Previous Article | Next Article 
Infection and Immunity, September 2000, p. 4913-4922, Vol. 68, No. 9
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Extract of Nippostrongylus brasiliensis
Stimulates Polyclonal Type-2 Immunoglobulin Response by Inducing De
Novo Class Switch
Humphrey N.
Ehigiator,1
Andrew W.
Stadnyk,1,2 and
Timothy D. G.
Lee1,3,*
Departments of Microbiology and
Immunology,1
Pediatrics,2 and
Surgery,3 Dalhousie University,
Halifax, Nova Scotia, Canada
Received 14 February 2000/Returned for modification 17 March
2000/Accepted 12 June 2000
 |
ABSTRACT |
Infection with the nematode parasite Nippostrongylus
brasiliensis induces a pronounced type-2 T-cell response that is
associated with marked polyclonal immunoglobulin E (IgE) and IgG1
production in mice. To examine the differential roles of the infection
and products produced by nematodes, we investigated a soluble extract of N. brasiliensis for the ability to mediate this type-2
response. We found that the extract induced a marked increase in IgE
and IgG1 levels, similar to that induced by the infection. The extract did not affect the level of IgG2a in serum, showing that the effect was
specific to IgE and IgG1 (type-2-associated immunoglobulin) rather than
inducing a nonspecific increase in all immunoglobulin isotypes. This
response was also associated with increased interleukin-4 production in
vitro. These results confirm that the extract, like infection, is a
strong inducer of polyclonal type-2 responses and a reliable model for
investigating the regulation of nematode-induced responses. The extract
induced the production of IgG1 when added to in vitro cultures of
lipopolysaccharide-stimulated B cells. This provides evidence for the
induction of class switch. It did not induce upregulation of IgG1 in
naive (unstimulated) B cells or expand B cells in in vitro cultures.
Analysis of DNA from the spleens of mice treated with the extract by
digestion-circularization PCR demonstrated a marked increase in the
occurrence of
1 switch region gene recombination in the cells in
vivo. These results provide strong evidence that soluble worm products
are able to mediate the marked polyclonal
1/
response and that
infection is not required to mediate this response. Furthermore, these
data provide evidence that the soluble nematode extract induces this effect by causing de novo class switch of B cells and not by an expansion of IgG1 B cells or an increase in antibody production by IgG1
plasma cells.
 |
INTRODUCTION |
Nippostrongylus
brasiliensis infection in mice has been widely used to address the
mechanisms involved in the regulation of the type-2 responses
associated with nematodes. One significant aspect of the type-2 shift
induced by this worm in mice is the bias of the immunoglobulin (Ig)
response towards IgE and IgG1 (29, 72, 75). A compelling
characteristic of this response is the fact that most of this antibody
is not directed against the parasite; only a small fraction is specific
to nematode antigens (20, 21). This clearly indicates that
nematode infection induces a polyclonal activation of reaginic
antibodies. Further to this, there is strong evidence that nematode
infection will bias the developing immune response to unrelated
antigens towards IgE and reaginic IgG. For example, we (31)
have shown dramatic effects on the developing antibody response to
third-party antigens by treatment with nematodes and nematode extracts.
This observation is significant in that it suggests that the influence
of nematodes on immune responses is far reaching and may have profound
effects on developing immune responses to unrelated antigenic
challenge. This could have significant effects on the outcome of
vaccination strategies in areas where nematode infection is endemic.
Currently, the prevailing evidence supports important roles for both
interleukin-4 (IL-4) and IL-13 in IgE and IgG1 production, including
such antibody production following nematode infection. This has been
confirmed by cytokine blocking experiments (1, 2, 10, 27,
72) and gene knockout experiments (25, 26, 40, 41,
51). Several in vitro culture studies have shown that production
of both IgE and IgG1 is dependent on IL-4, as the addition of
antibodies to either IL-4 or the IL-4 receptor completely inhibits IgE
and IgG1 production (12-14).
This cytokine dependence is likely due to the role of these cytokines
in mediating class switch. For example, it has been demonstrated that
the addition of IL-4 to cultures of either lipopolysaccharide (LPS)- or
anti-CD40 antibody-stimulated murine B cells induces high levels of
germline
and
1 transcripts that correlate with the amount of IgE
and IgG1 induction, respectively (5-7, 16, 23, 37, 57).
Similar observations have been reported in a number of in vivo model
systems (73, 74). The production of both IgE and reaginic
IgG has common regulatory elements (15, 38, 52, 59, 62);
there is now convincing evidence in mice of a sequential switch from µ to
1 and then to
(38, 59, 74). Such a sequential
switch has also been documented in other species (43).
It is clear that IL-4 and IL-13 are involved in reaginic antibody
production in response to nematodes. What remains to be addressed,
however, is the relationship between the inflammatory parameters of
infection, the products produced by the nematode, and the
immunoglobulin response that follows. It is unclear whether the large
polyclonal
1/
response seen after nematode infection is due to
infection per se or to the elaboration of factors which either directly
or indirectly mediate class switch by nematodes. The evidence that
cytokine-like molecules can be produced by nematodes (17,
47) is suggestive of a direct role for nematode factors in the
mediation of the
1/
response. This is of significant interest
since it could form the foundation for nematode-based therapeutics.
In this study, we examined the effects of a soluble
Nippostrongylus protein extract on IgE and IgG1
responses in mice. We confirmed that soluble worm products are able to
mediate the heightened polyclonal
1/
response and that infection
is not required to mediate this response. Furthermore, we demonstrated
that the soluble nematode extract induces the effect by causing de novo
class switch of B cells.
 |
MATERIALS AND METHODS |
Animals.
Female nude (nu
/nu
)
BALB/cBYJ mice and control littermates
(nu+/nu+) were purchased from Jackson
Laboratories (Bar Harbor, Maine). All mice were used at 8 to 12 weeks
of age. Male Sprague Dawley (SD) rats (220 to 250 g) used in the
maintenance of N. brasiliensis and in the preparation of
adult worm homogenate (AWH) were purchased from Harlan Sprague Dawley
(Indianapolis, Ind.). All animals were maintained in compliance with
the Canadian Council on Animal Care guidelines, with food and water
provided ad libitum.
Parasites.
Third-stage (infective) larvae of N. brasiliensis were obtained from Dean Befus (University of Alberta,
Edmonton, Canada). The life cycle of the worms was maintained regularly
by passage in Sprague Dawley rats as previously described
(30).
Nippostrongylus adult worm extract preparation.
A whole adult worm extract (AWH) was prepared essentially as previously
described by Nawa and coworkers (46). Briefly, SD rats were
infected by subcutaneous injection of 5,000 third-stage larvae in 0.5 ml of phosphate-buffered saline (PBS) containing 100 U of penicillin
and 100 µg of streptomycin per ml (PBS-PS). Rats were sacrificed 8 days later, the abdominal cavity was exposed and adult worms were
recovered from the small intestine using a modified Baermann apparatus.
The adult worms were washed at least 10 times with sterile PBS-PS. The
last two washes were done in PBS alone. After washing, the worms were
counted, transferred into a glass tube, and homogenized in 1 to 2 ml of
PBS with a glass tissue homogenizer. The homogenate, in addition to 3 to 5 ml of PBS used to rinse the homogenizer, was transferred into 15-ml polypropylene tubes. To eliminate large particles, the homogenate was centrifuged at 1,000 × g for 15 min at 4°C. The
supernatant was collected and then further clarified (to eliminate fine
particles) by centrifugation at 15,000 × g for 30 min
at 4°C. The homogenate was sterilized through syringe filters (0.22 µm; Millipore Corp.), aliquoted into 1.5-ml microcentrifuge tubes
(Fisher Scientific, Nepean, Ontario, Canada), and stored at
20°C.
No protease inhibitors were added at any stage of the procedure.
Protein content of the extract was determined with the bicinchoninic
