Previous Article | Next Article 
Infection and Immunity, September 2000, p. 5075-5083, Vol. 68, No. 9
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Induction of Colony-Stimulating Factor Expression
following Staphylococcus or Salmonella
Interaction with Mouse or Human Osteoblasts
Kenneth L.
Bost,*
Jennifer L.
Bento,
John K.
Ellington,
Ian
Marriott, and
Michael C.
Hudson
Department of Biology, University of North
Carolina at Charlotte, Charlotte, North Carolina
Received 28 March 2000/Returned for modification 5 June
2000/Accepted 20 June 2000
 |
ABSTRACT |
Staphylococcus aureus and Salmonella spp.
are common causes of bone diseases; however, the immune response during
such infections is not well understood. Colony-stimulating factors
(CSF) have a profound influence on osteoclastogenesis, as well as the
development of immune responses following infection. Therefore, we
questioned whether interaction of osteoblasts with two very different
bacterial pathogens could affect CSF expression by these cells.
Cultured mouse and human osteoblasts were exposed to various numbers of S. aureus or Salmonella dublin bacteria, and a
comprehensive analysis of granulocyte-macrophage (GM)-CSF, granulocyte
(G)-CSF, macrophage (M)-CSF, and interleukin-3 (IL-3) mRNA expression
and cytokine secretion was performed. Expression of M-CSF and IL-3
mRNAs by mouse osteoblasts was constitutive and did not increase
significantly following bacterial exposure. In contrast, GM-CSF and
G-CSF mRNA expression by mouse osteoblasts was dramatically upregulated
following interaction with either viable S. aureus or
Salmonella. This increased mRNA expression also translated
into high levels of GM-CSF and G-CSF secretion by mouse and human
osteoblasts following bacterial exposure. Viable S. aureus
and Salmonella induced maximal levels of CSF mRNA
expression and cytokine secretion compared to UV-killed bacteria.
Furthermore, GM-CSF and G-CSF mRNA expression could be induced in
unexposed osteoblasts separated by a permeable Transwell membrane from
bacterially exposed osteoblasts. M-CSF secretion was increased in
cultures of exposed human osteoblasts but not in exposed mouse
osteoblast cultures. Together, these studies are the first to define
CSF expression and suggest that, following bacterial exposure,
osteoblasts may influence osteoclastogenesis, as well as the
development of an immune response, via the production of these cytokines.
 |
INTRODUCTION |
Two principal cell populations are
responsible for the continual process of bone remodeling. Osteoclasts
derive from myeloid precursors (59) and drive the resorption
of bone by acidification and release of lysosomal enzymes
(73). Conversely, osteoblasts derive from a mesenchymal bone
marrow precursor (3) and produce components of bone,
principally type I collagen. Osteoblasts also catalyze the
calcification process and produce soluble factors which serve to
modulate the activity, or the formation, of osteoclasts. In this
manner, osteoblasts function as a principal director of osteoclast
function, and it is the communication between these two cell
populations that constitutes one of the most important mechanisms of
bone formation.
Among the osteoblast-derived factors which may have profound effects on
osteoclastogenesis, and/or the activity of osteoclasts, are the
colony-stimulating factors (CSF) macrophage (M)-CSF, granulocyte (G)-CSF, and granulocyte-macrophage (GM)-CSF. For example,
op/op mice are deficient in a functional gene encoding M-CSF
(83) and due to reduced M-CSF production (5, 20,
40) these mice have reduced numbers of osteoclasts and are
osteopetrotic. Furthermore, M-CSF has been shown to facilitate
osteoclastogenesis and also to activate osteoclast function (30,
37, 39, 72, 82). Since M-CSF augments osteoclast maturation and
activity, the presence of this CSF has been closely linked with bone
resorption (12, 42, 56). The fact that osteoblasts can
upregulate their expression of M-CSF (22, 38, 62, 63, 79)
suggests that osteoblast-derived M-CSF secretion may stimulate
osteoclast development and activity (11).
Similarly, the presence of excess G-CSF stimulates bone resorption.
When this CSF was used as an exogenous therapy (67, 71) or
genetically overexpressed (70), increased bone resorption was observed. The mechanisms of G-CSF-induced bone resorption are not
clear, although it has been suggested that osteoblast-derived G-CSF
(21, 68) might affect bone remodeling.
GM-CSF, like M-CSF, facilitates the early differentiation of myeloid
precursors into osteoclast precursors (29, 45, 46, 58, 69).
Conversely, however, GM-CSF seems to limit the formation of the more
mature, multinucleated osteoclasts (33, 65, 66, 76). Since
osteoblasts can also be stimulated to secrete GM-CSF (21, 32, 51,
80), it is also possible that osteoblast-derived GM-CSF
contributes to the regulation of osteoclastogenesis.
Bacterial infections and their products can be potent stimulators of
osteoclastogenesis and bone resorption (55). Bacteria can
destroy bone by several possible mechanisms, including the production
of acids or proteases, or by indirectly stimulating osteoclastogenesis.
However, it is unclear what mechanisms are the most important in the
pathophysiology of bacterium-induced bone resorption. This question is
further complicated by the diversity of bone and joint diseases (e.g.,
osteomyelitis, arthritis, or periodontitis) and by the diversity of
bacterial species which can act as causative agents (e.g.,
Staphylococcus spp. and Salmonella spp.). Since
osteoblasts dictate osteoclast function, it is logical to begin to
question how bacterial infections might affect osteoblast activity.
