Previous Article | Next Article 
Infection and Immunity, August 2000, p. 4795-4801, Vol. 68, No. 8
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Sunlight-Induced Propagation of the Lysogenic Phage
Encoding Cholera Toxin
Shah M.
Faruque,1,*
Asadulghani,1
M. Mostafizur
Rahman,1
Matthew K.
Waldor,2 and
David A.
Sack1
Molecular Genetics Laboratory, International
Centre for Diarrhoeal Disease Research, Bangladesh, Dhaka-1000,
Bangladesh,1 and Division of Geographic
Medicine, Tupper Research Institute, New England Medical Center,
Boston, Massachusetts 021112
Received 9 February 2000/Returned for modification 17 April
2000/Accepted 8 May 2000
 |
ABSTRACT |
In toxigenic Vibrio cholerae, the cholera enterotoxin
(CT) is encoded by CTX
, a lysogenic bacteriophage. The propagation of this filamentous phage can result in the origination of new toxigenic strains. To understand the nature of possible environmental factors associated with the propagation of CTX
, we examined the effects of temperature, pH, salinity, and exposure to direct sunlight on the induction of the CTX prophage and studied the transmission of
the phage to potential recipient strains. Exposure of cultures of
CTX
lysogens to direct sunlight resulted in ~10,000-fold increases in phage titers. Variation in temperature, pH, or salinity of the
culture did not have a substantial effect on the induction of the
prophage, but these factors influenced the stability of CTX
particles. Exposure of mixed cultures of CTX
lysogens and potential
recipient strains to sunlight significantly increased both the in vitro
and in vivo (in rabbit ileal loops) transduction of the recipient
strains by CTX
. Included in these transduction experiments were two
environmental nontoxigenic (CTX
) strains of V. cholerae O139. These two O139 strains were transduced at high
efficiency by CTX
, and the phage genome integrated into the O139
host chromosome. The resulting CTX
lysogens produced biologically
active CT both in vitro and in rabbit ileal loops. This finding
suggests a possible mechanism explaining the origination of
toxigenic V. cholerae O139 strains from nontoxigenic
progenitors. This study indicates that sunlight is a significant
inducer of the CTX prophage and suggests that sunlight-induced
transmission of CTX
may constitute part of a natural mechanism for
the origination of new toxigenic strains of V. cholerae.
 |
TEXT |
Seasonal outbreaks of cholera caused
by toxigenic Vibrio cholerae strains are a major public
health problem in many developing countries. Toxigenic V. cholerae O1 and O139 strains cause disease by colonizing the human
small intestine, where they produce a potent enterotoxin, the cholera
toxin (CT), which is principally responsible for the severe watery
diarrhea characteristic of cholera (5, 23). The
ctxAB operon, which encodes the A and B subunits of CT, is
part of a larger genetic element originally termed the CTX genetic
element (22). Recent studies have shown that the CTX genetic
element corresponds to the genome of CTX
, a lysogenic filamentous
bacteriophage (28). It has been previously demonstrated that
naturally occurring strains of toxigenic V. cholerae produce high titers of the phage following exposure to the DNA-damaging agent
mitomycin C, and cell-free phage particles can infect and convert
susceptible nontoxigenic V. cholerae strains into toxigenic strains (6, 7). Similar to other temperate phages, the CTX prophage can also be induced by exposure to UV irradiation under laboratory conditions. However, no studies have been conducted so far
to identify possible natural factors associated with the induction and
propagation of CTX
.
Although toxigenic V. cholerae bacteria are human pathogens,
the species can persist in the aquatic environment in the absence of
human hosts. Therefore, the ecology of V. cholerae appears to involve both environmental and human host components (2, 5). During survival in the aquatic environment, the physiological state of V. cholerae is not well understood but is
presumably influenced by various parameters, including sunlight,
temperature, pH, and salinity (19, 25). It is not clear
whether these factors can also result in the induction of CTX prophages
in toxigenic V. cholerae and hence promote the transmission
of CTX
to nontoxigenic environmental strains, leading to the
origination of new toxigenic strains. In the present study, we examined
the effects of temperature, pH, salinity, and exposure to direct
sunlight on the induction, stability, and propagation of CTX
.
Naturally occurring toxigenic V. cholerae strains used in
the present study included 32 strains belonging to the O1, O139, and
non-O1 non-O139 serogroups, and the strains were isolated from cholera
patients or environmental surface water in Bangladesh (see Table 3).
The nontoxigenic V. cholerae strains used in the transduction studies or as controls included two O139 strains and three
El Tor strains isolated in Bangladesh or India. The genetically marked
phage IG-Km
was a derivative of CTX
into which a kanamycin
resistance (Kmr) determinant was introduced into an
intergenic NotI site (16). Strain ASF-1 carried a
chromosomally integrated copy of the IG-Km
genome and was
constructed by lysogenic conversion of CT-negative V. cholerae O1 El Tor strain SA-317 with IG-Km
. Strain SM44 was a
derivative of toxigenic El Tor strain P27459 in which the CTX element
was marked with a Kmr determinant (10). The
genetically marked phage CTX-Km
was derived from strain SM44 as
described previously (6, 7, 28). Properties of the control
bacterial strains and phages used in this study are presented in Table
1.