acid protein assay kit (Pierce Laboratory, Rockford, Ill.) according to
the manufacturer's instruction.
In vivo treatment.
For in vivo experimentation, BALB/c mice
were injected subcutaneously with 200 µl (200 µg of protein) of
either AWH or killed mycobacteria (Sigma-Aldrich Co., Oakville,
Ontario, Canada). Control animals were either untreated (naive) or
injected with either PBS or Freund's incomplete adjuvant (FIA;
Sigma-Aldrich Co.). Prior to use, AWH was emulsified in FIA (ratio,
1:1). For nematode infections, mice were injected subcutaneously with
600 larvae in 200 µl of PBS. At each time point postinfection, mice
in the various groups were bled through the retroorbital plexus, and the serum obtained was stored at
20°C until analyzed for
immunoglobulin levels using antibody capture enzyme-linked
immunosorbent assay (ELISA). Some mice from each group were sacrificed;
spleen cells were obtained and used for both cytokine mRNA and protein
profile analyses.
Cell isolation.
Single spleen cell suspensions from either
naive or treated mice were prepared in RPMI 1640 (ICN, Aurora, Ohio)
supplemented with 10% fetal bovine serum (Life Technologies,
Burlington, Ontario, Canada), 20 mM HEPES (Life Technologies), 100 U of
penicillin per ml, 100 µg of streptomycin per ml, 2 mM
L-glutamine (Life Technologies), and 50 µM
2-mercaptoethanol (Sigma-Aldrich Co.). The cell suspension was purged
of red blood cells by hypotonic lysis with ammonium chloride lysing
buffer. B cells were isolated from nude mouse spleen cell preparations
by adherent cell depletion (1 h at 37°C). B cells were isolated from
control littermates by negative selection as previously described
(32). This treatment consistently yielded a B-cell purity of
>95% as determined by flow cytometry. The viability of the cells was
determined by trypan blue dye exclusion. Cells from these preparations
and nude mouse B cells were tested for reactivity to the T-cell mitogen
concanavalin A (ConA), and no residual T-cell activity was detected.
Proliferation assay.
B cells (2 × 105/well) were cultured in 96-well flat-bottomed plates
(Nalge Nunc Inc., Roskilde, Denmark) in a total volume of 200 µl per
well. Each well was stimulated with LPS (5 µg/ml; from
Escherichia coli serotype O55.55; Sigma-Aldrich Co.) in the presence or absence of AWH at different concentrations. The cultures were incubated for 72 h at 37°C, followed by an additional 18-h pulse with 1 µCi of [3H]thymidine (ICN) per ml. The
cells were harvested onto glass fiber mats with a cell harvester
(Skatron Instrument Inc., Sterling, Va.). Proliferation was assessed by
measuring [3H]thymidine incorporation with a
scintillation counter (Beckman, Mississauga, Ontario, Canada). In all
experiments, wells were set up in triplicate. Data are expressed as
disintegrations per minute (dpm) ± standard deviation (SD) in
each triplicate.
In vitro stimulation of B cells for immunoglobulin
production.
Purified B cells (2 × 106/ml) were
stimulated with 10 µg of LPS per ml alone or LPS in combination with
AWH (20 µg/ml) or IL-4 (5 ng/ml; Genzyme, Cambridge, Mass.). The
cells were incubated in 1 ml of supplemented RPMI in 24-well plates
(Nalge Nunc Inc.) at 37°C. Culture supernatants were harvested 7 days
later, centrifuged to eliminate cells, and stored at
20°C until
analyzed for immunoglobulin levels using antibody capture ELISA.
Antibody ELISA.
The level of IgE, IgG1, and IgG2a in mouse
serum and IgG1 and IgM levels in B-cell culture supernatants were
determined by standard capture ELISA. Flat-bottomed 96-well maxiSorb
immuno-plates (Nalge Nunc Inc.) were coated with 2 µg of the
respective capture anti-immunoglobulin antibody (goat anti-mouse IgG1,
goat anti-mouse IgG2a, or goat anti-mouse IgM; Cedarlane Laboratories,
Hornby, Ontario, Canada) or anti-mouse IgE monoclonal antibody
(Pharmingen, Mississauga, Ontario, Canada) per ml overnight at 4°C.
After blocking, the wells were seeded with 100 µl of either serum or
B-cell culture supernatants and appropriate standards and incubated
overnight at room temperature. Immunoglobulins were detected using
secondary antibodies conjugated to horseradish peroxidase (Cedarlane
Laboratories), a substrate solution that consisted of 0.4 µg of
o-phenylenediamine substrate (Sigma-Aldrich Co.) per ml in
citrate buffer (pH 5.0) and hydrogen peroxide (0.04%; Sigma-Aldrich
Co.). Absorbance was read at a wavelength of 490 nm using a Titertek
plate reader (ICN).
Cytokine ELISA.
Supernatants from the spleen cell cultures
were analyzed for the levels of IL-4 by a sandwich ELISA as described
previously (33). Briefly, flat-bottomed 96-well ELISA plates
were coated with anti-mouse IL-4 (1 µg/ml; Pharmingen); in 0.1 M
carbonate buffer (pH 9.6) at 100 µl per well and incubated overnight
at 4°C. After blocking, test culture supernatants and recombinant IL-4 were applied to the wells, and the plates were incubated overnight
at 4°C. Following this, biotinylated anti-IL-4 antibody (Pharmingen)
was added to the wells at 0.5 µg/ml and incubated for 1 h at
room temperature. Detection was by extravidin-peroxidase (Sigma-Aldrich
Co.), with the detection substrate being 3,3'5,5'-tetramethylbenzidine plus H2O2.
RT-PCR.
Total cellular RNA was isolated from spleen cells of
mice injected with AWH or worms or naive (untreated) mice using
TRIzol reagent (Life Technologies). RNA was isolated from
107 spleen cells as previously described (30).
Reverse transcription (RT) reaction of each RNA sample was performed on
1 µg of total RNA using Moloney murine leukemia virus (M-MLV) reverse
transcriptase (Life Technologies). Each reaction mixture (total volume,
20 µl) contained first-strand buffer (1×), dithiothreotol (0.01 M),
deoxyribonucleoside triphosphates (dNTPs; 0.5 mM), random hexamer
primers (1 µg), M-MLV reverse transcriptase enzyme (200 U), and RNA
solution (1 µg).
PCR was performed on cDNA products (3 µl) for IL-4 and IL-13
sequences in the presence of reaction mixtures made up of PCR buffer (2 M KCl, 1 M Tris [pH 8.4], 1 M MgCl2, 1 mg of bovine serum
albumin per ml), 0.2 mM dNTPs, 0.5 µM each of the primer sets, and
2.5 U of Taq DNA polymerase (Life Technologies). Each reaction was adjusted to a final volume of 50 µl with distilled water. The conditions used for PCR were 35 cycles of 1 min at 94°C
for DNA denaturation, 1 min at 55°C for primer annealing, and 1 min
at 72°C for primer extension, at the end of which the product was
subjected to a final incubation period of 5 min at 72°C to ensure
complete product extension. Amplification of
-actin sequences served
as control transcripts for the reaction and for semiquantitative
purposes. PCR products were resolved on 1.5% agarose gel containing
ethidium bromide. Gels were photographed with a DS/34 Polaroid camera
(Bio/Can) using a Foto/Prep 1 UV transilluminator (Bio/Can) or
digitally captured with Micro Analyst software (Bio-Rad Laboratories,
Hercules, Calif.). The primers used in the PCR (obtained from Life
Technologies) are as follows:
-actin, 5' primer,
CTGGAGAAGAGCTATGAGC, and 3' primer,
TTCTGCATCCTGTCAGCAATG; IL-4 5' primer,
CGAAGAACACCACAGAGAGTGAGCT, and 3' primer,
GACTCATTCATGGTGCAGCTTATCG; IL-13 5' primer,
ATGGCGCTCTGGGTGACTGCAG, and 3' primer, GAAGGGGCCGTGGCGAAACAGTTG.
DC-PCR.
For digestion-circularization-PCR (DC-PCR), genomic
DNA was isolated from spleen cells of naive (untreated) mice or treated mice by standard methods as previously described (18, 64) or
with DNAzol reagent as recommended by the manufacturer
(Life Technologies).
Digestion of each DNA sample was performed in 1.5-ml microcentrifuge
tubes with 5 to 10 µg of DNA in a 100-µl volume using
EcoRI as the restriction endonuclease. Each reaction mixture
contained
10 µl of 10× React 3 buffer (1× final; Life
Technologies),
EcoRI
(2 U/µg of DNA; Life Technologies),
DNA solution, and the appropriate
volume of double-distilled water
required to adjust the volume
to 100 µl. The reaction mixtures were
then incubated overnight
in a 37°C waterbath, following which the
enzyme was inactivated
by incubation at 70°C for 20 min. For ligation
(circularization),
10 to 20 µl of digested DNA samples was placed in
1.5-ml microcentrifuge
tubes to which 20 µl of 5× T4 DNA ligase
buffer (1× final; Life
Technologies), 2 µl (20 U) of T4 DNA ligase
(Life Technologies),
and double-distilled water were added to a final
volume of 100
µl. The reaction mixtures were incubated overnight in a
16°C waterbath.
Ligated DNA samples were kept at

