TEXT

Top Abstract Text References

Seasonal outbreaks of cholera caused by toxigenic Vibrio cholerae strains are a major public health problem in many developing countries. Toxigenic V. cholerae O1 and O139 strains cause disease by colonizing the human small intestine, where they produce a potent enterotoxin, the cholera toxin (CT), which is principally responsible for the severe watery diarrhea characteristic of cholera (5, 23). The ctxAB operon, which encodes the A and B subunits of CT, is part of a larger genetic element originally termed the CTX genetic element (22). Recent studies have shown that the CTX genetic element corresponds to the genome of CTX, a lysogenic filamentous bacteriophage (28). It has been previously demonstrated that naturally occurring strains of toxigenic V. cholerae produce high titers of the phage following exposure to the DNA-damaging agent mitomycin C, and cell-free phage particles can infect and convert susceptible nontoxigenic V. cholerae strains into toxigenic strains (6, 7). Similar to other temperate phages, the CTX prophage can also be induced by exposure to UV irradiation under laboratory conditions. However, no studies have been conducted so far to identify possible natural factors associated with the induction and propagation of CTX.

Although toxigenic V. cholerae bacteria are human pathogens, the species can persist in the aquatic environment in the absence of human hosts. Therefore, the ecology of V. cholerae appears to involve both environmental and human host components (2, 5). During survival in the aquatic environment, the physiological state of V. cholerae is not well understood but is presumably influenced by various parameters, including sunlight, temperature, pH, and salinity (19, 25). It is not clear whether these factors can also result in the induction of CTX prophages in toxigenic V. cholerae and hence promote the transmission of CTX to nontoxigenic environmental strains, leading to the origination of new toxigenic strains. In the present study, we examined the effects of temperature, pH, salinity, and exposure to direct sunlight on the induction, stability, and propagation of CTX.

Naturally occurring toxigenic V. cholerae strains used in the present study included 32 strains belonging to the O1, O139, and non-O1 non-O139 serogroups, and the strains were isolated from cholera patients or environmental surface water in Bangladesh (see Table 3). The nontoxigenic V. cholerae strains used in the transduction studies or as controls included two O139 strains and three El Tor strains isolated in Bangladesh or India. The genetically marked phage IG-Km was a derivative of CTX into which a kanamycin resistance (Km^r) determinant was introduced into an intergenic NotI site (16). Strain ASF-1 carried a chromosomally integrated copy of the IG-Km genome and was constructed by lysogenic conversion of CT-negative V. cholerae O1 El Tor strain SA-317 with IG-Km. Strain SM44 was a derivative of toxigenic El Tor strain P27459 in which the CTX element was marked with a Km^r determinant (10). The genetically marked phage CTX-Km was derived from strain SM44 as described previously (6, 7, 28). Properties of the control bacterial strains and phages used in this study are presented in Table 1.

The gene probe used in this study to detect the CTX genome was a 0.5-kb EcoRI fragment of pCVD27 (6, 12). Strand-specific oligonucleotide probes with the sequences 5'TCTATCTCTGTAGCCCCTATTACG and 5'CTCAGACGGGATTTGTTAGGCACG, for probing the plus and minus strands, respectively, were also used to detect the presence of single-stranded DNA of CTX and to distinguish between the replicative-form (RF) double-stranded DNA and single-stranded phage DNA in crude preparations. The O139-specific probe was a 1.3-kb EcoRI fragment of pCRII-A3 (21, 29). The nontoxigenic O139 strains were also tested for the presence of genes encoding toxin-coregulated pilus (TCP), which is the receptor for CTX, the virulence regulatory gene toxR, and the CTX attachment sequence attRS. The presence of the TCP pathogenicity island was determined by using PCR assays specific for the tcpA, tcpI, and acfB genes, as described previously (7, 14). The toxR gene probe was a 2.4-kb BamHI fragment of pVM7 (20), and the 18-bp attRS sequence was identified using a synthetic oligonucleotide corresponding to the attRS sequence (10). Colony blots or Southern blots were prepared using nylon filters (Hybond; Amersham International plc, Aylesbury, United Kingdom) and processed by standard methods (18). The polynucleotide probes were labeled by random priming (9) using a random primer DNA labeling kit (Bethesda Research Laboratories, Gaithersburg, Md.) and [-³²P]dCTP (3,000 Ci/mmol; Amersham). Oligonucleotide probes were labeled by 3' tailing using terminal deoxynucleotide transferase and [-³²P]dCTP (Amersham). Southern blots and colony blots were hybridized with the labeled probes and autoradiographed as described previously (6, 7).

