton outer membrane protein of rickettsiae: identification of an avirulent mutant deficient in processing.
Infect. Immun.
60:159-165[Abstract/Free Full Text].
|
| 15.
|
Heinzen, R. A.,
S. S. Grieshaber,
L. S. Van Kirk, and C. J. Devin.
1999.
Dynamics of actin-based movement by Rickettsia rickettsii in Vero cells.
Infect. Immun.
67:4201-4207[Abstract/Free Full Text].
|
| 16.
|
Heinzen, R. A.,
S. F. Hayes,
M. G. Peacock, and T. Hackstadt.
1993.
Directional actin polymerization associated with spotted fever group rickettsia infection of Vero cells.
Infect. Immun.
61:1926-1935[Abstract/Free Full Text].
|
| 17.
|
Kadurugamuwa, J. L.,
M. Rohde,
J. Wehland, and K. N. Timmis.
1991.
Intercellular spread of Shigella flexneri through a monolayer mediated by membranous protrusions and associated with reorganization of the cytoskeletal protein vinculin.
Infect. Immun.
59:3463-3471[Abstract/Free Full Text].
|
| 18.
|
Kocks, C.,
E. Gouin,
M. Tabouret,
P. Berche,
H. Ohayon, and P. Cossart.
1992.
L. monocytogenes-induced actin assembly requires the actA gene product, a surface protein.
Cell
68:521-531[CrossRef][Medline].
|
| 19.
|
Laine, R. O.,
K. L. Phaneuf,
C. C. Cunningham,
D. Kwiatkowski,
T. Azuma, and F. S. Southwick.
1998.
Gelsolin, a protein that caps the barbed ends and severs actin filaments, enhances the actin-based motility of Listeria monocytogenes in host cells.
Infect. Immun.
66:3775-3782[Abstract/Free Full Text].
|
| 20.
|
Lasa, I.,
V. David,
E. Gouin,
J. B. Marchand, and P. Cossart.
1995.
The amino-terminal part of ActA is critical for the actin-based motility of Listeria monocytogenes; the central proline-rich region acts as a stimulator.
Mol. Microbiol.
18:425-436[CrossRef][Medline].
|
| 21.
|
Lett, M. C.,
C. Sasakawa,
N. Okada,
T. Sakai,
S. Makino,
M. Yamada,
K. Komatsu, and M. Yoshikawa.
1989.
virG, a plasmid-coded virulence gene of Shigella flexneri: identification of the VirG protein and determination of the complete coding sequence.
J. Bacteriol.
171:353-359[Abstract/Free Full Text].
|
| 22.
|
Loisel, T. P.,
R. Boujemaa,
D. Pantaloni, and M. F. Carlier.
1999.
Reconstitution of actin-based motility of Listeria and Shigella using pure proteins.
Nature
401:613-616[CrossRef][Medline].
|
| 23.
|
Luna, E. J., and A. L. Hitt.
1992.
Cytoskeleton-plasma membrane interactions.
Science
258:955-964[Abstract/Free Full Text].
|
| 24.
|
Pavalko, F. M.,
C. A. Otey, and K. Burridge.
1989.
Identification of a filamin isoform enriched at the ends of stress fibers in chicken embryo fibroblasts.
J. Cell Sci.
94:109-118[Abstract/Free Full Text].
|
| 25.
|
Pistor, S.,
T. Chakraborty,
U. Walter, and J. Wehland.
1995.
The bacterial actin nucleator protein ActA of Listeria monocytogenes contains multiple binding sites for host microfilament proteins.
Curr. Biol.
5:517-525[CrossRef][Medline].
|
| 26.
|
Prevost, M. C.,
M. Lesourd,
M. Arpin,
F. Vernel,
J. Mounier,
R. Hellio, and P. J. Sansonetti.
1992.
Unipolar reorganization of F-actin layer at bacterial division and bundling of actin filaments by plastin correlate with movement of Shigella flexneri within HeLa cells.
Infect. Immun.