20°C until
amplification by
PCR.
PCR was performed on ligated DNA products for the detection of
Sµ-S

1 recombination and nicotinic acetylcholine receptor (nAChRe)

subunit gene with appropriate primers in clean 0.5-ml
microcentrifuge
tubes. Portions (5 to 20 µl) from the ligation
reaction were placed
into PCR tubes with the reaction mixture
containing 5 µl of 10×
GeneAmp PCR buffer II (100 mM Tris-HCl [pH
8.3], 500 mM KCl),
2 µl (1.0 mM) of MgCl
2, 0.2 mM each
of the dNTPs, 0.5 µM each
of the primer set, and 2.5 U of AmpliTaq
DNA polymerase (AmpliTaq
Gold; Perkin Elmer Corp., Norwalk, Conn.).
Each reaction was adjusted
to a final volume of 50 µl with distilled
water. Amplification
of the samples for the detection of Sµ-S

1
rearrangement and nAChRe
gene was performed in an automated thermal
cycler subjected to
the following cycling parameters: 94°C for 9 min
to activate the
enzyme, initial 5 cycles of denaturation at 94°C for
1 min, annealing
at 65°C for 1 min, and extension at 72°C for 2 min; further 30
cycles of denaturation at 94°C for 1 min, stringent
annealing
at 68°C for 1 min, and extension at 72°C for 2 min; and
complete
extension of PCR products at 72°C for 7 min. Amplification
of
the nAChRe gene served as a control for DNA preparation, restriction
digestion, and ligation in the DC-PCR procedure and for
semiquantitative
purposes. PCR products were kept at

20°C until
analyzed by agarose
gel electrophoresis. PCR products were resolved as
stated in the
section
above.
The primer sequences used in the PCR (initially published by Chu et al.
[
6]) were purchased from Life Technologies and
are as
follows: nAChRe sense, 5'-AGGCGCGCACTGACACCACTAAG-3'; nAChRe
antisense, 5'-GACTGCTGTGGGTTTCACCCAG-3' (generated a 753-bp
PCR
product from the digested and circularized genomic DNA
template);
Sµ antisense,
5'-
GGCCGGTCGACGGAGACCAATAATCAGAGGGAAG-3';
S

1
sense, 5'-
GCGCCATCGATGGAGAGCAGGGTCTCCTGGGTAGG-3'
(generated
a 219-bp PCR product from the digested and
circularized genomic
DNA template). Nucleotides in bold are linker
sequences containing
a
SalI or
ClaI site; the
remaining nucleotides represent mouse
genomic sequences. Primers were
reconstituted upon receipt with
sterile double-distilled water,
aliquoted in autoclaved 500-µl
microcentrifuge tubes, and stored at

20°C.
Statistics.
Statistical analyses were performed by the
one-way analysis of variance (ANOVA) for comparisons between multiple
treatments and Student's t test for comparisons between two
treatments. Comparisons with a probability value of <0.05 were
considered significant.
 |
RESULTS |
N. brasiliensis extract induces IgE and IgG1
production.
Increased production of circulating IgE and IgG1 in
mice infected with nematodes has been widely reported (15, 29,
75), but the mechanism involved in this response is unclear. We
adopted a reductive approach using an extract (AWH) of N. brasiliensis. We found that, like infection, injection of mice
with AWH (200 µg of protein, which is equivalent to about 200 worms)
resulted in a marked increase in the level of total IgE in the serum
(Fig. 1A). This was about five- to
sixfold higher than the control level at 3 weeks post-AWH injection. In
mice injected with the vehicle alone, no increase in IgE level was
detected. In fact, in these mice the baseline level at day 0 was
maintained at all time points examined. In addition, a marked increase
in the level of IgG1 was observed in mice injected with AWH (Fig. 1B).
The pattern of the increase in IgE and IgG1 levels in the serum of mice
injected with AWH is very similar to the pattern observed in mice
infected with the worm (75). However, the final absolute
levels were always higher in nematode-infected (IgE, 30 µg/ml; IgG1,
2 mg/ml) than in AWH-treated mice.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
AWH induces IgE and IgG1 production in the serum of
BALB/c mice. Female BALB/c mice in groups of three were injected
subcutaneously at the back of the neck with AWH emulsified in FIA (100 to 200 µg of protein in a 200-µl volume). The control group was
injected with the vehicle alone (FIA). Each group of mice was bled for
serum each week for 3 weeks, and the sera within the groups were
pooled. The pooled serum samples were assayed for IgE (A), IgG1 (B),
and IgG2a (C) levels by capture ELISA. The data are from one experiment
and are representative of three (IgE), five (IgG1), and four (IgG2a)
independent experiments.
|
|
N. brasiliensis is a strong inducer of type-2-associated
immune response (
15,
28,
30,
33). To verify whether the
induction
of increased IgE and IgG1 levels by AWH is specific to these
type-2
immunoglobulins, the level of IgG2a, a type-1 immunoglobulin
isotype,
was also examined. The level of IgG2a in the serum of the
AWH-injected
mice was similar to that observed in the mice that were
injected
with the vehicle control (Fig.
1C). These observations show
that
AWH induces an immune response that is biased toward type-2
immunoglobulins,
similar to our observations with
N. brasiliensis infection (data
not
shown).
To confirm that the response induced by AWH is not simply a response to
a complex antigen, the immune response induced by
AWH was compared to
the immune response induced in mice injected
with killed mycobacteria
in the same vehicle as AWH. As shown
in Fig.
2A, IgE was detected in significant
amounts in mice injected
with AWH (reaching a level of 20 µg/ml) but
was not detected in
the serum of mice injected with mycobacteria. The
level of IgG1
in mycobacteria-treated mice was not greater than that
observed
in mice injected with the vehicle control or in naive
(untreated)
mice (Fig.
2B). In contrast, mice injected with
mycobacteria showed
much higher levels of IgG2a in the serum than
control animals,
from 150 to about 450 µg/ml (Fig.
2C). In the same
experiment,
mice injected with AWH did not show increased levels of
IgG2a
in comparison to naive (untreated) or vehicle-injected mice (Fig.
2C). These data provide strong evidence that the
Nippostrongylus extract, and not just a response to the
injection of a complex
antigen mixture, specifically induced the
increased type-2-associated
immunoglobulin response observed.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 2.
Increased IgE and IgG1 response is specific to AWH
treatment. BALB/c mice in groups of three were injected with killed
mycobacteria (Myc) or AWH emulsified in FIA (vehicle). The third group
received vehicle alone (FIA). Mice in each group were bled for serum at
14 and 21 days posttreatment. Serum samples were pooled within each
group. Serum samples were assayed for IgE, IgG1, and IgG2a levels by
capture ELISA. Data shown are the IgE (A), IgG1 (B), and IgG2a (C)
levels at 21 days posttreatment. Results are expressed as mean ± SD of triplicate wells and are representative of three experiments (A)
***, P < 0.0004, two-tailed, unpaired Student's
t test; (B and C) ***, P < 0.001; NS,
not significant (P > 0.05), one-way ANOVA.
|
|
AWH induces IL-4 and IL-13 production.
Increased IgG1 and IgE
levels are associated with increased IL-4 and IL-13 production (1,
15, 41, 69). In nematode infections, the levels of mRNA and
protein for these cytokines have been demonstrated to be increased in
both spleen and mesenteric lymph node cells (19, 28, 39, 67,
69). If our hypothesis regarding the increase in IgE and IgG1
activity induced by AWH is correct, we would expect that the increased
levels of these immunoglobulins would likewise be associated with an
increase in the levels of these cytokines. To investigate this
possibility, spleen cells from mice treated with AWH were analyzed for
increased IL-4 production. Figure 3A
demonstrates IL-4 mRNA expression in spleen cells from AWH-treated
mice. A similar increase in IL-13 mRNA was also observed in the spleen
cells from AWH-treated mice (Fig. 3B). In agreement with the data on
levels of IgE and IgG1 in serum, the cytokine mRNA level was higher in
worm-infected animals than in AWH-treated mice. Amplicons for IL-4 and
IL-13 could not be detected by RT-PCR of spleen cells from naive
(untreated) mice.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 3.
IL-4 and IL-13 mRNA induction by AWH. Spleen cells were
isolated from mice 21 days after treatment with AWH or N. brasiliensis (Nb). For assessment of IL-4 (A) and IL-13
(B) mRNA expression, total cellular RNA was isolated with
TRIzol and reverse-transcribed into single-stranded cDNA
using M-MLV reverse transcriptase and random hexamers as described in
Materials and Methods. The resulting cDNA template was used in a PCR
with primers specific for either IL-4 or IL-13. -Actin mRNA levels
were also determined by RT-PCR to control for equal RNA loading. PCR
amplicons were resolved on a 1.5% agarose gel with ethidium bromide
staining. Results are representative of three experiments. Nv, naive
(untreated). The negative controls in panel B were no enzyme in RT
reaction, no RNA in RT reaction, no cDNA in PCR, and no primers in PCR
(left to right, respectively).
|
|
Since an increase in mRNA levels does not always reflect increased
protein production, IL-4 protein levels were also assessed.
Spleen
cells isolated from mice 2 and 3 weeks posttreatment, were
stimulated
with ConA in vitro; supernatants were collected and
analyzed for IL-4
levels by ELISA. IL-4 was detected in the supernatants
of
ConA-stimulated spleen cells from both worm- and AWH-treated
mice (Fig.
4A), but not in supernatants of cells
from naive control
mice. The level of IL-4 was significantly higher
(
P < 0.001) in
worm-infected (620 pg/ml) than in
AWH-injected (110 pg/ml) mice.
This increase in IL-4 levels is due
specifically to the injection
of AWH and not to a nonspecific effect of
treatment with a complex
antigen mixture. As shown in Fig.
4B,
substantial levels of IL-4
(>120 pg/ml) were observed in the culture
supernatants of ConA-stimulated
spleen cells from AWH-injected mice,
whereas <20 pg/ml (limit
of detection) of IL-4 was present in the
supernatants from mycobacterium-treated
mice. When these data were
normalized for the vehicle, the cytokine
pattern correlated well with
the observed immunoglobulin subclass
levels shown in Fig.
2. These data
confirm that the IL-4 induced
in the spleen cells of mice treated with
AWH is mediated specifically
by the extract and not simply a
"response to antigen" effect (i.e.,
that the observed responses are
not simply due to the injection
of a complex mixture of antigens but
specifically due to factors
in the extract).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Increased IL-4 response in spleen cell cultures is
specific to AWH treatment. For assessment of IL-4 protein levels,
spleen cells isolated from naive (untreated) mice or mice treated with
AWH or worms (Nb) (A), killed mycobacteria (Myc), or AWH
emulsified in FIA (B) 21 days posttreatment were stimulated with ConA
(5 µg/ml) for 24 or 48 h. Culture supernatants were then
analyzed by ELISA for IL-4 levels as described in Materials and
Methods. Results are expressed as the mean concentration of IL-4 ± SD of three replicate wells. ***, P < 0.001,
one-way ANOVA. Data in panel B were normalized for vehicle. ND, below
detection limit (15 pg/ml). Results are representative of three
experiments.
|
|
AWH induces IgG1 production in in vitro B-cell culture.
The
observation that AWH induces an increase in IgE and IgG1 levels in
mouse serum suggests an effect on B-cell activity. To examine this, we
determined whether AWH could induce B cells in culture to produce IgG1.
Purified B cells were stimulated with LPS and then incubated in the
presence of AWH for 7 days. Supernatants from these cultures
were
assayed for IgG1 by capture ELISA. As a positive control,
LPS-stimulated B-cell cultures were incubated with IL-4. B cells
stimulated with LPS secrete significant amounts of IgM, but in
the
presence of IL-4, the cells undergo class switch to become
IgG1- (or
IgE)-secreting B cells. The data shown in Fig.
5A demonstrate
that IL-4 induced an
increase in IgG1 levels in the B-cell culture
supernatants. In the same
experiment, AWH also induced an increase
in IgG1 levels in cultures of
LPS-stimulated B cells. This increase
was not observed in cultures of
naive B cells stimulated with
AWH alone, nor did LPS alone induce IgG1
production in B cells
in the absence of AWH. In addition, the induction
of increased
IgG1 levels in the B-cell culture was associated with a
decrease
in the levels of IgM in the culture supernatants (Fig.
5B).
These
data are very suggestive that the soluble nematode extract (AWH)
induces LPS-stimulated B cells to undergo class switch from µ
to