All strains tested for induction by sunlight were grown in Luria broth (LB) at 37°C to an absorbance at 540 nm (A₅₄₀) of 0.2. The cells were collected by centrifugation, washed, and resuspended in fresh LB. Five milliliters of the suspension, containing approximately 5 × 10⁴ bacterial cells, was spread on a sterile petri dish and exposed to direct sunlight for a specified time (30 to 45 min). The intensity of the light was measured using a digital light meter (VWR Scientific, South Plainfield, N.J.). Control plates were kept under normal light in a shaded area during the same time period. The treated cells were inoculated into test flasks containing 50 ml of fresh LB. All flasks were incubated at 37°C with shaking, and aliquots of culture were periodically removed and analyzed for the presence of extracellular CTX using previously described methods (6, 7). Briefly, to detect Km^r determinant-labeled CTX particles derived from strains SM44 and ASF-1, the culture supernatant was sterilized by filtration through 0.22-µm-pore-size filters (Millipore Corp., Bedford, Mass.), and the filtrate was titrated for infectious phage particles by incubating aliquots of the supernatant with the classical strain RV508 and then selecting for colonies resistant to kanamycin (50 µg/ml). To detect the induction of the CTX prophage in wild-type strains, preparations of the culture supernatants containing CTX DNA were identified by Southern blot hybridization using specific probes, as described previously (6). Aliquots of LB mixed with serial dilutions of IG-Km (10 to 10⁴ particles/ml) isolated from supernatants of O395(pIG-Km) were used as positive controls to test the detection limit of the hybridization assay. An aliquot of the culture obtained for the phage assay was also diluted and plated to determine the number of viable cells.

To study the effects of pH, NaCl concentration (salinity), and temperature on the induction of CTX prophage, a series of test flasks containing LB was adjusted to different pHs (6.5, 7.5, 8.0, and 8.5), salinity levels (0.5 to 2.0%, in increments of 0.5%), or combinations of different pHs and salinities. Series of flasks containing 50 ml of LB with defined pH and salinity were inoculated with 5 × 10⁴ cells of strain SM44 and incubated at four different temperatures, 25, 30, 37, or 40°C, with shaking. The induction of the prophage was monitored by periodically examining aliquots of culture supernatants for the presence of CTX-Km during the following 12 h, as described above.

To examine the stability of CTX under different conditions of temperature, pH, and salinity, CTX-Km isolated from a culture of O395(pCTX-Km) was used. Approximately 5 × 10⁶ phage particles were inoculated into a series of test tubes containing 5 ml of LB adjusted to a predefined pH and salinity. Control tubes containing normal saline or distilled water were also inoculated. The tubes were stored at different temperatures, and aliquots of the medium (100 µl) were periodically removed and analyzed for remaining infectious CTX-Km particles. The Km^r colonies were counted and stability of the phage was expressed as the percentage of initial inoculum of infectious phage particles. Initially, stability was examined at room temperature at three different pHs (6.0, 7.0, and 8.0) and salinity levels (0.05, 0.5, and 1.0%), as well as at combinations of these two parameters. Later, more elaborate examinations of the effect of pH (2.0 to 12.0) at a salinity of 0.5% and that of salinity (0.05 to 1.5%) at pH 8.0 on the stability of CTX were performed. The effect of temperature (4, 25, 30, 37, 40, and 45°C) on the stability of CTX was examined at pH 8.0 and 0.5% salinity.