60:4088-4099[Abstract/Free Full Text].
|
| 27.
|
Reinhard, M.,
K. Giehl,
K. Abel,
C. Haffner,
T. Jarchau,
V. Hoppe,
B. M. Jockusch, and U. Walter.
1995.
The proline-rich focal adhesion and microfilament protein VASP is a ligand for profilins.
EMBO J.
14:1583-1589[Medline].
|
| 28.
|
Reinhard, M.,
M. Halbrugge,
U. Scheer,
C. Wiegand,
B. M. Jockusch, and U. Walter.
1992.
The 46/50 kDa phosphoprotein VASP purified from human platelets is a novel protein associated with actin filaments and focal contacts.
EMBO J.
11:2063-2070[Medline].
|
| 29.
|
Reinhard, M.,
M. Rudiger,
B. M. Jockusch, and U. Walter.
1996.
VASP interaction with vinculin: a recurring theme of interactions with proline-rich motifs.
FEBS Lett.
399:103-107[CrossRef][Medline].
|
| 30.
|
Robbins, J. R.,
A. I. Barth,
H. Marquis,
E. L. de Hostos,
W. J. Nelson, and J. A. Theriot.
1999.
Listeria monocytogenes exploits normal host cell processes to spread from cell to cell.
J. Cell Biol.
146:1333-1350[Abstract/Free Full Text].
|
| 31.
|
Rosenblatt, J.,
B. J. Agnew,
H. Abe,
J. R. Bamburg, and T. J. Mitchison.
1997.
Xenopus actin depolymerizing factor/cofilin (XAC) is responsible for the turnover of actin filaments in Listeria monocytogenes tails.
J. Cell Biol.
136:1323-1332[Abstract/Free Full Text].
|
| 32.
|
Sanger, J. M.,
B. Mittal,
F. S. Southwick, and J. W. Sanger.
1995.
Listeria monocytogenes intracellular migration: inhibition by profilin, vitamin D-binding protein and DNase I.
Cell Motil. Cytoskeleton
30:38-49[CrossRef][Medline].
|
| 33.
|
Sechi, A. S.,
J. Wehland, and J. V. Small.
1997.
The isolated comet tail pseudopodium of Listeria monocytogenes: a tail of two actin filament populations, long and axial and short and random.
J. Cell Biol.
137:155-167[Abstract/Free Full Text].
|
| 34.
|
Silverman, D. J.
1997.
Oxidative cell injury and spotted fever group rickettsiae, p. 79-98.
In
B. Anderson, M. Bendinelli, and H. Friedman (ed.), Rickettsial infection and immunity. Plenum Publishing Corp., New York, N.Y.
|
| 35.
|
Silverman, D. J.
1984.
Rickettsia rickettsii-induced cellular injury of human vascular endothelium in vitro.
Infect. Immun.
44:545-553[Abstract/Free Full Text].
|
| 36.
|
Silverman, D. J.,
L. A. Santucci,
N. Meyers, and Z. Sekeyova.
1992.
Penetration of host cells by Rickettsia rickettsii appears to be mediated by a phospholipase of rickettsial origin.
Infect. Immun.
60:2733-2740[Abstract/Free Full Text].
|
| 37.
|
Silverman, D. J.,
C. L. Wisseman, Jr., and A. Waddell.
1980.
In vitro studies of Rickettsia-host cell interactions: ultrastructural study of Rickettsia prowazekii-infected chicken embryo fibroblasts.
Infect. Immun.
29:778-790[Abstract/Free Full Text].
|
| 38.
|
Smith, G. A.,
J. A. Theriot, and D. A. Portnoy.
1996.
The tandem repeat domain in the Listeria monocytogenes ActA protein controls the rate of actin-based motility, the percentage of moving bacteria, and the localization of vasodilator-stimulated phosphoprotein and profilin.
J. Cell Biol.
135:647-660[Abstract/Free Full Text].
|
| 39.
|
Temm-Grove, C. J.,
B. M. Jockusch,
M. Rohde,
K. Niebuhr,
T. Chakraborty, and J. Wehland.
1994.