1.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 5.
Influence of AWH on immunoglobulin production in in
vitro B-cell culture. Highly purified naive B cells from uninfected
mice (8 to 12 weeks old) isolated as described in Materials and Methods
were not stimulated (NS) or stimulated in culture containing AWH alone
(20 µg/ml), LPS alone (10 µg/ml), or LPS in combination with AWH
(20 µg/ml) or IL-4 (5 ng/ml). Culture supernatants were harvested 7 days later and then analyzed for IgG1 (A) and IgM (B) levels using
antibody capture ELISA as described in Materials and Methods. Results
are expressed as the mean concentration ± SD of three replicate
wells and are representative of six separate experiments. ***,
P < 0.001, one-way ANOVA.
|
|
Increased IgG1 level in AWH-treated mice associated with de novo
class switch.
The data above suggest that the induction of
increased immunoglobulin levels is mediated by class switch. However,
the data could be explained by (i) an expansion of existing
IgG1-committed B cells, (ii) an increase in antibody production by
individual cells, or (iii) an increase in de novo class switch. To
discriminate between these possibilities, we first investigated whether
the increase in IgG1 levels was mediated by an expansion of existing IgG1-committed B cells in vitro in the presence of AWH. B cells from
control (naive) mice were stimulated with LPS and cultured in the
presence of AWH. An expansion of an existing IgG1-committed population
would yield a significant increase in proliferation. Since higher
levels of IgG1 are found both in vivo and under these in vitro
conditions, this experiment appropriately addresses the issue of
expansion of memory cells. As expected, LPS itself induced significant
proliferation, but this proliferative response was significantly
inhibited (P < 0.001) when the cells were cultured in
the presence of AWH (Fig. 6).
Furthermore, AWH alone did not demonstrate stimulatory activity when
added to B cells. This inability of AWH to either stimulate naive
B-cell proliferation or enhance LPS-induced B-cell proliferation
effectively rules out the possibility of expansion of B cells as a
mechanism of action of AWH. AWH also inhibited the proliferation of B
cells obtained from mice infected with N. brasiliensis.
Since infection of mice with this nematode has been shown to cause
significant expansion of IgG1+ B cells in the spleen
(22, 70, 71), the B-cell population tested would have
increased IgG1+ B cells present compared to the control.
The fact that this population did not proliferate in response to AWH
confirms that AWH does not cause selective expansion of
IgG1+ B cells.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 6.
AWH does not expand B cells. B cells from BALB/c mice
were stimulated in culture containing LPS alone (5 µg/ml) or LPS in
combination with AWH (10 or 50 µg/ml). After 72 h of incubation
at 37°C, the cultures were pulsed with [3H]thymidine,
and the cells were assayed for incorporation 18 h later. Data
shown are expressed as mean disintegrations per minute (dpm) of
triplicate wells ± SD and are representative of seven
experiments. ***, P < 0.001, one-way ANOVA.
|
|
To distinguish between upregulation of antibody secretion by switched
cells and an increase in class switch (de novo class
switch), we
adopted the molecular approach, DC-PCR, which allows
the
semiquantitative assessment of switched DNA (
6). The
specificity
of this technique for IgG1 class switch has been
demonstrated
in a number of previous studies (
45,
52,
58,
76) and was
confirmed in this study by assessing genomic DNA from
an IgG1-producing
hybridoma (TSI-18; positive control) and an
IgG2a-producing hybridoma
(IB4; negative control) for the presence of

1 rearrangement (hybridomas
were a generous gift from A. Issekutz,
Dalhousie University, Halifax,
Nova Scotia, Canada). The TSI-18
hybridoma is homogenous for switched

1. In contrast, the IB4
hybridoma does not have

1 rearrangement
but has undergone

2a
rearrangement. Using previously published
primers (
6,
7) the
presence of the characteristic 219-bp
switched

1 DNA amplicon was
amplified by DC-PCR from TSI-18 DNA.
This amplicon was not present
after DC-PCR of IB4 DNA (Fig.
7A).
This
observation confirms the specificity with which DC-PCR can
assess
switch DNA recombination, allowing the discrimination of
the two
remaining possible mechanisms of action of AWH (increased
type-2
antibody secretion from individual cells versus increased
de novo class
switch).

View larger version (101K):
[in this window]
[in a new window]
|
FIG. 7.
AWH-induced IgG1 production is associated with an
increase in the number of IgG1-switched cells. Genomic DNA was isolated
from either the TSI-18 and IB4 hybridomas (A) or the spleen cells of
mice treated with either AWH, worms (Nb), or FIA (B) as
described in Materials and Methods. The DNA was digested with
EcoRI, ligated with T4 DNA ligase, and amplified by PCR
using primers specific for the recombined switch regions. nAChRe levels
in all samples were also determined by DC-PCR to control for equal
template loading and allow semiquantitation (comparison) of the
Sµ-S 1 product. PCR amplicons were resolved on a 1.5% agarose gel
with ethidium bromide staining. Results are representative of six
experiments. (A) Lane 1, TSI-18 (IgG1-producing hybridoma); lane 2, IB4
(IgG2a-producing hybridoma); lane 3, no DNA (control for PCR
contamination); lane 4, TSI-18 (nAChRe amplicon from IgG1-producing
hybridoma).
|
|
To assess class switch after AWH treatment, genomic DNA was isolated
from the spleen cells of mice injected with AWH or infected
with worms.
Control mice were injected with the vehicle alone.
Amplicons indicative
of

1 switch (219 bp) were found after DC-PCR
was performed on DNA
from spleen cells from either AWH-treated
or worm-infected animals
(Fig.
7B). This indicates significant

1 switch in the spleens of
these animals. As expected,

1 switch
could also be seen, but to a
lesser extent, after DC-PCR on DNA
from control mice. The presence of
an amplicon in these mice was
not unexpected, since normal mice
constitutively produce IgG1
in response to environmental challenge.
nAChRe levels were also
determined by DC-PCR to control for equal
template loading and
allow semiquantitation of the Sµ-S

1 products.
These data provide
strong evidence that the increase in total IgG1
levels observed
in the serum of mice infected with worms or injected
with AWH
is associated with increased