Surprisingly, few studies to date have addressed the response of
osteoblasts following their interaction with viable bacteria capable of
causing bone diseases (55).
Osteoblast-induced CSF production at the site of bacterial infection in
the bone could have several consequences. First, excess production of
M-CSF or G-CSF could increase osteoclastogenesis and promote bone
resorption. Alternatively, induced production of GM-CSF would likely
limit the formation of multinucleated osteoclasts. Each of these CSF
could also have profound effects on hematopoiesis and augment the
inflammatory response at the site of bone infection. However, such
speculations have little meaning in the absence of an understanding of
which CSF are produced in response to infection.
In the present study, we have addressed for the first time the ability
of gram-positive (Staphylococcus aureus) and gram-negative (Salmonella dublin) bacteria to induce CSF expression in
cultured mouse and human osteoblasts. Surprisingly, we found that
viable Staphylococcus or Salmonella could induce
significant levels of GM-CSF and G-CSF production in both mouse and
human osteoblasts. Only human osteoblasts directly exposed to bacteria
could be induced to increase their secretion of M-CSF over constitutive
levels. These results strongly suggest that osteoblasts respond to
bacterial challenge by the production of CSF that may contribute to the host response and modulate osteoclastogenesis.
 |
MATERIALS AND METHODS |
Isolation and culture of mouse osteoblasts.
Primary
osteoblast cell cultures were prepared from mouse neonate calvariae by
sequential collagenase-protease digestion as previously described by
our laboratory (9). Cell isolates were pooled in osteoblast
growth medium (OBGM) consisting of Dulbecco's modified Eagle's medium
containing 10% fetal bovine serum (Equitech, Ingram, Tex.), 25 mM
HEPES, 2 g of sodium bicarbonate per liter, 75 µg of glycine per
ml, 100 µg of ascorbic acid per ml, 40 ng of vitamin B12
per ml, 2 µg of p-aminobenzoic acid per ml, 200 ng of
biotin per ml, 100 U of penicillin per ml, 100 µg of streptomycin per
ml, and 0.25 µg of amphotericin B per ml (Fungizone) (pH 7.4) (60). Cells were seeded at a density of 105 per
well in 12-well cluster plates and incubated at 37°C in a 5%
CO2 atmosphere until they reached confluence (6 to 7 days). Greater than 99% of these cells expressed markers of osteoblasts, including type I collagen, osteocalcin, and alkaline phosphatase when
subjected to immunofluorimetric analyses as previously described (9).
Normal human osteoblast cultures.
Normal human osteoblasts
(Clonetics, San Diego, Calif.) were purchased and propagated in
accordance with the guidelines provided by the vendor and as previously
described by our laboratory (9). Cells were seeded in
25-cm2 flasks and incubated at 37°C in a 5%
CO2 atmosphere and medium supplied by the manufacturer,
which contained 10% fetal calf serum, ascorbic acid, gentamicin, and
amphotericin B. After the cells reached approximately 80% confluence
(5 to 9 days), they were removed from the flasks using 0.025%
trypsin-0.01% EDTA, washed in medium, and seeded into six-well
plates. After the cells reached approximately 80% confluence (6 to 7 days), they were infected with bacteria as described below. These
commercially available cells have been extensively characterized as
osteoblasts (28).
Exposure of cultured mouse and human osteoblasts to bacteria.
S. aureus strain UAMS-1 (ATCC 49230) is a clinical
osteomyelitis isolate and was grown overnight in 5 ml of tryptic soy
broth in a shaking water bath at 37°C. S. dublin strain
SL1363 is a wild-type strain found in mice which is pathogenic and
potentially lethal when given to susceptible mice (50% lethal dose,
106 bacteria) and was grown overnight in 5 ml of Luria
broth at 37°C. Bacteria were harvested by centrifugation for 10 min
at 4,300 × g at 4°C and washed once in 5 ml of Hanks
balanced salt solution. The pellet was then resuspended in 5 ml of OBGM
without antibiotics. Confluent layers of osteoblasts were exposed to
S. aureus or Salmonella suspensions at the
indicated ratios of bacteria to osteoblasts in 4 ml of OBGM without
antibiotics for 45 min at 37°C. After the bacteria had been washed
off the osteoblasts, the cultures were incubated for 3 h in 4 ml
of OBGM supplemented with 25 µg of gentamicin per ml to kill any
remaining extracellular bacteria. Cultures were washed again and
incubated in gentamicin-containing medium for the indicated periods of
time for determination of CFU as previously described (19),
for RNA isolation, or for collection of culture supernates.
In some experiments, S. aureus or Salmonella
bacteria were exposed to short-wavelength (250-nm) UV light for 5 or 3 min, respectively, prior to addition to cultured osteoblasts. Times
used for UV inactivation were empirically determined to reduce the
percentage of viable bacteria to less than 0.01% as determined by
colony counting (19).
RNA isolation, reverse transcription, and semiquantitative
PCR.