Exploitation of microfilament proteins by Listeria monocytogenes: microvillus-like composition of the comet tails and vectorial spreading in polarized epithelial sheets.
J. Cell Sci.
107:2951-2960[Abstract].
|
| 40.
|
Teysseire, N.,
J. A. Boudier, and D. Raoult.
1995.
Rickettsia conorii entry into Vero cells.
Infect. Immun.
63:366-374[Abstract/Free Full Text].
|
| 41.
|
Theriot, J. A.
1997.
Accelerating on a treadmill: ADF/cofilin promotes rapid actin filament turnover in the dynamic cytoskeleton.
J. Cell Biol.
136:1165-1168[Free Full Text].
|
| 42.
|
Theriot, J. A.,
J. Rosenblatt,
D. A. Portnoy,
P. J. Goldschmidt-Clermont, and T. J. Mitchison.
1994.
Involvement of profilin in the actin-based motility of L. monocytogenes in cells and in cell-free extracts.
Cell
76:505-517[CrossRef][Medline].
|
| 43.
|
Tilney, L. G.,
P. S. Connelly, and D. A. Portnoy.
1990.
Actin filament nucleation by the bacterial pathogen, Listeria monocytogenes.
J. Cell Biol.
111:2979-2988[Abstract/Free Full Text].
|
| 44.
|
Tilney, L. G.,
D. J. DeRosier,
A. Weber, and M. S. Tilney.
1992.
How Listeria exploits host cell actin to form its own cytoskeleton. II. Nucleation, actin filament polarity, filament assembly, and evidence for a pointed end capper.
J. Cell Biol.
118:83-93[Abstract/Free Full Text].
|
| 45.
|
Tilney, L. G., and D. A. Portnoy.
1989.
Actin filaments and the growth, movement, and spread of the intracellular bacterial parasite, Listeria monocytogenes.
J. Cell Biol.
109:1597-1608[Abstract/Free Full Text].
|
| 46.
|
Tilney, L. G., and M. S. Tilney.
1994.
Methods to visualize actin polymerization associated with bacterial invasion.
Methods Enzymol.
236:476-481[Medline].
|
| 47.
|
Walker, D. H.
1989.
Rocky Mountain spotted fever: a disease in need of microbiological concern.
Clin. Microbiol. Rev.
2:227-240[Abstract/Free Full Text].
|
| 48.
|
Walker, T. S.
1984.
Rickettsial interactions with human endothelial cells in vitro: adherence and entry.
Infect. Immun.
44:205-210[Abstract/Free Full Text].
|
| 49.
|
Walker, T. S., and H. H. Winkler.
1978.
Penetration of cultured mouse fibroblasts (L cells) by Rickettsia prowazeki.
Infect. Immun.
22:200-208[Abstract/Free Full Text].
|
| 50.
|
Way, M.
1998.
Interaction of vaccinia virus with the actin cytoskeleton.
Folia Microbiol.
43:305-310.
|
| 51.
|
Welch, M. D.,
J. Rosenblatt,
J. Skoble,
D. A. Portnoy, and T. J. Mitchison.
1998.
Interaction of human Arp2/3 complex and the Listeria monocytogenes ActA protein in actin filament nucleation.
Science
281:105-108[Abstract/Free Full Text].
|
| 52.
|
Winkler, H. H., and E. T. Miller.
1982.
Phospholipase A and the interaction of Rickettsia prowazekii and mouse fibroblast L-929 cells.
Infect. Immun.
38:109-113[Abstract/Free Full Text].
|
Infection and Immunity, August 2000, p. 4706-4713, Vol. 68, No. 8
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Shenoy, V. B., Tambe, D. T., Prasad, A., Theriot, J. A.
(2007). A kinematic description of the trajectories of Listeria monocytogenes propelled by actin comet tails. Proc. Natl. Acad. Sci. USA
104: 8229-8234
[Abstract]
[Full Text]
-
VALBUENA, G., WALKER, D. H.