1 gene recombination,
resulting
in increased switched

1-specific B
cells.
 |
DISCUSSION |
Infection of mammals with parasitic nematodes induces elevated
levels of reaginic antibody. In humans, these are IgE and IgG4. In
mice, they are IgE and IgG1. Of significant interest is that much of
this reaginic antibody is not specific to worm antigens. For example,
it has been estimated that less than 20% of the IgE induced in the
serum of N. brasiliensis-infected animals is specific to
worm antigen (20, 21). This increase in immunoglobulin level
demonstrates that N. brasiliensis has the ability to
modulate B-cell activities in vivo. However, the mechanisms involved in the development of this unique polyclonal IgG1 and IgE response to
nematode infection are unclear. We have used a reductive approach involving the use of a nematode extract to address this question. This
approach provides the opportunity to assess the modulatory effect of
the worms in both in vivo and in vitro systems. The results presented
here show that injection of mice with the whole-worm homogenate, AWH,
induced very dramatic increases in the levels of total IgE and IgG1 in
the serum. Previous attempts to induce IgE responses by the injection
of rodents with extracts of adult N. brasiliensis worms have
been unsuccessful (24, 47). The difference in the outcome of
these experiments and the observation reported in our study could be
attributed to the difference in the preparation of the extracts and/or
the concentration of the extracts injected into the rodents and the
mode of administration. Furthermore, unlike our study, earlier extracts
were administered in PBS, which would be rapidly absorbed. In our study
the extract was released slowly from the injected vehicle. Soluble
extracts of Brugia (49, 50), Toxocara
(8), and Ascaris (31, 65) organisms
are known to induce type-2 modulation. Uchikawa and coworkers
(68) have reported IgE induction in rats using
excretory/secretory (ES) products of N. brasiliensis, but in
our view, the results of experimentation with ES products must always
be viewed carefully because of the significant potential for
contamination during what is effectively a nonsterile culture procedure
to obtain the ES. The data reported here are the first evidence that a
fresh, sterile extract of N. brasiliensis induces dramatic
IgE and IgG1 production in vivo under controlled conditions. This
provides the basis for experimentation into the mechanisms by which
this response is mediated.
The fact that AWH induces marked increases in total (polyclonal) IgE
and IgG1 levels but does not affect the level of IgG2a confirms that
the effect of AWH is restricted to these type-2-associated immunoglobulins. In addition, the response induced by AWH is not merely
a response to the injection of a complex antigen. Mice injected with
killed mycobacteria produced IgG2a but not IgE or IgG1. These data
provide evidence that the complex parameters of infection are not
required for the reaginic response to the worm and strongly suggest the
presence of a nematode factor(s) which mediates this response. However,
these data do not elucidate the mechanisms behind this important response.
It is well established that the production of IgE and IgG1
immunoglobulin isotypes in both in vivo and in vitro systems requires the presence of the cytokines IL-4 and IL-13 (2, 3, 25, 27, 40,
41, 45, 51, 72). These cytokines are clearly associated with
increases in the level of these immunoglobulins in the serum of mice
infected with nematodes (15, 39, 51). A number of
investigators have demonstrated mRNA and protein for these type-2
cytokines from spleen and mesenteric lymph node cells of mice infected
with different nematode parasites (28, 39, 67, 69). Their
importance has been conclusively demonstrated in studies with IL-4 and
IL-13 single and double knockout mice (2, 3, 25, 41, 51,
72). A remaining question, however, has been the manner in which
the nematode infection activates these cytokines. The multiple
parameters associated with infection make it difficult to address this
question. In our study, the presence of IL-4 and IL-13 was adequately
demonstrated in spleen cells isolated from mice treated with the
soluble protein extract (AWH). The pattern of the production of these
cytokines correlated well with the immunoglobulin production pattern in
the different treatment groups. Furthermore, the increase in both mRNA
and protein indicates that AWH, like live worms, stimulates both
transcription and translation of the cytokines. The detection of IL-13
mRNA in the spleen cell cultures from mice injected with AWH was of significant interest. It demonstrates the full spectrum of type-2 cytokines that regulate IgE and IgG1 production. This observation is of
importance in light of the increasing evidence detailing the
significant role of IL-13 in the regulation of type-2-associated immunoglobulin responses (2, 40, 41, 51, 72). It is important to note that, as observed with the immunoglobulin response, the increase in IL-4 production by spleen cells did not occur in
response to injection of mice with killed mycobacteria, a control complex antigenic mixture, confirming the specificity of the response. Although the role of IL-4 in the regulation of IgE and IgG1 production is well established, there is some evidence to support the presence of
regulatory mechanisms independent of IL-4 for type-2-associated immune
responses (11, 44). This observation suggests that nematodes
(or nematode factors) could modify host immune responses directly, to
promote their survival.
An extract of the intestinal nematode parasite Heligmosomoides
polygyrus has recently been reported to stimulate the production of IgG1 in naive spleen cell culture in vitro (56). The data in that study showed that the extract mediated its effect by
stimulating T cells to produce a factor (presumably IL-4) that induced
IgG1 production in the culture. Our data showing the induction of IgG1 in cultures of LPS-stimulated B cells by AWH, however, suggest a more
direct effect of AWH on B-cell differentiation that is T-cell
independent. The purity of the B cells used in the in vitro cultures in
this study was greater than 95%, as shown by fluorescence-activated cell sorting analysis, and similar results were observed when B cells
from T-cell-deficient mice were used in the in vitro cultures. No
residual T-cell activity was detected in these B-cell cultures (assessed with ConA). Although the level of IgE was not assessed in
these B-cell-activated cultures, the level of the alternate reaginic
antibody, IgG1, is a sufficient marker of activation of the reaginic
response, especially since class switch to
in mice is preceded by a
1 switch (38).
The in vitro activity of AWH reported here suggests strongly that AWH
contains a switch factor or that it mediates the production of a switch
factor by the B cells themselves (or by the small number of accessory
cells present to ensure adequate LPS stimulation of B cells). This
activity of AWH does not appear to be IL-4 mediated because IL-4 was
not present in the culture supernatant of LPS- and AWH-activated B
cells when analyzed by ELISA (detection limit, 15 pg/ml; data not
shown). Nonetheless, evidence exists that some nematodes contain
cytokine-like molecules (17, 36, 48, 53). For example, a
gamma interferon homologue has been reported in the intestinal nematode
parasite Trichuris muris (17). Similarly, Pastrana and coworkers have also reported the secretion of a homologue of human macrophage migration inhibitory factor by the filarial nematode parasites Brugia malayi, Wuchereria
bancrofti, and Onchocerca volvolus (48).
These findings demonstrate that nematodes have the capacity to produce
cytokine-like factors. These cytokine homologues may have the potential
to modify host immune responses to promote parasite survival.
This observation that AWH may induce class switch in vitro suggests a
possible mechanism for the in vivo observations made in this study.