At the indicated times, RNA was extracted from cultured mouse
osteoblasts, reverse transcribed, and subjected to semiquantitative reverse transcription (RT)-PCR as previously described (6-9, 47). Briefly, total RNA was isolated using TRIZOL Reagent
(Gibco-BRL, Gaithersburg, Md.) and 2 µg of total RNA was reverse
transcribed in the presence of random hexamers using 200 U of RNase
H-free Moloney leukemia virus reverse transcriptase (Superscript II; Gibco-BRL) in the buffer supplied by the manufacturer. PCR was performed on 5% of the total cDNA to quantify expression of the mRNAs
encoding interleukin-6 (IL-6), IL-12p40, IL-12p35, and glyceraldehyde 3-phosphate dehydrogenase (G3PDH) using denaturation at 95°C, annealing at 60°C, and extension at 72°C (Robocycler 40;
Stratagene, La Jolla, Calif.), with the first of 27 total cycles having
extended denaturation and annealing times. PCR primers were derived
from the published sequences of IL-3 (10), GM-CSF
(50), M-CSF (17), and G-CSF (75) and
included CTGATGCTCTTCCACCTGGGACTCC and
CATTCGCAGATGTAGGCAGGCAACA to amplify mouse IL-3,
TTTACTTTTCCTGGGCATTGTGGTC and CCGCATAGGTGGTAACTTGTGTTTC to amplify mouse GM-CSF, GGCTGGCTTGGCTTGGGATGATTCT and
GTCTGTCAGTCTCTGCCTGGATGCTG to amplify mouse M-CSF,
CGAAGGCTTCCCTGAGTGGCTGCTCTA and
GGACACCTCCTGCCCGGCGCTGG to amplify mouse G-CSF, and
CCATCACCATCTTCCAGGAGCGAG and CACAGTCTTCTGGGTGGCAGTGAT to amplify G3PDH.
Following PCR, 15% of each amplified sample was electrophoresed on
ethidium bromide-stained agarose gels and visualized under
UV
illumination. Densitometric analysis of the RT-PCR product
bands was
performed using NIH Image (obtained from the National
Institutes of
Health website [
http://rsb.info.nih.gov/nih-image]).
Each gel
image was imported into NIH Image by Adobe Photoshop
(Adobe Systems,
San Jose, Calif.), a gel-plotting macro was used
to outline the bands,
and the intensity was calculated on the
Uncalibrated OD
setting.
To ensure that similar amounts of input RNA were reverse transcribed,
RNA was quantified by DNA dipsticks prior to the cDNA
reactions
(InVitrogen, San Diego, Calif.). In addition, PCR amplification
of the
G3PDH housekeeping gene was performed on cDNA from each
sample to
ensure equal RNA input and RT similar efficiencies.
The identity of the
amplified fragments was verified by size comparison
with DNA standards
(Promega).
Quantification of IL-3, GM-CSF, M-CSF, and G-CSF secretion in
culture supernatants.
Capture enzyme-linked immunosorbent assays
(ELISAs) were performed to quantify mouse and human GM-CSF, G-CSF,
M-CSF, and IL-3 secretion using a methodology which has been previously
described (7, 8). The following pairs of capture and
detection antibodies were used to quantify mouse CSF secretion,
respectively: anti-mouse GM-CSF (clone MP1-22E9) and biotinylated
anti-mouse GM-CSF (clone MP1-31G6; PharMingen, San Diego, Calif.),
polyclonal anti-mouse G-CSF and biotinylated anti-mouse G-CSF (clone
67604.111; R&D Systems, Minneapolis, Minn.), polyclonal anti-mouse
M-CSF and biotinylated polyclonal anti-mouse M-CSF (R&D Systems), and
anti-mouse IL-3 (clone MP2-8F8) and biotinylated anti-mouse IL-3 (clone
MP2-43D11; PharMingen).
The following pairs of capture and detection antibodies were used to
quantify human CSF secretion, respectively: anti-human
GM-CSF (clone
BVD2-23B6) and biotinylated anti-human GM-CSF (clone
BVD2-21C11;
PharMingen), anti-human G-CSF (clone BVD-13-3A5) and
biotinylated
anti-human G-CSF (clone BVD11-37G10; PharMingen),
polyclonal anti-human
M-CSF and biotinylated anti-human M-CSF
(clone 26730.11; R&D Systems),
and anti-human IL-3 (clone BVD8-3G11)
and biotinylated anti-human
IL-3 (clone BVD3-1F9;
PharMingen).
It was necessary to biotinylate the anti-mouse G-CSF (clone 67604.111),
the polyclonal anti-mouse M-CSF, and the anti-human
M-CSF (clone
26730.11) antibodies in our laboratory since these
reagents were only
available in purified form. This was accomplished
using the EZ-Link
Sulfo-NHS biotinylation kit (Pierce, Rockford,
Ill.) in accordance with
the directions supplied by the
manufacturer.
Capture antibodies were used to coat high protein binding microtiter
plates (Corning, Corning, N.Y.) at 15 µg/ml for 18 h.
After
washing, antibody-coated plates were blocked with 2% bovine
serum
albumin (Sigma Chemical Co., St. Louis, Mo.) in phosphate-buffered
saline for 2 h; this was followed by addition of supernatants
taken from osteoblast cultures at the indicated times after bacterial
exposure. After overnight incubation, unbound material was washed
off
and biotinylated detection antibodies were added at 10 µg/ml
and the
mixture was incubated for 2 h. After washing, bound antibody
was
detected by addition of streptavidin-horseradish peroxidase
(Southern
Biotechnology Associates, Birmingham, Ala.) for 45 min;
the substrate
tetramethylbenzidine (Promega, Madison, Wis.) was
then added.