Transduction of recipient strains by CTX was assayed using two different donor strains, SM44 and ASF-1, and three different recipient strains, including a tetracycline-resistant classical biotype strain, AE-2883, and two nontoxigenic O139 strains, AOE12-39 and Env-99 (Table 1). The donor and recipient strains were grown separately, washed, and resuspended in fresh LB (for the classical strain) or AKI medium (for the O139 strains). Approximately 2.5 × 10⁴ cells of the donor or the recipient strain were mixed in 5 ml of LB or AKI medium and exposed to direct sunlight (~42,000 lx) for 30 min. For the in vitro assay, 1 ml of the exposed cell suspension was inoculated into 50 ml of the same medium and incubated at 30°C for 16 h. Aliquots of the culture were analyzed for transduction of the recipient strain by using either appropriate antibiotics or DNA probes. In order to detect transduction of recipient strain AE-2883, dilutions of the culture were plated on Luria agar plates containing kanamycin (50 µg/ml) and tetracycline (20 µg/ml). To detect the transduction of the nontoxigenic O139 strains, dilutions of the mixed culture were grown on kanamycin plates, and colony blots prepared from the plates were hybridized with the O139-specific DNA probe to detect Km^r O139 derivatives.

For the in vivo assays, 1-ml aliquots of the sunlight-treated cells were inoculated into the ileal loops of adult New Zealand White rabbits obtained from the breeding facility of the Animal Resources Branch of the International Centre for Diarrhoeal Disease Research, Bangladesh (ICDDR,B), and prepared as described previously (4). After 16 h, the rabbits were sacrificed and contents of the ileal loops were collected. The inside of the loops was washed out with 1 ml of 10 mM phosphate-buffered saline (pH 7.4) and collected in the same tube. Dilutions of the ileal loop fluids were analyzed by plating on appropriate antibiotic plates and using DNA probes. The ratio of Km^r-transduced colonies to total number of colonies derived from the recipient strain was calculated and expressed as the percentage of recipient cells carrying the phage genome.

Representative colonies were picked, grown in LB containing kanamycin (50 µg/ml), and further analyzed for the presence of the phage genome. Total DNA or plasmid DNA was extracted from overnight cultures by standard methods (18) and purified using microcentrifuge filter units (Ultrafree-Probind; Sigma). Integration of the phage genome into the chromosome of the recipient cells was studied by comparative Southern blot analysis of total DNA and plasmid preparations from infected and native strains (7). The ability of the CTX lysogens derived from parental nontoxigenic O139 strains to produce CT was determined by the G_M1 ganglioside-dependent enzyme-linked immunosorbent assay and the rabbit ileal loop assay, as described previously (4, 24).

Induction of CTX prophage by sunlight. Two strains, SM44 and ASF-1, harboring Km^r determinant-marked CTX prophages were initially used to study parameters influencing prophage induction. CTX does not form plaques, and genetically marked prophages allow quantification of the number of phage particles secreted in supernatants via transduction assays (6, 7, 28). Initially, a large number of individual colonies of strains SM44 and ASF-1 were picked and tested separately for the production of Km^r-transducing particles. Most colonies tested either were negative or produced a very small number of phage particles (between 5 and 127 particles per ml) when grown without artificial induction. The number of spontaneous CTX-transducing particles produced by SM44 or ASF-1 was significantly lower than the titers previously reported for two other CTX lysogens (15). Presumably, this reflects strain differences.

View this table: [in this window] [in a new window]   TABLE 2.   Sunlight-induced production of extracellular CTX particles by genetically marked strains of V. cholerae carrying a kanamycin-resistant determinant in the CTX genome

View larger version (19K): [in this window] [in a new window]   FIG. 1.   Kinetics of cell growth and production of extracellular CTX particles by strain SM44 induced with exposure to direct sunlight (42,000 lx) for 30 min. Values are the averages of five different observations.

View this table: [in this window] [in a new window]   TABLE 3.   Analysis of naturally occurring toxigenic V. cholerae strains of environmental or clinical origin for sunlight-induced production of extracellular CTX

View larger version (99K): [in this window] [in a new window]   FIG. 2.   Supernatant fluids of toxigenic V. cholerae strains, exposed to direct sunlight (42,000 lx) for 30 min and subsequently grown for 5 h, were sterilized by filtration through a 0.22-µm-pore-size filter and were used to precipitate possible bacteriophage particles. The precipitates were dissolved in appropriate buffer and treated with DNase I and RNase A to remove contaminating exogenous DNA or RNA. Total phage nucleic acids were isolated as described in the text and analyzed using the ctxA probe. Lanes 1, 3, 5, and 7 contain phage DNA preparations from four toxigenic strains grown without exposure to sunlight, whereas lanes 2, 4, 6, and 8 contain phage DNA preparations derived from the corresponding sunlight-induced cultures. Lane 9 contains phage DNA preparations from approximately 3 × 102 IG-Km particles added to LB and used as a control. Numbers indicating molecular sizes of bands correspond to a supercoiled DNA ladder (Bethesda Research Laboratories).