However, there are alternate mechanisms by which AWH could exert its
effect to increase the levels of IgE and IgG1 in vivo. The increase in
immunoglobulin levels in vivo could be as a result of (i) an expansion
of IgG1 B cells or (ii) an increase in antibody production by IgG1
plasma cells.
Robinson and coworkers (54, 55) and Lee and Xie
(32) demonstrated B- and T-cell mitogenic activity in
nematode extracts, suggesting a capability of inducing an expansion of
IgG1 B cells (the first alternative above). However, this possibility
is not supported by the data presented in the study reported here. Data obtained from the in vitro proliferation assay showed that AWH does not
expand B cells from naive, AWH, or worm-treated mice. In fact, AWH
induced a significant inhibition of B-cell proliferation. This
observation rules out expansion of existing IgG1 B cells as the
mechanism by which AWH induced the production of IgG1. The observations
that AWH has the ability to induce IgG1 production in LPS-stimulated B
cells and is also able to inhibit the B-cell proliferative response
appear contradictory. These observations are even more interesting
since it has been suggested that DNA synthesis is necessary for isotype
switching (42, 61, 63). However, other reports suggest that
immunoglobulin class switch is not directly linked to cell
proliferation (9, 34, 35, 60). This was most clearly proven
in the report by Snapper and coworkers (60), which
demonstrated that B cells lacking RelB, which exhibit fourfold less
proliferation, undergo normal levels of immunoglobulin class switching.
At this point it is reasonable to assume, from available evidence, that
certain factors involved in class switch require proliferation, while
others do not.
A more convincing hypothesis is that the increase in IgG1 in response
to AWH treatment is the result of an increase in the percentage of B
cells exhibiting class switch to IgG1, i.e., an increase in de novo
class switch of naive B cells. Based on the increased production of
IgG1 in LPS-stimulated B cells exposed to AWH observed in our in vitro
study and the fact that it did not stimulate IgG1 production when added
alone, a hypothesis that immunoglobulin class switch is the main
mechanism by which AWH mediates the marked increase in total IgG1
levels in vivo is more tenable.
To evaluate whether the increase in total IgG1 by AWH in vivo was, in
fact, due to wholesale class switch, we adopted the DC-PCR technique,
first described by Chu and colleagues (6, 7). This technique
is specifically designed to examine immunoglobulin class switch, and
its sensitivity and reliability in assessing the extent of
immunoglobulin heavy-chain gene recombination events have been well
reported (37, 45, 52, 58, 76). With this technique, it is
important to note that only DNA segments in which switch recombination
has occurred will generate PCR products. In the absence of switch, the
switch regions, which are several kilobases apart, exist on different
fragments. These fragments lack the appropriate sequences to which the
primer anneals during amplification.
Using this system, we were able to amplify
1-switched DNA
(Sµ-S
1; 219 bp) at significant levels from DNA preparations of spleen cells from both worm- and AWH-treated mice at 3 weeks
posttreatment. A control positive signal for the IgG1 class switch was
provided by the use of DNA from an IgG1-producing hybridoma (TSI-18).
This signal also served as a basis for comparison of the level of
immunoglobulin class switch detected in the different treatment groups
in this study. Because of the fact that both IgG1 and IgE are
upregulated by N. brasiliensis infection and other
Th2-activating treatments (4, 13, 29, 66) and the evidence
of sequential switch from µ to
1 and then to
(38, 43, 66,
74), we concentrated on IgG1 as a marker for induction of
immunoglobulin class switch by this nematode. Marked levels of
1
switch recombination were seen in both the worm- and AWH-treated mice.
Only a very low background Sµ-S
1 switch was detected in control animals.
This study provides strong evidence that the induction of increased
IgG1 and IgE levels in worm-infected and AWH-treated mice is primarily
due to stimulation of de novo class switch to these type-2-associated
immunoglobulins by the nematode extract. The data are supported by the
work of Yoshida and colleagues (74), who detected switch
region recombination indicative of sequential µ to
1 and then to
switch in N. brasiliensis-infected animals.
We have confirmed in this study that nematode infection is not required
for polyclonal reaginic antibody production; soluble nematode products
also have this effect. In addition, these products do not induce this
response by amplifying an existing
1 B-cell response but by inducing
a µ to
1 class switch. These data are of significant interest
because of their implications for vaccine strategies in areas where
nematode infection is endemic.
 |
ACKNOWLEDGMENTS |
This work was supported by grants from the Natural Sciences and
Engineering Research Council of Canada and Novartis, Inc.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Transplantation and Immunology Research Laboratory, Sir Charles Tupper Medical Building, Dalhousie University, Halifax, Nova Scotia, Canada B3H 4H7. Phone: (902) 494-3882. Fax: (902)
494-5125. E-mail: tim.lee{at}dal.ca.
Editor:
J. M. Mansfield
 |
REFERENCES |
| 1.
|
Bancroft, A. J., and R. K. Grencis.
1998.
Th1 and Th2 cells and immunity to intestinal helminths.
Chem. Immunol.
71:192-208[Medline].
|
| 2.
|
Bancroft, A. J.,
A. N. J. McKenzie, and R. K. Grencis.
1998.
A critical role for IL-13 in resistance to intestinal nematode infection.
J. Immunol.
160:3453-3461[Abstract/Free Full Text].
|
| 3.
|
Barner, M.,
M. Mohrs,
F. Brombacher, and M. Kopf.
1998.
Differences between IL-4R -deficient and IL-4-deficient mice reveal a role for IL-13 in the regulation of Th2 responses.
Curr. Biol.
8:669-672[CrossRef][Medline].
|
| 4.
|
Beck, L., and H. L. Spiegelberg.
1989.
The polyclonal and antigen-specific IgE, IgG1 and IgG2a response of mice injected with ovalbumin in alum or complete freund's adjuvant.
Cell Immunol.
123:1-8[CrossRef][Medline].
|
| 5.
|
Berton, M. T.,
J. W. Uhr, and E. S. Vitetta.
1989.
Synthesis of germ-line 1 immunoglobulin heavy-chain transcripts in resting B cells: induction by interleukin 4 and inhibition by interferon .
Proc. Natl. Acad. Sci. USA
86:2829-2833[Abstract/Free Full Text].
|
| 6.
|
Chu, C. C.,
W. E. Paul, and E. E. Max.
1992.
Quantitation of immunoglobulin µ- 1 heavy chain switch region recombination by a digestion-circularization polymerase chain reaction method.
Proc. Natl. Acad. Sci. USA
89:6978-6982[Abstract/Free Full Text].
|
| 7.
|
Chu, C. C.,
E. E. Max, and W. E. Paul.
1993.
DNA rearrangement can account for in vitro switching to IgG1.
J. Exp. Med.
178:1381-1390[Abstract/Free Full Text].
|
| 8.
|
Del Prete, G. F.,
M. De Carli,
C. Mastromauro,
R. Biagiotti,
D. Macchia,
P. Falagiani,
M. Ricci, and S. Romagnani.
1991.
Purified protein derivative of Mycobacterium tuberculosis and excretory-secretory antigen(s) of Toxocara canis expand in vitro human T cells with stable and opposite (type 1 T helper or type 2 T helper) profile of cytokine production.
J. Clin. Investig.
88:346-350.
|
| 9.
|
Dillehay, D. L.,
X. L. Jiang, and E. W. Lamon.
1991.
Differential effects of retinoids on pokeweed mitogen induced B cell proliferation versus immunoglobulin synthesis.
Int. J. Immunopharmacol.
13:1043-1048[CrossRef][Medline].
|
| 10.
|
Emson, C. L.,
S. E. Bell,
A. Jones, and A. N. J. McKenzie.
1998.
Interleukin (IL)-4-independent induction of immunoglobulin (Ig)E, and perturbation of T cell development in transgenic mice expressing IL-13.
J. Exp. Med.
188:399-404[Abstract/Free Full Text].
|
| 11.
|
Ferlin, W. G.,
E. Severinson,
L. Ström,
A. W. Heath,
R. L. Coffman,
D. A. Ferrick, and M. C. Howard.
1996.
CD40 signaling induces interleukin-4-independent IgE switching in vivo.
Eur. J. Immunol.
26:2911-2915[Medline].