Colorimetric reactions were stopped by the addition
of 0.5 M
H
2SO
4, and
A450 was
measured (model 550 microplate reader;
Bio-Rad, Hercules, Calif.).
Cytokine levels in culture supernatants were quantified by
extrapolation from standard curves generated by determining absorbances
using limiting dilutions of recombinant cytokines purchased from
PharMingen or R&D Systems. The sensitivities of the ELISAs used
to
quantify mouse or human CSF were determined to be 50 and 50
pg/ml for
GM-CSF, 30 and 40 pg/ml for G-CSF, 90 and 60 pg/ml for
M-CSF, and 30 and 50 pg/ml for IL-3. Results are presented as
means of triplicate
determinations ± standard deviations. Statistically
significant
differences in CSF secretion were determined using
the Student
t test (GraphPad, San Diego, Calif.).
Transwell cocultures of bacterium-exposed mouse osteoblasts and
unexposed mouse osteoblasts.
Mouse osteoblasts were cultured in
the bottom chamber of a 12-well Transwell (Corning) tissue culture
plate and exposed to S. aureus or Salmonella at
various ratios of bacteria to osteoblasts in medium containing no
antibiotics. After 45 min, extracellular bacteria were washed off and
culture medium containing gentamicin was added. Unexposed mouse
osteoblasts were also cultured in the upper Transwell chamber and
physically separated from the bacterium-exposed osteoblasts by a
0.45-µm-pore-size membrane. Cells were cocultured for 12 h, and
then RNA was isolated from cells within the upper and lower chambers.
RT-PCR was performed to detect CSF mRNA expression as described above.
 |
RESULTS |
Enumeration of viable intracellular bacteria following exposure of
mouse osteoblasts.
The ability of S. aureus and
Salmonella to enter mouse osteoblasts was demonstrated using
a measurement of viable intracellular bacteria. Mouse osteoblasts were
exposed to the indicated numbers of bacteria for 45 min in medium
without antibiotics. After washing off of extracellular bacteria,
medium containing gentamicin was added for 3 h of incubation to
kill the remaining extracellular bacteria. This procedure was
demonstrated to be completely effective in eliminating extracellular
viable bacteria as determined by plating of culture supernatants onto
tryptic soy agar to quantify the number of viable extracellular
bacteria remaining. Following bacterial inoculation, osteoblasts were
lysed and dilutions of the lysates were plated onto tryptic soy agar to
quantify the number of viable bacteria present. At an initial exposure
ratio of 250 S. aureus bacteria to one osteoblast,
approximately 1 viable bacterium remained per osteoblast at 3 h
postexposure (Table 1). A similar result
was obtained for Salmonella at an initial exposure ratio of
10 bacteria to one osteoblast. Taken together, the results in Table 1
serve to illustrate the small number of viable bacteria which remained
following the brief initial exposure of the cultured osteoblasts to
S. aureus or Salmonella.
S. aureus-induced CSF mRNA expression by mouse
osteoblasts.
Mouse osteoblasts were cultured in the presence of
various numbers of S. aureus bacteria for 45 min, and then
viable extracellular bacteria were eliminated. At various times
postexposure, RNA was isolated from these cells and a semiquantitative
RT-PCR was performed to determine CSF mRNA expression. GM-CSF and G-CSF
mRNAs were each induced more than 15-fold from minimal constitutive
levels by 12 h postexposure at an initial exposure ratio of 250:1
(Fig. 1). Importantly, increases in mRNA
levels occurred in a dose-dependent manner that paralleled the numbers
of S. aureus bacteria initially added. In five different
RT-PCR analyses, measurable levels of GM-CSF and G-CSF mRNAs were
always induced (14.4 ± 3.4- and 12.6 ± 3.9-fold,
respectively, by 12 h postexposure). This was in contrast to M-CSF
and IL-3 mRNA expression, which was constitutive but did not increase
significantly by 12 h postinfection. These time-dependent increases in GM-CSF and G-CSF message expression could not be ascribed
to differences in input RNA or to differences in the efficiency of RT,
as evidenced by RT-PCR amplification of the G3PDH housekeeping gene for
each sample.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
CSF mRNA expression following exposure of mouse
osteoblasts to S. aureus. Murine osteoblasts were left
unexposed (lanes 0) or exposed to S. aureus at the indicated
ratio (250:1, 75:1, or 25:1 bacterium-to-osteoblast ratio) for 45 min,
and then extracellular bacteria were removed. RNA was isolated 6, 12, and 24 h following exposure to bacteria, and semiquantitative
RT-PCR was performed for each mRNA species. Results are presented as
amplified products electrophoresed on ethidium bromide-stained agarose
gels. RT-PCR amplification of the G3PDH housekeeping gene was performed
to ensure that similar amounts of input RNA and similar RT efficiencies
were being compared. These studies were performed three times with
similar results.
|
|
These results were observed in a second set of experiments (Fig.