Stability of CTX. The effects of temperature, pH, and salinity on the stability of CTX-Km were assessed by adding a defined number of phage particles into medium adjusted to different conditions of salinity and pH or into normal saline. The titers of CTX-Km transducing particles remaining after 12 h, expressed as a percentage of the original titer, are shown in Fig. 3. Phage particles remained infectious for more than 4 weeks when stored at room temperature in normal saline or in LB containing a minimum of 0.5% NaCl. The transducing phages were fairly stable over a pH range between 4.0 and 10.0 (Fig. 3). At temperatures above 37°C or at a salinity below 0.1%, the majority of the transducing particles were inactivated. These findings suggest that phage particles may persist in the aquatic environment as infectious agents, depending on these and possibly other parameters.

View larger version (47K): [in this window] [in a new window]   FIG. 3.   Effects of temperature, pH, and salinity on the stability of CTX, assayed after 12 h of incubation in LB adjusted to different pHs or salinity levels, using the genetically marked phage CTX-Km (see text for details). The effect of salinity was assayed at pH 8.0 and that of pH was assayed at a salinity of 0.5% at room temperature. The effect of temperature was measured at pH 8.0 and a salinity of 0.5%. Values are the averages of three independent observations.

Transmission of CTX. We examined the transfer of CTX between strains when mixed cultures of potential donor and recipient strains were exposed to sunlight. Transduction of the Km^r determinant-marked CTX prophages carried by strains SM44 and ASF-1 was monitored by transfer of kanamycin resistance to the recipient strains. One recipient, AE-2883, could be differentiated from the donor strains by its resistance to tetracycline, whereas the other two strains were of the O139 serogroup and could be differentiated from the donor strains by using an O139-specific probe. Transduction was assayed both under in vitro laboratory conditions and in vivo inside the ileal loops of adult rabbits. Previous investigators have used infant mice to study in vivo transfer of CTX, but we found that the rabbit ileal loop model is also useful for in vivo CTX transduction assays. Sunlight exposure significantly increased in vitro transduction of the recipient strains. When the mixed cultures were exposed to sunlight, the number of transductants was more than 20-fold higher than the number obtained in the absence of sunlight (Table 4). The overall transduction efficiency was higher in the rabbit ileal loops than in vitro, and the in vivo efficiency increased further when the mixed cultures were exposed to sunlight prior to inoculation in rabbits (Table 4). TCP, the receptor for CTX, is known to be expressed more adequately in vivo (17). Since the induction studies clearly showed a marked increase in extracellular CTX, it is most likely that in addition to adequate expression of TCP, the increased efficiency of CTX transduction in vivo was due to the availability of high titers of transducing particles in the inoculum which was preexposed to sunlight.

View this table: [in this window] [in a new window]   TABLE 4.   Transduction of V. cholerae strains by CTX derived from sunlight-treated lysogens carrying genetically marked CTX prophages

View this table: [in this window] [in a new window]   TABLE 5.   Production of cholera toxin by CTX-infected derivatives of nontoxigenic V. cholerae O139 strains

Environmental factors in the emergence of epidemic strains. Species of the genus Vibrio have been regarded as a group of organisms whose major habitats are aquatic ecosystems (2). It has been suggested that acquisition of virulence-associated genes, particularly those encoding intestinal colonization factors and enterotoxins, has allowed specific vibrios to adapt to the human intestinal environment (5, 13). The genes for the major enterotoxin, ctxAB, reside in the genome of CTX, and the propagation of this phage is assumed to be associated with the horizontal transmission of genes encoding CT. In the present study, we demonstrated the conversion of nontoxigenic O139 strains into toxigenic derivatives. These strains were also positive for genes encoding the intestinal colonization factor and CTX receptor, TCP, and the virulence regulatory gene toxR, involved in the expression of both TCP and CT, which are the major virulence factors found in epidemic strains (11).