|
| 12.
|
Finkelman, F. D.,
I. M. Katona,
J. F. Urban, Jr.,
C. M. Snapper,
J. Ohara, and W. E. Paul.
1986.
Suppression of in vivo polyclonal IgE responses by monoclonal antibody to the lymphokine B cell stimulatory factor-1.
Proc. Natl. Acad. Sci. USA
83:9675-9678[Abstract/Free Full Text].
|
| 13.
|
Finkelman, F. D.,
I. M. Katona,
J. F. Urban, Jr.,
J. Holmes,
J. Ohara,
A. S. Tung,
J.vG. Sample, and W. E. Paul.
1988.
IL-4 is required to generate and sustain in vivo IgE responses.
J. Immunol.
141:2335-2341[Abstract].
|
| 14.
|
Finkelman, F. D.,
J. F. Urban, Jr.,
M. P. Beckman,
K. A. Schooley,
J. Holmes, and I. M. Katona.
1991.
Regulation of murine in vivo IgG and IgE responses by a monoclonal anti-IL-4 receptor antibody.
Int. Immunol.
3:599-607[Abstract/Free Full Text].
|
| 15.
|
Finkelman, F. D.,
T. Shea-Donohue,
J. Goldhill,
C. A. Sullivan,
S. C. Morris,
K. B. Madden,
W. C. Gause, and J. F. Urban, Jr.
1997.
Cytokine regulation of host defence against parasitic gastrointestinal nematodes: lessons from studies with rodent models.
Annu. Rev. Immunol.
15:505-533[CrossRef][Medline].
|
| 16.
|
Fujieda, S.,
K. Zhang, and A. Saxon.
1995.
IL-4 plus CD40 monoclonal antibody induces human B cells subclass-specific isotype switch: switching to 1, 3, and 4, but not 2.
J. Immunol.
155:2318-2328[Abstract].
|
| 17.
|
Grencis, R. K., and G. M. Entwistle.
1997.
Production of an interferon-gamma homologue by an intestinal nematode: functionally significant or interesting artefact?
Parasitology
115:S101-S106.
|
| 18.
|
Gross-Bellard, M.,
P. Oudet, and P. Chambon.
1973.
Isolation of high-molecular-weight DNA from mammalian cells.
Eur. J. Biochem.
36:32-38[Medline].
|
| 19.
|
Ishikawa, N.,
P. K. Goyal,
R. Mahida,
K.-F. Li, and D. Wakelin.
1998.
Early cytokine responses during intestinal parasitic infections.
Immunology
93:257-263[CrossRef][Medline].
|
| 20.
|
Jarrett, E. E. E.,
D. M. Haig, and H. Bazin.
1976.
Time course studies on rat IgE production in N. brasiliensis infection.
Clin. Exp. Immunol.
24:346-351[Medline].
|
| 21.
|
Jarrett, E. E. E., and H. R. P. Miller.
1982.
Production and activities of IgE in helminth infection.
Prog. Allergy
31:178-233[Medline].
|
| 22.
|
Katona, I. M.,
J. F. Urban,
I. Scher,
C. Kanellopoulos-Langevin, and F. D. Finkelman.
1983.
Induction of an IgE response by Nippostrongylus brasiliensis: characterization of lymphoid cells with intracytoplasmic or surface IgE.
J. Immunol.
130:350-351[Medline].
|
| 23.
|
Kepron, M. R.,
Y.-W. Chen,
J. W. Uhr, and E. S. Vitetta.
1989.
IL-4 induces the specific rearrangement of 1 genes on the expressed and unexpressed chromosomes of lipopolysaccharide-activated normal murine B cells.
J. Immunol.
143:334-339[Abstract].
|
| 24.
|
Kojima, S., and Z. Ovary.
1975.
Effect of Nippostrongylus brasiliensis infection on anti-hapten IgE antibody response in the mouse. I. Induction of carrier specific helper cells.
Cell. Immunol.
15:274-286[CrossRef][Medline].
|
| 25.
|
Kopf, M.,
G. Le Gros,
M. Bachmann,
M. C. Lamers,
H. Bluethmann, and G. Köhler.
1993.
Disruption of the murine IL-4 gene blocks Th2 cytokine responses.
Nature
362:245-248[CrossRef][Medline].
|
| 26.
|
Kuhn, R.,
K. Rajewsky, and W. Muller.
1991.
Generation and analysis of interleukin-4 deficient mice.
Science
254:707-710[Abstract/Free Full Text].
|
| 27.
|
Lai, Y. H., and T. R. Mosmann.
1999.
Mouse IL-13 enhances antibody production in vivo and acts directly on B cells in vitro to increase survival and hence antibody production.
J. Immunol.
162:78-87[Abstract/Free Full Text].
|
| 28.
|
Lawrence, R. A.,
C. A. Gray,
J. Osborne, and R. M. Maizels.
1996.
Nippostrongylus brasiliensis: cytokine responses and worm expulsion in normal and IL-4 deficient mice.
Exp. Parasitol.
84:65-73[CrossRef][Medline].
|
| 29.
|
Lebrun, P., and H. L. Spiegelberg.
1987.
Concomitant immunoglobulin E and immunoglobulin G1 formation in Nippostrongylus brasiliensis-infected mice.
J. Immunol.
139:1459-1465[Abstract].
|
| 30.
|
Ledingham, D. L.,
V. C. McAlister,
H. N. Ehigiator,
C. Giacomantonio,
M. Theal, and T. D. G. Lee.
1996.
Prolongation of rat kidney allograft survival by nematodes.
Transplantation
61:184-188[CrossRef][Medline].
|
| 31.
|
Lee, T. D. G., and A. M. McGibbon.
1993.
Potentiation of IgE responses to third party antigens mediated by Ascaris suum soluble products.
Int. Arch. Allergy Immunol.
102:185-190[Medline].
|
| 32.
|
Lee, T. D. G., and C. Y. Xie.
1995.
Polyclonal stimulation of murine B lymphocytes by Ascaris soluble product.
J. Allergy Clin. Immunol.
95:1246-1254[CrossRef][Medline].
|
| 33.
|
Liwski, R. S., and T. D. G. Lee.
1999.
Nematode infection enhances survival of activated T cells by modulating accessory cell function.
J. Immunol.
163:5005-5012[Abstract/Free Full Text].
|
| 34.
|
Lycke, N., and W. Strober.
1989.
Cholera toxin promotes B cell isotype differentiation.
J. Immunol.
142:3781-3787[Abstract].
|
| 35.
|
Lycke, N.,
E. Severinson, and W. Strober.
1990.
Cholera toxin acts synergistically with IL-4 to promote IgG1 switch differentiation.
J. Immunol.
145:3316-3324[Abstract].
|
| 36.
|
Maizels, R. M.,
D. A. P. Bundy,
M. E. Selkirk,
D. F. Smith, and R. M. Anderson.
1993.
Immunological modulation and evasion by helminth parasites in human populations.
Nature
365:797-805[CrossRef][Medline].
|
| 37.
|
Mandler, R.,
C. C. Chu,
W. E. Paul,
E. E. Max, and C. M. Snapper.
1993a.
Interleukin 5 induces Sµ-S 1 DNA rearrangement in B cells activated with dextran-anti-IgD antibodies and interleukin 4: a three-component model for Ig class switching.
J. Exp. Med.
178:1577-1586[Abstract/Free Full Text].
|
| 38.
|
Mandler, R.,
F. D. Finkelman,
A. D. Levine, and C. M. Snapper.
1993b.
IL-4 induction of IgE class switching by lipopolysaccharide-activated murine B cells occurs predominantly through sequential switching.
J. Immunol.
150:407-418[Abstract].
|
| 39.
|
Matsuda, S.,
R. Uchikawa,
M. Yamada, and N. Arizono.
1995.
Cytokine mRNA expression profiles in rats infected with the intestinal nematode Nippostrongylus brasiliensis.
Infect. Immun.
63:4653-4660[Abstract/Free Full Text].
|
| 40.
|
McKenzie, G. J.,
C. L. Emson,
S. E. Bell,
S. Anderson,
P. Fallon,
G. Zurawski,
R. Murray,
R. Grencis, and A. N. J. McKenzie.
1998.
Impaired development of Th2 cells in IL-13-deficient mice.
Immunity
9:423-432[CrossRef][Medline].
|
| 41.
|
McKenzie, G. J.,
P. G. Fallon,
C. L. Emson,
R. K. Grencis, and A. N. J. McKenzie.
1999.
Simultaneous disruption of interleukin (IL)-4 and IL-13 defined individual roles in T helper cell type 2-mediated responses.
J. Exp. Med.
189:1565-1572[Abstract/Free Full Text].
|
| 42.
|
Miller, R. L., and P. B. Rothman.
1998.
Molecular mechanisms controlling immunoglobulin E responses, p. 21-33.
In
T. F. Kresina (ed.), Immune modulating agents. Mercel Dekker, Inc., New York, N.Y.
|
| 43.
|
Mills, F. C.,
G. Thyphronitis,
F. D. Finkelman, and E. E. Max.
1992.
Ig µ- isotype switch in IL-4-treated human B lymphoblastoid cells: evidence for a sequential switch.
J. Immunol.
149:1075-1085[Abstract].
|
| 44.
|
Morawetz, R. A.,
L. Gabriele,
L. V. Rizzo,
N. Noben-Trauth,
R. Kühn,
K. Rajewsky,
W. Müller,
T. M. Doherty,
F. Finkelman,
R. L. Coffman, and H. C. Morse, III.
1996.
Interleukin (IL)-4-independent immunoglobulin class switch to immunoglobulin (Ig)E in the mouse.
J. Exp. Med.
184:1651-1661[Abstract/Free Full Text].
|
| 45.
|
Nakanishi, K.,
T. Yoshimoto,
C. C. Chu,
H. Matsumoto,
K. Hase,
N. Nagai,
T. Tanaka,
M. Miyasaka,
W. E. Paul, and S. Shinka.
1995.
IL-2 inhibits IL-4-dependent IgE and IgG1 production in vitro and in vivo.
Int. Immunol.
7:259-268[Abstract/Free Full Text].
|
| 46.
|
Nawa, Y.,
H. R. P. Miller,
E. Hall, and E. E. E. Jarrett.
1981.
Adoptive transfer of total and parasite-specific IgE responses in rats infected with Nippostrongylus brasiliensis.
Immunology
44:119-123[Medline].
|
| 47.
|
Orr, T. S. C.,
P. Riley, and J. E. Doe.
1971.
Potentiated reagin response to egg albumin in Nippostrongylus brasiliensis infected rats. II. Time course of the reagin response.
Immunology