2), which also included expression of CSF
mRNA following
interaction with UV-killed
S. aureus. It was
clear from these
studies that UV-killed
S. aureus had a
reduced capacity to induce
GM-CSF and G-CSF mRNA expression compared to
viable bacteria (e.g.,
5.0- and 2.4-fold reductions, respectively, at
12 h for an initial
exposure ratio of 250:1).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 2.
CSF mRNA expression following exposure of mouse
osteoblasts to viable or UV-killed S. aureus. Murine
osteoblasts were left unexposed (lanes 0) or exposed to viable or
UV-killed S. aureus at the indicated ratio (250:1, 75:1, or
25:1 bacterium-to-osteoblast ratio) for 45 min, and then extracellular
bacteria were removed. RNA was isolated 6 and 12 h following
exposure to bacteria, and a semiquantitative RT-PCR was performed for
each mRNA species. Results are presented as amplified products
electrophoresed on ethidium bromide-stained agarose gels. RT-PCR
amplification of the G3PDH housekeeping gene was performed to ensure
that similar amounts of input RNA and similar RT efficiencies were
being compared. These studies were performed three times with similar
results.
|
|
Salmonella-induced CSF mRNA expression by mouse
osteoblasts.
Similar experiments were performed to assess the
ability of Salmonella to induce CSF mRNA expression by mouse
osteoblasts. As shown in Fig. 3,
Salmonella was a potent inducer of GM-CSF and G-CSF mRNA
expression (e.g., each greater than 22-fold at 6 h for an initial
exposure ratio of 10:1) but could not significantly increase expression
of mRNA encoding M-CSF or IL-3 over constitutive levels (Fig. 3).
Surprisingly, UV-killed Salmonella was also a potent
stimulator of GM-CSF and G-CSF mRNA expression (e.g., each greater than
20-fold at 6 h for an initial exposure ratio of 10:1).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 3.
CSF mRNA expression following exposure of mouse
osteoblasts to Salmonella. Murine osteoblasts were exposed
to S. dublin at the indicated ratio (30:1, 10:1 or 3:1
bacterium-to-osteoblast ratio) for 45 min, and then extracellular
bacteria were removed. RNA was isolated 6 and 12 h following
exposure to bacteria, and a semiquantitative RT-PCR was performed for
each mRNA species. Results are presented as amplified products
electrophoresed on ethidium bromide-stained agarose gels. RT-PCR
amplification of the G3PDH housekeeping gene was performed to ensure
that similar amounts of input RNA and similar RT efficiencies were
being compared. These studies were performed three times with similar
results.
|
|
S. aureus-induced CSF secretion by mouse
osteoblasts.
To determine whether the elevations in mRNA encoding
GM-CSF in mouse osteoblasts exposed to S. aureus seen in the
previous figures were mirrored by alterations in the translation and
secretion of this cytokine, specific capture ELISAs were performed.
Culture supernatants of untreated osteoblasts or osteoblasts exposed to various numbers of S. aureus bacteria for 24 and 48 h
were assayed for the presence of CSF. Figure
4 shows the results of one such set of
assays. Viable S. aureus induced GM-CSF and G-CSF secretion as early as 24 h postexposure, and this production continued to increase by 48 h. A dose-response relationship between cytokine secretion and the inoculum of S. aureus used was observed.
Conversely, UV-killed S. aureus was much less potent an
inducer of these two CSF. Production of M-CSF was observed, but the
presence of viable or UV-killed S. aureus did not
significantly alter the constitutive secretion of this cytokine (Fig.
4). IL-3 secretion by mouse osteoblasts was below the level of
sensitivity of the ELISA (i.e., 30 pg/ml) under all of the experimental
conditions used.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
Dose-dependent S. aureus (Staph) induction of
CSF secretion by cultured mouse osteoblasts. Osteoblasts
(107) were exposed to various numbers of viable or
UV-killed S. aureus bacteria (250:1, 75:1, and 25:1
bacterium-to-osteoblast ratios) for 45 min. Extracellular bacteria were
then eliminated, and culture supernatants were taken 24 and 48 h
postexposure. Specific capture ELISAs were performed to quantify CSF
secretion. Results are presented as means of triplicate
determinations ± standard deviations. These studies were
performed three times with similar results.
|
|
Salmonella-induced CSF secretion by mouse
osteoblasts.
Interaction with viable Salmonella was
especially potent at inducing GM-CSF secretion, whereas interaction
with UV-killed bacteria was approximately 20-fold less effective (Fig.
5). A similar trend was observed for
Salmonella-induced G-CSF secretion; however, reductions in
G-CSF secretion following interaction with UV-killed
Salmonella were less than threefold compared to the levels
obtained following infection with viable bacteria.
Salmonella did not increase M-CSF secretion over
constitutive levels, and no detectable IL-3 secretion was observed
(Fig. 5).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 5.
Dose-dependent Salmonella induction of CSF
secretion by cultured mouse osteoblasts. Osteoblasts (107)
were exposed to various numbers of viable or UV-killed
Salmonella bacteria (30:1, 10:1, and 3:1
bacterium-to-osteoblast ratios) for 45 min. Extracellular bacteria were
then eliminated, and culture supernatants were taken 24 and 48 h
postexposure. Specific capture ELISAs were performed to quantify CSF
secretion. Results are presented as means of triplicate
determinations ± standard deviations. These studies were
performed three times with similar results.
|
|
S. aureus-induced CSF secretion by human
osteoblasts.