The gene probe used in this study to detect the CTX
genome was a
0.5-kb EcoRI fragment of pCVD27 (6, 12).
Strand-specific oligonucleotide probes with the sequences
5'TCTATCTCTGTAGCCCCTATTACG and
5'CTCAGACGGGATTTGTTAGGCACG, for probing the plus and minus strands, respectively, were also used to detect the presence of single-stranded DNA of CTX
and to distinguish between the
replicative-form (RF) double-stranded DNA and single-stranded
phage DNA in crude preparations. The O139-specific probe was a 1.3-kb
EcoRI fragment of pCRII-A3 (21, 29). The
nontoxigenic O139 strains were also tested for the presence of genes
encoding toxin-coregulated pilus (TCP), which is the receptor for
CTX
, the virulence regulatory gene toxR, and the CTX
attachment sequence attRS. The presence of the TCP
pathogenicity island was determined by using PCR assays specific for
the tcpA, tcpI, and acfB genes, as
described previously (7, 14). The toxR gene probe
was a 2.4-kb BamHI fragment of pVM7 (20), and the
18-bp attRS sequence was identified using a synthetic
oligonucleotide corresponding to the attRS sequence (10). Colony blots or Southern blots were prepared using
nylon filters (Hybond; Amersham International plc, Aylesbury, United Kingdom) and processed by standard methods (18). The
polynucleotide probes were labeled by random priming
(9) using a random primer DNA labeling kit (Bethesda
Research Laboratories, Gaithersburg, Md.) and
[
-32P]dCTP (3,000 Ci/mmol; Amersham). Oligonucleotide
probes were labeled by 3' tailing using terminal deoxynucleotide
transferase and [
-32P]dCTP (Amersham). Southern
blots and colony blots were hybridized with the labeled probes
and autoradiographed as described previously (6, 7).
All strains tested for induction by sunlight were grown in Luria broth
(LB) at 37°C to an absorbance at 540 nm (A540)
of 0.2. The cells were collected by centrifugation, washed, and
resuspended in fresh LB. Five milliliters of the suspension, containing
approximately 5 × 104 bacterial cells, was spread on
a sterile petri dish and exposed to direct sunlight for a specified
time (30 to 45 min). The intensity of the light was measured using a
digital light meter (VWR Scientific, South Plainfield, N.J.). Control
plates were kept under normal light in a shaded area during the same
time period. The treated cells were inoculated into test flasks
containing 50 ml of fresh LB. All flasks were incubated at 37°C with
shaking, and aliquots of culture were periodically removed and analyzed
for the presence of extracellular CTX
using previously described
methods (6, 7). Briefly, to detect Kmr
determinant-labeled CTX
particles derived from strains SM44 and
ASF-1, the culture supernatant was sterilized by filtration through
0.22-µm-pore-size filters (Millipore Corp., Bedford, Mass.), and the
filtrate was titrated for infectious phage particles by incubating
aliquots of the supernatant with the classical strain RV508 and then
selecting for colonies resistant to kanamycin (50 µg/ml). To detect
the induction of the CTX prophage in wild-type strains, preparations of
the culture supernatants containing CTX
DNA were identified by
Southern blot hybridization using specific probes, as described
previously (6). Aliquots of LB mixed with serial dilutions
of IG-Km
(10 to 104 particles/ml) isolated from
supernatants of O395(pIG-Km) were used as positive controls to test the
detection limit of the hybridization assay. An aliquot of the culture
obtained for the phage assay was also diluted and plated to determine
the number of viable cells.
To study the effects of pH, NaCl concentration (salinity), and
temperature on the induction of CTX prophage, a series of test flasks
containing LB was adjusted to different pHs (6.5, 7.5, 8.0, and 8.5),
salinity levels (0.5 to 2.0%, in increments of 0.5%), or combinations
of different pHs and salinities. Series of flasks containing 50 ml of
LB with defined pH and salinity were inoculated with 5 × 104 cells of strain SM44 and incubated at four different
temperatures, 25, 30, 37, or 40°C, with shaking. The induction of the
prophage was monitored by periodically examining aliquots of culture
supernatants for the presence of CTX-Km
during the following 12 h, as described above.