20:185-189[Medline].
|
| 48.
|
Pastrana, D. V.,
N. Raghavan,
P. Fitzgerald,
S. W. Eisinger,
C. Metz,
R. Bucala,
R. P. Schleimer,
C. Bickel, and A. L. Scott.
1998.
Filarial nematode parasites secrete a homologue of the human cytokine macrophage migration inhibitory factor.
Infect. Immun.
66:5955-5963[Abstract/Free Full Text].
|
| 49.
|
Pearlman, E.,
F. E. Hazlett, Jr.,
W. H. Boom, and J. W. Kazura.
1993.
Induction of murine T-helper-cell responses to the filarial nematode Brugia malayi.
Infect. Immun.
61:1105-1112[Abstract/Free Full Text].
|
| 50.
|
Pearlman, E.,
F. P. Heinzel,
F. E. Hazlett, Jr., and J. W. Kazura.
1995.
IL-12 modulation of T helper responses to the filarial helminth, Brugia malayi.
J. Immunol.
154:4658-4664[Abstract].
|
| 51.
|
Punnonen, J.,
G. Aversa,
B. G. Cocks,
A. N. J. McKenzie,
S. Menon,
G. Zurawski,
R. De Waal Malefyt, and J. E. de Vries.
1993.
Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells.
Proc. Natl. Acad. Sci. USA
90:3730-3734[Abstract/Free Full Text].
|
| 52.
|
Purkerson, J. M., and P. C. Isakson.
1994.
Independent regulation of DNA recombination and immunoglobulin (Ig) secretion during isotype switching to IgG1 and IgE.
J. Exp. Med.
179:1877-1883[Abstract/Free Full Text].
|
| 53.
|
Riffkin, M.,
H.-F. Seow,
D. Jackson,
L. Brown, and P. Wood.
1996.
Defence against the immune barrage: helminth survival strategies.
Immunol. Cell. Biol.
74:564-574[Medline].
|
| 54.
|
Robinson, M.,
T. R. Gustad,
F.-Y. Wei,
C. S. David, and N. Storey.
1994.
Adult worm homogenate of the nematode parasite Heligmosomoides polygyrus induces proliferation of naive T lymphocytes without MHC restriction.
Cell. Immunol.
158:157-166[CrossRef][Medline].
|
| 55.
|
Robinson, M.,
T. R. Gustad,
N. Storey, and C. S. David.
1995.
Heligmosomoides polygyrus adult worm homogenate superantigen: presentation to T cells requires MHC class I positive accessory cells.
Cell. Immunol.
161:188-194[CrossRef][Medline].
|
| 56.
|
Robinson, M., and T. R. Gustad.
1996.
In vitro stimulation of naive mouse lymphocytes by Heligmosomoides polygyrus adult worm antigens induces the production of IgG1.
Parasite Immunol. (Oxford)
18:87-93.
|
| 57.
|
Rothman, P.,
S. Lutzker,
W. Cook,
R. Coffman, and F. W. Alt.
1988.
Mitogen plus interleukin 4 induction of C transcript in B lymphoid cells.
J. Exp. Med.
168:2385-2389[Abstract/Free Full Text].
|
| 58.
|
Shparago, N.,
P. Zelazowski,
L. Jin,
T. M. McIntyre,
E. Stüber,
L. M. T. Peçanha,
M. R. Kehry,
J. J. Mond,
E. E. Max, and C. M. Snapper.
1996.
IL-10 selectively regulates murine Ig isotype switching.
Int. Immunol.
8:781-790[Abstract/Free Full Text].
|
| 59.
|
Siebenkotten, G.,
C. Esser,
M. Wabl, and A. Radbruch.
1992.
The murine IgG1/IgE class switch program.
Eur. J. Immunol.
22:1827-1834[Medline].
|
| 60.
|
Snapper, C. M.,
F. R. Rosas,
P. Zelazowski,
M. A. Moorman,
M. R. Kehry,
R. Bravo, and F. Weih.
1996.
B cells lacking RelB are defective in proliferative responses, but undergo normal B cell maturation to Ig secretion and Ig class switching.
J. Exp. Med.
184:1537-1541[Abstract/Free Full Text].
|
| 61.
|
Snapper, C. M.,
P. Zelazowski,
F. R. Rosas,
M. R. Kehry,
M. Tian,
D. Baltimore, and W. C. Sha.
1997.
B cells from p50/NF- B knockout mice have selective defects in proliferation, differentiation, germ-line CH transcription, and Ig class switching.
J. Immunol.
156:183-191[Abstract].
|
| 62.
|
Spiegelberg, H. L.
1990.
The role of interleukin-4 in IgE and IgG subclass formation.
Springer Semin. Immunopathol.
12:365-383[Medline].
|
| 63.
|
Stavnezer, J.
1996.
Antibody class switching.
Adv. Immunol.
61:79-146[Medline].
|
| 64.
|
Strauss, W. M.
1994.
Preparation of genomic DNA from mammalian tissue, p. 2.2.1-2.2.3.
In
F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. John Wiley and Sons Inc., New York, N.Y.
|
| 65.
|
Stromberg, B. E.
1979.
IgE and IgG1 production by a soluble product of Ascaris suum in the guinea-pig.
Immunology
38:489-495[Medline].
|
| 66.
|
Sudowe, S.,
A. Rademaekers, and E. Kölsch.
1997.
Antigen dose-dependent predominance of either direct or sequential switch in IgE antibody responses.
Immunology
91:464-472[CrossRef][Medline].
|
| 67.
|
Svetic, A.,
K. B. Madden,
X. D. Zhou,
P. Lu,
I. M. Katona,
F. D. Finkelman,
J. F. Urban, Jr., and W. C. Gause.
1993.
A primary intestinal helminth infection rapidly induces a gut-associated elevation of Th2-associated cytokines and IL-3.
J. Immunol.
150:3434-3441[Abstract].
|
| 68.
|
Uchikawa, R.,
M. Yamada,
S. Matsuda, and N. Arizono.
1993.
IgE antibody responses induced by transplantation of the nematode Nippostrongylus brasiliensis in rats: a possible role of nematode excretory-secretory product in IgE production.
Immunology
80:541-545[Medline].
|
| 69.
|
Uchikawa, R.,
M. Yamada,
S. Matsuda,
A. Kuroda, and N. Arizono.
1994.
IgE antibody production is associated with suppressed interferon- levels in mesenteric lymph nodes of rats infected with the nematode Nippostrongylus brasiliensis.
Immunology
82:427-432[Medline].
|
| 70.
|
Urban, J. F., Jr.,
I. M. Katona,
D. A. Dean, and F. D. Finkelman.
1984.
The cellular IgE response of rodents to infection with Nippostrongylus brasiliensis, Trichinella spiralis and Schistosoma mansoni.
Vet. Parasitol.
14:193-208[CrossRef][Medline].
|
| 71.
|
Urban, J. F., Jr.,
H. R. Gamble, and I. M. Katona.
1989.
Intestinal immune responses of mammals to nematode parasites.
Am. Zool.
29:469-478.
|
| 72.
|
Urban, J. F., Jr.,
N. Noben-Trauth,
D. D. Donaldson,
K. B. Madden,
S. C. Morris,
M. Collins, and F. D. Finkelman.
1998.
IL-13, IL-4R , and Stat6 are required for the expulsion of the gastrointestinal nematode parasite Nippostrongylus brasiliensis.
Immunity
8:255-264[CrossRef][Medline].
|
| 73.
|
Xu, L., and P. Rothman.
1994.
IFN- represses germline transcription and subsequently down regulates switch recombination to .
Int. Immunol.
6:515-521[Abstract/Free Full Text].
|
| 74.
|
Yoshida, K.,
M. Matsuoka,
S. Usuda,
A. Mori,
K. Ishizaka, and H. Sakano.
1990.
Immunoglobulin switch circular DNA in the mouse infected with Nippostrongylus brasiliensis: evidence for successive class switching from µ to via 1.
Proc. Natl. Acad. Sci. USA
87:7829-7833[Abstract/Free Full Text].
|
| 75.
|
Zakroff, S. G. H.,
L. Beck,
E. G. Platzer, and H. L. Spiegelberg.
1989.
The IgE and IgG subclass responses of mice to four helminth parasites.
Cell. Immunol.
119:193-201[CrossRef][Medline].
|
| 76.
|
Zelazowski, P.,
D. Carrasco,
F. R. Rosas,
M. A. Moorman,
R. Bravo, and C. M. Snapper.
1997.
B cells genetically deficient in the c-Rel transactivation domain have selective defects in germline CH transcription and Ig class switching.
J. Immunol.
159:3133-3139[Abstract].
|
Infection and Immunity, September 2000, p. 4913-4922, Vol. 68, No. 9
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kohno, M., Yamasaki, S., Tybulewicz, V. L. J., Saito, T.
(2005). Rapid and large amount of autocrine IL-3 production is responsible for mast cell survival by IgE in the absence of antigen. Blood
105: 2059-2065
[Abstract]
[Full Text]
-
Tezuka, H., Imai, S., Hidano, S., Tsukidate, S., Fujita, K.
(2003). Various Types of Dirofilaria immitis Polyproteins Selectively Induce a Th2-Type Immune Response. Infect. Immun.
71: 3802-3811
[Abstract]
[Full Text]
-
Lobos, E., Nutman, T. B., Hothersall, J. S., Moncada, S.
(2003). Elevated Immunoglobulin E against Recombinant Brugia malayi{gamma}-Glutamyl Transpeptidase in Patients with Bancroftian Filariasis: Association with Tropical Pulmonary Eosinophilia or Putative Immunity. Infect. Immun.
71: 747-753
[Abstract]
[Full Text]
-
Paterson, J. C. M., Garside, P., Kennedy, M. W., Lawrence, C. E.
(2002). Modulation of a Heterologous Immune Response by the Products of Ascaris suum. Infect. Immun.
70: 6058-6067
[Abstract]
[Full Text]
-
Tezuka, H., Imai, S., Muto, R., Furuhashi, Y., Fujita, K.
(2002). Recombinant Dirofilaria immitis Polyprotein That Stimulates Murine B Cells To Produce Nonspecific Polyclonal Immunoglobulin E Antibody. Infect. Immun.
70: 1235-1244
[Abstract]
[Full Text]