The abilities of bacteria to interact with mouse
osteoblasts and to induce dramatic GM-CSF and G-CSF expression were
surprising, since these cells are not known for the ability to mount a
host response against infection. We next investigated whether a similar osteoblast-initiated host response is common to cultured human osteoblasts. Normal human osteoblasts were obtained (Clonetics) and
subcultured in our laboratory as previously described (9). Following treatment with various inoculums of S. aureus or
Salmonella, supernatants were taken from these cultures and
ELISAs were performed to quantify CSF secretion. Exposure of
osteoblasts to S. aureus (Fig.
6) or Salmonella (Fig.
7) induced substantial GM-CSF and G-CSF
secretion in a dose-dependent manner. As with mouse osteoblasts, UV-inactivated bacteria were less effective in stimulating the secretion of these particular CSF. Furthermore, the cytokine quantities secreted by human osteoblasts were similar to those secreted by mouse
osteoblasts when differences in cell culture density were taken into
account. Thus, for GM-CSF and G-CSF secretion, human and mouse
osteoblasts had similar responses to the presence of these bacteria.
The fact that both mouse and human osteoblasts respond to bacterial
exposure with CSF secretion suggests that this is a conserved response
and adds further weight to the potential importance of this finding.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 6.
Dose-dependent S. aureus (Staph) induction of
CSF secretion by cultured human osteoblasts. Osteoblasts (3 × 106) were exposed to various numbers of viable or UV-killed
S. aureus bacteria (250:1, 75:1, and 25:1
bacterium-to-osteoblast ratios) for 45 min. Extracellular bacteria were
then eliminated, and culture supernatants were taken 24 and 48 h
postexposure. Specific capture ELISAs were performed to quantify CSF
secretion. Results are presented as means of triplicate
determinations ± standard deviations. These studies were
performed twice with similar results.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 7.
Dose-dependent Salmonella induction of CSF
secretion by cultured human osteoblasts. Human osteoblasts (3 × 106) were exposed to various numbers of viable or UV-killed
Salmonella bacteria (30:1, 10:1, and 3:1
bacterium-to-osteoblast ratios) for 45 min. Extracellular bacteria were
then eliminated, and culture supernatants were taken 24 and 48 h
postexposure. Specific capture ELISAs were performed to quantify CSF
secretion. Results are presented as means of triplicate
determinations ± standard deviations. These studies were
performed twice with similar results.
|
|
However, unlike mouse osteoblasts, human osteoblasts upregulated their
expression of M-CSF in response to both
S. aureus (Fig.
6)
and
Salmonella (Fig.
7). While there was constitutive
expression
of M-CSF by these cells, exposure to viable bacteria
elicited
further induction of this cytokine. These increases followed a
dose response, and it was especially surprising to find that UV-killed
bacteria were similar to viable bacteria in the ability to augment
M-CSF secretion (Fig.
6 and
7). These results suggest that, while
similar, the human osteoblast response to bacteria includes some
increases in M-CSF secretion, a finding that was not observed
using
murine
osteoblasts.
Finally, human osteoblasts did not secrete detectable levels of IL-3 in
response to
S. aureus or
Salmonella exposure
(Fig.
6 and
7). Taken together with the results obtained with mouse
osteoblast cultures, these data suggest that osteoblasts are not
a
significant source of IL-3 during a host response to bacterial
exposure.
Soluble factors contribute to the induction of GM-CSF and G-CSF in
infected mouse osteoblasts.
There are at least two possible
mechanisms for bacterium-induced CSF secretion by osteoblasts. Direct
interaction of bacteria with osteoblasts could provide signals which
activate transcription of the appropriate genes, followed by
translation and secretion. Alternatively, the interaction of bacteria
with osteoblasts could induce these cells to secrete other soluble
factors which could act in an autocrine or paracrine manner to induce
GM-CSF or G-CSF expression indirectly. To address the latter
possibility, a Transwell culture system was used. Mouse osteoblasts
were grown in the bottom chamber of a Transwell plate, and these cells
were exposed to various doses of viable S. aureus or
Salmonella bacteria, followed by elimination of
extracellular bacteria as in all of the previous experiments. Upper
chambers were then placed in the Transwell plates containing uninfected
osteoblasts. This created a coculture of infected osteoblasts in the
lower chamber that were separated by a 0.2-µm membrane from the
uninfected osteoblasts in the upper chamber. After 12 h of
coculture, RNA was isolated from cells in the upper and lower chambers
and assayed by RT-PCR for expression of mRNAs. As expected, S. aureus- or Salmonella-infected osteoblasts in the lower
chamber demonstrated significant increases in GM-CSF and G-CSF mRNA
expression (Fig. 8). However, we were
surprised to find that uninfected osteoblasts in the upper chamber also had increased levels of GM-CSF and G-CSF mRNA expression, albeit to a
lesser degree than that observed in infected osteoblasts. These
dose-dependent increases in GM-CSF and G-CSF message expression could
not be ascribed to differences in input RNA or to differences in the
efficiency of RT, as evidenced by RT-PCR amplification of the G3PDH
housekeeping gene for each sample (Fig. 8).

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 8.