To examine the stability of CTX
under different conditions of
temperature, pH, and salinity, CTX-Km
isolated from a culture of
O395(pCTX-Km) was used. Approximately 5 × 106 phage
particles were inoculated into a series of test tubes containing 5 ml
of LB adjusted to a predefined pH and salinity. Control tubes containing normal saline or distilled water were also inoculated. The
tubes were stored at different temperatures, and aliquots of the medium
(100 µl) were periodically removed and analyzed for remaining
infectious CTX-Km
particles. The Kmr colonies were
counted and stability of the phage was expressed as the percentage of
initial inoculum of infectious phage particles. Initially, stability
was examined at room temperature at three different pHs (6.0, 7.0, and
8.0) and salinity levels (0.05, 0.5, and 1.0%), as well as at
combinations of these two parameters. Later, more elaborate
examinations of the effect of pH (2.0 to 12.0) at a salinity of 0.5%
and that of salinity (0.05 to 1.5%) at pH 8.0 on the stability of
CTX
were performed. The effect of temperature (4, 25, 30, 37, 40, and 45°C) on the stability of CTX
was examined at pH 8.0 and 0.5% salinity.
Transduction of recipient strains by CTX
was assayed using two
different donor strains, SM44 and ASF-1, and three different recipient
strains, including a tetracycline-resistant classical biotype strain,
AE-2883, and two nontoxigenic O139 strains, AOE12-39 and Env-99 (Table
1). The donor and recipient strains were grown separately, washed, and
resuspended in fresh LB (for the classical strain) or AKI medium (for
the O139 strains). Approximately 2.5 × 104 cells of
the donor or the recipient strain were mixed in 5 ml of LB or AKI
medium and exposed to direct sunlight (~42,000 lx) for 30 min. For
the in vitro assay, 1 ml of the exposed cell suspension was inoculated
into 50 ml of the same medium and incubated at 30°C for 16 h.
Aliquots of the culture were analyzed for transduction of the recipient
strain by using either appropriate antibiotics or DNA probes. In order
to detect transduction of recipient strain AE-2883, dilutions of the
culture were plated on Luria agar plates containing kanamycin (50 µg/ml) and tetracycline (20 µg/ml). To detect the transduction of
the nontoxigenic O139 strains, dilutions of the mixed culture were
grown on kanamycin plates, and colony blots prepared from the plates
were hybridized with the O139-specific DNA probe to detect
Kmr O139 derivatives.
For the in vivo assays, 1-ml aliquots of the sunlight-treated cells
were inoculated into the ileal loops of adult New Zealand White rabbits
obtained from the breeding facility of the Animal Resources Branch of
the International Centre for Diarrhoeal Disease Research, Bangladesh
(ICDDR,B), and prepared as described previously (4). After
16 h, the rabbits were sacrificed and contents of the ileal loops
were collected. The inside of the loops was washed out with 1 ml of 10 mM phosphate-buffered saline (pH 7.4) and collected in the same tube.
Dilutions of the ileal loop fluids were analyzed by plating on
appropriate antibiotic plates and using DNA probes. The ratio of
Kmr-transduced colonies to total number of colonies derived
from the recipient strain was calculated and expressed as the
percentage of recipient cells carrying the phage genome.
Representative colonies were picked, grown in LB containing
kanamycin (50 µg/ml), and further analyzed for the presence of the
phage genome. Total DNA or plasmid DNA was extracted from overnight cultures by standard methods (18) and
purified using microcentrifuge filter units
(Ultrafree-Probind; Sigma). Integration of the phage genome
into the chromosome of the recipient cells was studied by comparative
Southern blot analysis of total DNA and plasmid preparations from
infected and native strains (7). The ability of the CTX
lysogens derived from parental nontoxigenic O139 strains to produce CT
was determined by the GM1 ganglioside-dependent enzyme-linked immunosorbent assay and the rabbit ileal loop assay, as
described previously (4, 24).
Induction of CTX prophage by sunlight.
Two strains, SM44 and
ASF-1, harboring Kmr determinant-marked CTX prophages were
initially used to study parameters influencing prophage induction.
CTX
does not form plaques, and genetically marked prophages allow
quantification of the number of phage particles secreted in
supernatants via transduction assays (6, 7, 28). Initially,
a large number of individual colonies of strains SM44 and ASF-1 were
picked and tested separately for the production of
Kmr-transducing particles. Most colonies tested either were
negative or produced a very small number of phage particles (between 5 and 127 particles per ml) when grown without artificial
induction. The number of spontaneous CTX
-transducing
particles produced by SM44 or ASF-1 was significantly lower than the
titers previously reported for two other CTX
lysogens
(15). Presumably, this reflects strain differences.
To examine the effect of sunlight on the induction of CTX prophages in
SM44 and ASF-1, we selected colonies that spontaneously produced a
small number of phage particles (<50/ml). No significant difference in
the CTX-Km
transducing activity of the culture supernatants was
noted when the pH, salinity, or temperature of the cultures was varied.