(2004). EFFECT OF BLOCKING THE CXCL9/10-CXCR3 CHEMOKINE SYSTEM IN THE OUTCOME OF ENDOTHELIAL-TARGET RICKETTSIAL INFECTIONS. Am J Trop Med Hyg
71: 393-399
[Abstract]
[Full Text]
-
McLeod, M. P., Qin, X., Karpathy, S. E., Gioia, J., Highlander, S. K., Fox, G. E., McNeill, T. Z., Jiang, H., Muzny, D., Jacob, L. S., Hawes, A. C., Sodergren, E., Gill, R., Hume, J., Morgan, M., Fan, G., Amin, A. G., Gibbs, R. A., Hong, C., Yu, X.-j., Walker, D. H., Weinstock, G. M.
(2004). Complete Genome Sequence of Rickettsia typhi and Comparison with Sequences of Other Rickettsiae. J. Bacteriol.
186: 5842-5855
[Abstract]
[Full Text]
-
Drevets, D. A., Leenen, P. J. M., Greenfield, R. A.
(2004). Invasion of the Central Nervous System by Intracellular Bacteria. Clin. Microbiol. Rev.
17: 323-347
[Abstract]
[Full Text]
-
Stamm, L. M., Morisaki, J. H., Gao, L.-Y., Jeng, R. L., McDonald, K. L., Roth, R., Takeshita, S., Heuser, J., Welch, M. D., Brown, E. J.
(2003). Mycobacterium marinum Escapes from Phagosomes and Is Propelled by Actin-based Motility. JEM
198: 1361-1368
[Abstract]
[Full Text]
-
Macaluso, K. R., Mulenga, A., Simser, J. A., Azad, A. F.
(2003). Differential Expression of Genes in Uninfected and Rickettsia-Infected Dermacentor variabilis Ticks as Assessed by Differential-Display PCR. Infect. Immun.
71: 6165-6170
[Abstract]
[Full Text]
-
Valbuena, G., Bradford, W., Walker, D. H.
(2003). Expression Analysis of the T-Cell-Targeting Chemokines CXCL9 and CXCL10 in Mice and Humans with Endothelial Infections Caused by Rickettsiae of the Spotted Fever Group. Am. J. Pathol.
163: 1357-1369
[Abstract]
[Full Text]
-
Fehrenbacher, K., Huckaba, T., Yang, H.-C., Boldogh, I., Pon, L.
(2003). Actin comet tails, endosomes and endosymbionts. J. Exp. Biol.
206: 1977-1984
[Abstract]
[Full Text]
-
Harlander, R. S., Way, M., Ren, Q., Howe, D., Grieshaber, S. S., Heinzen, R. A.
(2003). Effects of Ectopically Expressed Neuronal Wiskott-Aldrich Syndrome Protein Domains on Rickettsia rickettsii Actin-Based Motility. Infect. Immun.
71: 1551-1556
[Abstract]
[Full Text]
-
Simser, J. A., Palmer, A. T., Fingerle, V., Wilske, B., Kurtti, T. J., Munderloh, U. G.
(2002). Rickettsia monacensis sp. nov., a Spotted Fever Group Rickettsia, from Ticks (Ixodes ricinus) Collected in a European City Park. Appl. Environ. Microbiol.
68: 4559-4566
[Abstract]
[Full Text]
-
Radulovic, S., Price, P. W., Beier, M. S., Gaywee, J., Macaluso, J. A., Azad, A.
(2002). Rickettsia-Macrophage Interactions: Host Cell Responses to Rickettsia akari and Rickettsia typhi. Infect. Immun.
70: 2576-2582
[Abstract]
[Full Text]
-
Goldberg, M. B.
(2001). Actin-Based Motility of Intracellular Microbial Pathogens. Microbiol. Mol. Biol. Rev.
65: 595-626
[Abstract]
[Full Text]
-
Suzuki, T., Sasakawa, C.
(2001). Molecular Basis of the Intracellular Spreading of Shigella. Infect. Immun.
69: 5959-5966
[Full Text]