Induction of G-CSF and GM-CSF mRNA expression in
cocultures of bacterially exposed and unexposed osteoblasts. Mouse
osteoblasts were used to seed the upper and lower chambers of Transwell
plates. Osteoblasts in the lower chamber were left unexposed (lane 0)
or exposed to S. aureus or Salmonella at the
indicated ratios (250:1 and 75:1 or 10:1 and 3:1
bacterium-to-osteoblast ratios, respectively) for 45 min, and then
extracellular bacteria were removed. Following exposure of osteoblasts
in the lower chamber, upper chambers containing unexposed osteoblasts
were positioned in the Transwell plates. RNA was isolated from the
upper and lower chambers 12 h following exposure to bacteria, and
a semiquantitative RT-PCR was performed for each mRNA species. Results
are presented as amplified products electrophoresed on ethidium
bromide-stained agarose gels. RT-PCR amplification of the G3PDH
housekeeping gene was performed to ensure that similar amounts of input
RNA and similar RT efficiencies were being compared. These studies were
performed twice with similar results.
|
|
Importantly, bacteria were not the source of this soluble factor, as
determined in experiments in which viable
S. aureus bacteria
(top chamber) were separated from murine osteoblasts (lower chamber)
within a Transwell plate. Viable
S. aureus bacteria were
added
to the top chamber and incubated for 45 min, during which time
osteoblasts were present in the bottom chamber but not in direct
contact with the bacteria. After 45 min, gentamicin was added
to each
chamber. At 48 h later, supernatants were taken from the
bottom
chamber containing the osteoblasts and ELISAs were used
to quantify
GM-CSF or G-CSF secretion. Less than 100 pg of CSF
secretion per ml was
observed (data not shown). These studies
demonstrate the necessity of
S. aureus to directly interact with
osteoblasts to induce a
host response. Furthermore, addition of
staphylococcal enterotoxin A at
various concentrations (10, 1,
and 0.1 ng/ml) induced no significant
IL-12, IL-6, or GM-CSF secretion
48 h postaddition to murine
osteoblasts compared to untreated
cultures. These results further
support the notion that
S. aureus-induced
effects on
osteoblasts are not mediated via soluble factors of
bacterial origin
but require cellular
contact.
Taken together, these results demonstrate that a soluble factor
produced in cultures of osteoblasts directly exposed to bacteria
can
act in a paracrine manner to stimulate the expression of GM-CSF
and
G-CSF mRNAs in normal, uninfected
osteoblasts.
 |
DISCUSSION |
These studies represent the first comprehensive analysis of
bacterially induced CSF production by cultured mouse and human osteoblasts. The results presented here were surprising in that they
demonstrated an unexpected ability of osteoblasts to respond to
bacterial exposure by secreting high levels of GM-CSF and G-CSF. The
amounts of CSF secreted by exposed osteoblasts were similar to that
reported for activated macrophages (43, 64), supporting the
relative biological importance of these findings. Furthermore, the
conservation of osteoblast-derived GM-CSF and G-CSF secretion in
response to bacterial exposure between humans and mice suggests the
fundamental nature of this response. Taken together, the present results support the notion that osteoblasts can contribute to the host
response during bone infection by acting as a significant source of
cytokine secretion.
Bone resorption following infection is well documented; however, the
mechanisms responsible for such clinical observations are not
altogether clear (55). The present demonstration that bacterially exposed human osteoblasts can be induced to become potent
secretors of GM-CSF, G-CSF, and M-CSF could have a significant impact
on this process. These cytokines are believed to be important growth
factors regulating the proliferation and differentiation of myeloid
osteoclast precursors (2, 48, 54). The increased production
of these growth factors mediated by S. aureus or
Salmonella may significantly increase osteoclast numbers.
Furthermore, we have previously reported (9) that S. aureus infection of osteoblasts induces substantial IL-6
secretion. It is well documented that osteoblast-derived IL-6 can
directly or indirectly modulate the activity of bone-resorptive
osteoclasts (18, 27, 31, 35), resulting in induction of
osteoclast differentiation or osteoclast-mediated bone
demineralization. The fact that viable bacteria can induce IL-6,
GM-CSF, G-CSF, and M-CSF secretion from human osteoblasts points to the
induction of a cytokine environment which would favor
osteoclastogenesis during infection. Since bone diseases commonly
result in aberrant bone remodeling, it is tempting to speculate that
such a perturbation in the regulation of bone formation may result, in
large part, from cytokine-mediated increases in bone resorption in
infected tissue.
However, the process of osteoclastogenesis is a complex one, as
demonstrated by the multiple effects of GM-CSF on this process. GM-CSF
production or administration has been shown to limit the formation of
more mature, multinucleated osteoclasts (33, 65, 66, 76).
Therefore, excess GM-CSF production may also limit the latter stages of
osteoclast formation. It is important to consider the net effect of
this cytokine on osteoclastogenesis before definitive conclusions can
be drawn as to the importance of increased GM-CSF production by
osteoblasts during bone remodeling.
S. aureus and Salmonella are two common causative
agents of bone diseases (13, 44, 57, 81) and were chosen for
use in these investigations based on this fact. While common to bone diseases, these two pathogens have very dissimilar characteristics and
modes of invasion. S. aureus is a gram-positive pathogen
whose adherence to bone is an important component in its infectivity (14, 24) and possibly its formation of biofilms
(13). Conversely, Salmonella is a gram-negative
bacterium known for its ability to invade cells (23, 41).