However, when the cultures were exposed to direct sunlight (mean
intensity of 42,000 lx) for 30 min prior to incubation, the number of
phage particles increased more than 10,000-fold (Table
2). No increase was noted in control
cultures which were stored in a well-lighted area (average of 3,180 lx) but away from direct sunshine. This showed that direct sunlight is a
significant natural inducer of the CTX prophage. Examination of the
production of phage particles in sunlight-induced cultures at different
stages of cell growth showed a steady increase of phage particles for
nearly 6 h. This was followed by a sharp decline which
corresponded to the stationary phase of the culture (Fig. 1). These findings are in agreement with
a previous report (15) that infectious CTX
particles are
rapidly inactivated during the stationary phase of a culture by a
secreted CTX
-destroying factor identified as the hemagglutinin
protease of V. cholerae. We confirmed that the rapid decline
in CTX
titers in stationary-phase cultures of SM44 and ASF-1 was
secondary to CTX
-destroying factor activity (data not shown).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Sunlight-induced production of extracellular CTX
particles by genetically marked strains of V. cholerae
carrying a kanamycin-resistant determinant in the CTX genome
|
|

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
Kinetics of cell growth and production of extracellular
CTX particles by strain SM44 induced with exposure to direct
sunlight (42,000 lx) for 30 min. Values are the averages of five
different observations.
|
|
CTX
was detectable in culture supernatants from 25 of 32 wild-type
(nonmarked) strains induced with sunlight (Table
3) by Southern blot hybridization using a
plus strand-specific oligonucleotide probe (Fig.
2). The bands corresponding to the
single-stranded phage DNA were absent in 30 of 32 preparations derived
from supernatants of wild-type strains grown without sunlight
induction. In control assays, approximately 2 × 102
transducing particles per ml produced a visible band. Thus, some of
these wild-type strains may have produced a small number of phage
particles during normal growth that was below this level of detection.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Analysis of naturally occurring toxigenic V. cholerae strains of environmental or clinical origin for
sunlight-induced production of extracellular CTX
|
|

View larger version (99K):
[in this window]
[in a new window]
|
FIG. 2.
Supernatant fluids of toxigenic V. cholerae
strains, exposed to direct sunlight (42,000 lx) for 30 min and
subsequently grown for 5 h, were sterilized by filtration through
a 0.22-µm-pore-size filter and were used to precipitate possible
bacteriophage particles. The precipitates were dissolved in appropriate
buffer and treated with DNase I and RNase A to remove contaminating
exogenous DNA or RNA. Total phage nucleic acids were isolated as
described in the text and analyzed using the ctxA probe.
Lanes 1, 3, 5, and 7 contain phage DNA preparations from four toxigenic
strains grown without exposure to sunlight, whereas lanes 2, 4, 6, and
8 contain phage DNA preparations derived from the corresponding
sunlight-induced cultures. Lane 9 contains phage DNA preparations from
approximately 3 × 102 IG-Km particles added to LB
and used as a control. Numbers indicating molecular sizes of bands
correspond to a supercoiled DNA ladder (Bethesda Research
Laboratories).
|
|
The duration of sunlight exposure as well as the intensity of sunlight
had a significant effect on both phage titer and viable cell number.
The effect of sunlight was roughly proportional to the product of light
intensity and duration of exposure. Exposure to sunlight resulted in
cell death, but phage production by the surviving cells was increased.
For example, immediately after exposure to sunlight at an average
intensity of 42,000 lx for 30 min, the viable cell count was reduced by
approximately 6%, and the total phage production by the surviving
cells increased more than 20-fold (Fig. 1).
The CTX
genome is comprised of a core region and an RS2 region
(30). With the exception of ctxAB, the genes of
the core region are thought to be essential for morphogenesis of CTX
particles and hence for its propagation as an infectious phage. The
open reading frames in RS2, rstR, rstA, and
rstB, encode a repressor (RstR) as well as products required
for the replication and integration of CTX
(30). In
lysogens, RstR is thought to repress transcription of rstA,
a gene required for CTX
replication. Our data suggest that RstR
repressor function is probably inactivated by direct sunlight.
Inactivation of RstR presumably leads to the expression of
rstA and thereby allows the CTX prophage to enter into a
replicative pathway. To begin to address this possibility, we examined
the sunlight-exposed cells for the presence of CTX
RF DNA. This was accomplished by hybridizing plasmid preparations with a minus strand-specific oligonucleotide probe which would not hybridize with
the plus strand found in the CTX
genome. The CTX
RF DNA was
detectable in Southern blots of plasmids prepared from sunlight-exposed cells and not from unexposed cells (data not shown). This suggests that
the sunlight-induced increases in phage production in strains carrying
the CTX prophage were preceded by and mediated by production of the RF
DNA of CTX
. This is further supported by the observation that phage
titers in the culture supernatants of strain SA-406(pCTX-Km), which
carried the RF of the phage genome, did not increase substantially after the culture was exposed to sunlight (Table 2). High titers of the
phage were detected in the supernatants from cultures of this strain,
irrespective of whether the cells were exposed to sunlight or kept in
the shade. However, further studies are required to investigate the
detailed molecular mechanisms associated with sunlight-mediated
induction of the CTX prophage.
Stability of CTX
.
The effects of temperature, pH, and
salinity on the stability of CTX-Km
were assessed by adding a
defined number of phage particles into medium adjusted to different
conditions of salinity and pH or into normal saline. The titers of
CTX-Km
transducing particles remaining after 12 h, expressed as
a percentage of the original titer, are shown in Fig.
3. Phage particles remained infectious
for more than 4 weeks when stored at room temperature in normal saline
or in LB containing a minimum of 0.5% NaCl. The transducing phages
were fairly stable over a pH range between 4.0 and 10.0 (Fig. 3). At
temperatures above 37°C or at a salinity below 0.1%, the majority of
the transducing particles were inactivated. These findings suggest that
phage particles may persist in the aquatic environment as infectious
agents, depending on these and possibly other parameters.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of temperature, pH, and salinity on the
stability of CTX , assayed after 12 h of incubation in LB
adjusted to different pHs or salinity levels, using the genetically
marked phage CTX-Km (see text for details). The effect of salinity
was assayed at pH 8.0 and that of pH was assayed at a salinity of 0.5%
at room temperature. The effect of temperature was measured at pH 8.0 and a salinity of 0.5%. Values are the averages of three independent
observations.
|
|
Transmission of CTX
.
We examined the transfer of CTX
between strains when mixed cultures of potential donor and recipient
strains were exposed to sunlight. Transduction of the Kmr
determinant-marked CTX prophages carried by strains SM44 and ASF-1 was
monitored by transfer of kanamycin resistance to the recipient strains.
One recipient, AE-2883, could be differentiated from the donor strains
by its resistance to tetracycline, whereas the other two strains were
of the O139 serogroup and could be differentiated from the donor
strains by using an O139-specific probe. Transduction was assayed both
under in vitro laboratory conditions and in vivo inside the ileal loops
of adult rabbits. Previous investigators have used infant mice to study
in vivo transfer of CTX
, but we found that the rabbit ileal loop
model is also useful for in vivo CTX
transduction assays. Sunlight exposure significantly increased in vitro transduction of the recipient
strains. When the mixed cultures were exposed to sunlight, the number
of transductants was more than 20-fold higher than the number obtained
in the absence of sunlight (Table 4). The overall transduction efficiency was higher in the rabbit ileal loops
than in vitro, and the in vivo efficiency increased further when the
mixed cultures were exposed to sunlight prior to inoculation in rabbits
(Table 4). TCP, the receptor for CTX
, is known to be expressed more
adequately in vivo (17). Since the induction studies clearly
showed a marked increase in extracellular CTX
, it is most likely
that in addition to adequate expression of TCP, the increased
efficiency of CTX
transduction in vivo was due to the availability
of high titers of transducing particles in the inoculum which was
preexposed to sunlight.
View this table:
[in this window]
[in a new window]
|
TABLE 4.
Transduction of V. cholerae strains by CTX
derived from sunlight-treated lysogens carrying genetically marked
CTX prophages
|
|
The origin of strains belonging to the newly emerged epidemic serogroup
O139 has been investigated in several previous studies (1, 3, 8,
26, 29). These studies suggested that the O139 serogroup probably
originated from a toxigenic strain of the El Tor biotype by changes in
the genes determining the serogroup antigen. In the present study, two
nontoxigenic O139 strains were transduced by a genetically marked
phage, IG-Km
, which carried a functional ctxAB operon.
Subsequent analysis of the transductants showed that the phage genome
integrated into the O139 chromosome, forming stable lysogens. These
lysogens of the O139 strains were tested for production of CT and were
found to produce high levels of biologically active CT (Table
5). Thus, we demonstrated the lysogenic
conversion of two nontoxigenic O139 strains into toxigenic derivatives,
and this process was significantly enhanced by sunlight (Table 4).
Although we have previously demonstrated lysogenic conversion of
nontoxigenic O1 El Tor strains by CTX
, this is the first
demonstration of the origination of toxigenic O139 strains from
nontoxigenic progenitors. Thus, lysogenic conversion may constitute an
alternative mechanism for the emergence of epidemic O139 strains from
nontoxigenic progenitors in the environment.
Environmental factors in the emergence of epidemic strains.
Species of the genus Vibrio have been regarded as a group of
organisms whose major habitats are aquatic ecosystems (2). It has been suggested that acquisition of virulence-associated genes,
particularly those encoding intestinal colonization factors and
enterotoxins, has allowed specific vibrios to adapt to the human
intestinal environment (5, 13). The genes for the major enterotoxin, ctxAB, reside in the genome of CTX
, and the
propagation of this phage is assumed to be associated with the
horizontal transmission of genes encoding CT. In the present study, we
demonstrated the conversion of nontoxigenic O139 strains into toxigenic
derivatives. These strains were also positive for genes encoding the
intestinal colonization factor and CTX
receptor, TCP, and the
virulence regulatory gene toxR, involved in the expression
of both TCP and CT, which are the major virulence factors found in
epidemic strains (11).
Since it does not appear that CTX
lysogens often spontaneously
produce high titers of CTX
particles, efficient propagation of this
phage under natural conditions may be mediated by environmental factors
which result in the induction of CTX prophages and the persistence of
free CTX
particles in aquatic environments. In the present study, we
showed that the CTX prophage is induced by sunlight. The stability of
the phage is favored at a salinity above 0.5%, temperatures below
37°C, and a pH range of 5.0 to 10.0. In most countries in which
cholera is endemic, substantial fluctuations in water temperature and
salinity may occur between the dry and wet seasons, or between winter
and summer. It would be interesting to study whether these fluctuating
environmental conditions induce CTX prophages and influence the
stability of CTX
particles. Furthermore, since cholera outbreaks in
these areas also occur in a seasonal pattern, it is possible that these changes in environmental conditions play a role in initiation of
cholera epidemics caused by new strains of toxigenic V. cholerae. The full array of factors associated with the
propagation of CTX
in natural environments where V. cholerae can survive have yet to be elucidated. Our efforts are at
present directed towards understanding the transmission of the CTX
phage in the aquatic environment and its possible relationship with the
emergence of seasonal epidemics in areas where cholera is endemic.
 |
ACKNOWLEDGMENTS |
We thank V. I. Mathan for helpful discussion.
This research was funded in part by the United States Agency for
International Development (USAID) under grant HRN-5986-A-00-6005-00 with the ICDDR,B, and by the National Institutes of Health under grant
no. RO1 AI39129-01A1 with the Department of International Health, Johns Hopkins University, and the ICDDR,B. The ICDDR,B is
supported by countries and agencies which share its concern for
the health problems of developing countries.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Molecular
Genetics Laboratory, Laboratory Sciences Division, ICDDR,B, GPO Box
128, Dhaka-1000, Bangladesh. Phone: 880 2 8811751 to 880 2 8811760. Fax: 880 2 8812529 and 880 2 8823116. E-mail:
faruque{at}icddrb.org.
Editor:
J. T. Barbieri
 |
REFERENCES |
| 1.
|
Calia, K. E.,
M. Murtagh,
M. J. Ferraro, and S. B. Calderwood.
1994.
Comparison of Vibrio cholerae O139 with V. cholerae O1 classical and El Tor biotypes.
Infect. Immun.
62:1504-1506[Abstract/Free Full Text].
|
| 2.
|
Colwell, R. R., and W. M. Spira.
1992.
The ecology of Vibrio cholerae, p. 107-127.
In
D. Barua, and W. B. Greenough III (ed.), Cholera. Plenum Medical Book Co., New York, N.Y.
|
| 3.
|
Comstock, L. E.,
J. A. Johnson,
J. M. Michshalski,
J. G. Morris, Jr., and J. B. Kaper.
1996.
Cloning and sequencing of a region encoding a surface polysaccharide of Vibrio cholerae O139 and characterization of the insertion site in the chromosome of V. cholerae O1.
Mol. Microbiol.
19:815-826[CrossRef][Medline].
|
| 4.
|
De, S. N., and D. N. Chatterje.
1953.
An experimental study of the mechanisms of action of Vibrio cholerae on the intestinal mucous membrane.
J. Pathol. Bacteriol.
46:559-562[CrossRef].
|
| 5.
|
Faruque, S. M.,
M. J. Albert, and J. J. Mekalanos.
1998.
Epidemiology, genetics, and ecology of toxigenic Vibrio cholerae.
Microbiol. Mol. Biol. Rev.
62:1301-1314[Abstract/Free Full Text].
|
| 6.
|
Faruque, S. M.,
Asadulghani,
A. R. M. A. Alim,
M. J. Albert,
K. M. N. Islam, and J. J. Mekalanos.
1998.
Induction of the lysogenic phage encoding cholera toxin in naturally occurring strains of toxigenic Vibrio cholerae O1 and O139.
Infect. Immun.
66:3752-3757[Abstract/Free Full Text].
|
| 7.
|
Faruque, S. M.,
Asadulghani,
M. N. Saha,
A. R. M. A. Alim,
M. J. Albert,
K. M. N. Islam, and J. J. Mekalanos.
1998.
Analysis of clinical and environmental strains of nontoxigenic Vibrio cholerae for susceptibility to CTX : molecular basis for origination of new strains with epidemic potential.
Infect. Immun.
66:5819-5825[Abstract/Free Full Text].
|
| 8.
|
Faruque, S. M.,
A. R. M. A. Alim,
S. K. Roy,
F. Khan,
G. B. Nair,
R. B. Sack, and M. J. Albert.
1994.
Molecular analysis of rRNA and cholera toxin genes carried by the new epidemic strain of toxigenic Vibrio cholerae O139 synonym Bengal.
J. Clin. Microbiol.
32:1050-1053[Abstract/Free Full Text].
|
| 9.
|
Feinberg, A., and B. Volgelstein.
1984.
A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity.
Anal. Biochem.
137:266-267[CrossRef][Medline].
|
| 10.
|
Goldberg, I., and J. J. Mekalanos.
1986.
Effect of a recA mutation on cholera toxin gene amplification and deletion events.
J. Bacteriol.
165:723-731[Abstract/Free Full Text].
|
| 11.
|
Herrington, D. A.,
R. H. Hall,
G. Losonsky,
J. J. Mekalanos,
R. K. Taylor, and M. M. Levine.
1988.
Toxin, toxin-coregulated pili and ToxR regulon are essential for Vibrio cholerae pathogenesis in humans.
J. Exp. Med.
168:1487-1492[Abstract/Free Full Text].
|
| 12.
|
Kaper, J. B.,
J. G. Morris, Jr., and M. Nishibuchi.
1988.
DNA probes for pathogenic Vibrio species, p. 65-67.
In
F. C. Tenover (ed.), DNA probes for infectious diseases. CRC Press, Inc., Boca Raton, Fla.
|
| 13.
|
Karaolis, D. K. R.,
R. Lan, and P. R. Reeves.
1995.
The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae.
J. Bacteriol.
177:3191-3198[Abstract/Free Full Text].
|
| 14.
|
Keasler, S. P., and R. H. Hall.
1993.
Detection and biotyping Vibrio cholerae O1 with multiplex polymerase chain reaction.
Lancet
341:1661[CrossRef][Medline].
|
| 15.
|
Kimsey, H. H., and M. K. Waldor.
1998.
Vibrio cholerae hemagglutinin/protease inactivates CTX .
Infect. Immun.
66:4025-4029[Abstract/Free Full Text].
|
| 16.
|
Lazar, S., and M. K. Waldor.
1998.
ToxR-independent expression of cholera toxin from the replicative form of CTX .
Infect. Immun.
66:394-397[Abstract/Free Full Text].
|
| 17.
|
Lee, S. H.,
D. L. Hava,
M. K. Waldor, and A. Camilli.
1999.
Regulation and temporal expression patterns of Vibrio cholerae virulence genes during infection.
Cell
99:625-634[CrossRef][Medline].
|
| 18.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 19.
|
Miller, C. J.,
B. S. Drasar, and R. G. Feachem.
1984.
Response of toxigenic Vibrio cholerae O1 to physicochemical stresses in aquatic environments.
J. Hyg.
93:475-495.
|
| 20.
|
Miller, V. L., and J. J. Mekalanos.
1984.
Synthesis of cholera toxin is positively regulated at the transcriptional level by toxR.
Proc. Natl. Acad. Sci. USA
81:3471-3475[Abstract/Free Full Text].
|
| 21.
|
Nair, G. B.,
P. K. Bag,
T. Shimada,
T. Ramamurthy,
T. Takeda,
S. Yamamoto,
H. Kurazono, and Y. Takeda.
1995.
Evaluation of DNA probes for specific detection of Vibrio cholerae O139 Bengal.
J. Clin. Microbiol.
33:2186-2187[Abstract].
|
| 22.
|
Pearson, G. D. N.,
A. Woods,
S. L. Chiang, and J. J. Mekalanos.
1993.
CTX genetic element encodes a site-specific recombination system and an intestinal colonization factor.
Proc. Natl. Acad. Sci. USA
90:3750-3754[Abstract/Free Full Text].
|
| 23.
|
Rabbani, G. H., and W. B. Greenough.
1990.
Cholera, p. 233-253.
In
E. Lebenthal, and M. Duffy (ed.), Textbook of secretory diarrhea. Raven Press Ltd., New York, N.Y.
|
| 24.
|
Sack, D. A.,
S. Huda,
P. K. B. Neogi,
R. R. Daniel, and W. M. Spira.
1980.
Microtiter ganglioside enzyme-linked immunosorbent assay for vibrio and Escherichia coli heat-labile enterotoxins and antitoxin.
J. Clin. Microbiol.
11:35-40[Abstract/Free Full Text].
|
| 25.
|
Singleton, F. L.,
R. Attwell,
S. Jangi, and R. R. Colwell.
1982.
Effects of temperature and salinity on Vibrio cholerae growth.
Appl. Environ. Microbiol.
44:1047-1058[Abstract/Free Full Text].
|
| 26.
|
Stroeher, U. H.,
K. E. Jedani,
B. K. Dredge,
R. Morona,
M. H. Brown,
L. E. Karageorgos,
M. J. Albert, and P. A. Manning.
1995.
Genetic rearrangements in the rfb regions of Vibrio cholerae O1 and O139.
Proc. Natl. Acad. Sci. USA
92:10374-10378[Abstract/Free Full Text].
|
| 27.
|
Taylor, R. K.,
V. L. Miller,
D. B. Furlong, and J. J. Mekalanos.
1987.
Use of phoA gene fusions to identify a pilus colonization factor coordinately regulated with cholera toxin.
Proc. Natl. Acad. Sci. USA
84:2833-2837[Abstract/Free Full Text].
|
| 28.
|
Waldor, M. K., and J. J. Mekalanos.
1996.
Lysogenic conversion by a filamentous phage encoding cholera toxin.
Science
272:1910-1914[Abstract].
|
| 29.
|
Waldor, M. K., and J. J. Mekalanos.
1994.
Vibrio cholerae O139 specific gene sequence.
Lancet
343:1366[Medline].
|
| 30.
|
Waldor, M. K.,
E. J. Rubin,
G. D. Pearson,
H. Kimsey, and J. J. Mekalanos.
1997.
Regulation, replication, and integration functions of the Vibrio cholerae CTX are encoded by region RS2.
Mol. Microbiol.
24:917-926[CrossRef][Medline].
|
Infection and Immunity, August 2000, p. 4795-4801, Vol. 68, No. 8
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Faruque, S. M., Naser, I. B., Islam, M. J., Faruque, A. S. G., Ghosh, A. N., Nair, G. B., Sack, D. A., Mekalanos, J. J.
(2005). Seasonal epidemics of cholera inversely correlate with the prevalence of environmental cholera phages. Proc. Natl. Acad. Sci. USA
102: 1702-1707
[Abstract]
[Full Text]
-
Breitbart, M., Wegley, L., Leeds, S., Schoenfeld, T., Rohwer, F.
(2004). Phage Community Dynamics in Hot Springs. Appl. Environ. Microbiol.
70: 1633-1640
[Abstract]
[Full Text]
-
Faruque, S. M., Chowdhury, N., Khan, R., Hasan, M. R., Nahar, J., Islam, M. J., Yamasaki, S., Ghosh, A. N., Nair, G. B., Sack, D. A.
(2003). Shigella dysenteriae Type 1-Specific Bacteriophage from Environmental Waters in Bangladesh. Appl. Environ. Microbiol.
69: 7028-7031
[Abstract]
[Full Text]
-
Jiang, S., Chu, W., Fu, W.
(2003). Prevalence of Cholera Toxin Genes (ctxA and zot) among Non-O1/O139 Vibrio cholerae Strains from Newport Bay, California. Appl. Environ. Microbiol.
69: 7541-7544
[Abstract]
[Full Text]
-
Li, M., Kotetishvili, M., Chen, Y., Sozhamannan, S.
(2003). Comparative Genomic Analyses of the Vibrio Pathogenicity Island and Cholera Toxin Prophage Regions in Nonepidemic Serogroup Strains of Vibrio cholerae. Appl. Environ. Microbiol.
69: 1728-1738
[Abstract]
[Full Text]
-
Faruque, S. M., Kamruzzaman, M., Asadulghani, , Sack, D. A., Mekalanos, J. J., Nair, G. B.
(2003). CTXPhi -independent production of the RS1 satellite phage by Vibriocholerae. Proc. Natl. Acad. Sci. USA
100: 1280-1285
[Abstract]
[Full Text]
-
Lipp, E. K., Huq, A., Colwell, R. R.
(2002). Effects of Global Climate on Infectious Disease: the Cholera Model. Clin. Microbiol. Rev.
15: 757-770
[Abstract]
[Full Text]
-
Zo, Y.-G., Rivera, I. N. G., Russek-Cohen, E., Islam, M. S., Siddique, A. K., Yunus, M., Sack, R. B., Huq, A., Colwell, R. R.
(2002). Genomic profiles of clinical and environmental isolates of Vibrio cholerae O1 in cholera-endemic areas of Bangladesh. Proc. Natl. Acad. Sci. USA
99: 12409-12414
[Abstract]
[Full Text]
-
Faruque, S. M., Asadulghani, , Kamruzzaman, M., Nandi, R. K., Ghosh, A. N., Nair, G. B., Mekalanos, J. J., Sack, D. A.
(2002). RS1 Element of Vibrio cholerae Can Propagate Horizontally as a Filamentous Phage Exploiting the Morphogenesis Genes of CTX{Phi}. Infect. Immun.
70: 163-170
[Abstract]
[Full Text]
-
Mukhopadhyay, A. K., Chakraborty, S., Takeda, Y., Nair, G. B., Berg, D. E.
(2001). Characterization of VPI Pathogenicity Island and CTX{phi} Prophage in Environmental Strains of Vibrio cholerae. J. Bacteriol.
183: 4737-4746
[Abstract]
[Full Text]