Therefore, the studies presented here also allow the first general
comparisons concerning the types of responses elicited from osteoblasts
following exposure to two very different pathogens. It was surprising
to find that gram-positive and gram-negative bacteria were able to
induce similar patterns of CSF secretion following interaction with
osteoblasts. It is not clear why the profiles are similar, but this
similarity may be suggestive of a common mechanism of activation. While
staphylococci are typically regarded as noninvasive, extracellular
pathogens that damage host cells after adhering to the extracellular
matrix (14, 24), several recent studies have shown that
S. aureus can be internalized by a number of cell types that
are not generally considered to be phagocytic (1, 4, 53,
77). Indeed, several recent reports (19, 34, 36, 61)
have demonstrated that S. aureus can be internalized by
osteoblasts and persist intracellularly. Based on these observations,
it is tempting to speculate that one component of S. aureus-mediated bone disease would be cell invasion and
persistence, which allows these bacteria to evade humoral or
neutrophil-mediated destruction. While the present study does not
directly address the importance of viable intracellular bacteria in
augmenting CSF production, it is clear that nonviable (and presumably
noninvasive) bacteria induced less cytokine secretion. Thus, it is
tempting to speculate that signals generated following intracellular
invasion by viable bacteria are an important component of the induction
of optimal CSF secretion; however, additional studies are required to
define such mechanisms.
The major functions of osteoblasts include the formation of new bone
and the modulation of osteoclast activity; however, evidence is
increasing that osteoblasts have a surprising ability to respond to
pathogens in a manner normally attributed to cells of the immune system. Recent studies in our laboratory have shown the ability of
cultured mouse and human osteoblasts exposed to S. aureus
(9) or Salmonella (unpublished data) to express
high levels of IL-6 and IL-12p75. The ability of IL-6 (78),
IL-12 (74), GM-CSF (26), and G-CSF
(15) to augment immune responses against bacterial infections is well documented. In fact, GM-CSF has been found to
augment the immune response against both S. aureus and
Salmonella infections (16, 25, 26, 49, 52). The
observation that both human and mouse osteoblasts can secrete
significant levels of GM-CSF following exposure to either bacterium
supports the notion that osteoblast-derived cytokines might
significantly contribute to the development of a protective host
response. Taken together, the present and previous (9)
findings suggest that a third significant function of osteoblasts is an
ability to contribute to the initiation of a host immune response
following bone infection.
In addition to the potential protective effects of increased cytokine
production by bacterially challenged osteoblasts, it should also be
noted that such secretion might contribute to the destructive
inflammation associated with bone infection. It is clear that cultured
osteoblasts can secrete substantial amounts of IL-6 (9),
IL-12 (9), GM-CSF, and G-CSF in response to bacterial
exposure. Furthermore, our results indicate that maximal amounts of
these cytokines occur with the presence of viable intracellular bacteria. This finding suggests that maximal cytokine secretion would
accompany an active or chronic infection. In such a scenario, increased
local cytokine production by osteoblasts responding to viable bacteria
could serve to sustain the inflammatory immune response by maintaining
the activated status of infiltrating macrophages, neutrophils, and/or
lymphocytes at the site of infection.
 |
ACKNOWLEDGMENTS |
This work was supported by the North Carolina Biotechnology
Center, the University of North Carolina at Charlotte Foundation, and
the Foundation for the Carolinas.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biology, UNC Charlotte, 9201 University City Blvd., Charlotte, NC
28223. Phone: (704) 547-2909. Fax: (704) 547-3128. E-mail:
klbost{at}emailuncc.edu.
Editor:
R. N. Moore
 |
REFERENCES |
| 1.
|
Almeida, R. A.,
K. R. Mathews,
E. Cifrian,
A. J. Guidry, and S. P. Oliver.
1996.
Staphylococcus aureus invasion of bovine mammary epithelial cells.
J. Dairy Sci.
79:1021-1026[Abstract].
|
| 2.
|
Al-Saffar, N.,
H. A. Khwaja,
Y. Kadoya, and P. A. Revell.
1996.
Assessment of the role of GM-CSF in the cellular transformation and the development of erosive lesions around orthopaedic implants.
Am. J. Clin. Pathol.
105:628-639[Medline].
|
| 3.
|
Aubin, J. E.
1998.
Advances in the osteoblast lineage.
Biochem. Cell Biol.
76:899-910[CrossRef][Medline].
|
| 4.
|
Bayles, K. W.,
C. A. Wesson,
L. E. Liou,
L. K. Fox,
G. A. Bohach, and W. R. Trumble.
1998.
Intracellular Staphylococcus aureus escapes the endosome and induces apoptosis in epithelial cells.
Infect. Immun.
66:336-342[Abstract/Free Full Text].
|
| 5.
|
Begg, S. K.,
J. M. Radley,
J. W. Pollard,
O. T. Chisholm,
E. R. Stanley, and I. Bertoncello.
1993.
Delayed hematopoietic development in osteopetrotic (op/op) mice.
J. Exp. Med.
177:237-242[Abstract/Free Full Text].
|
| 6.
|
Bost, K. L., and J. D. Clements.
1995.
In vivo induction of interleukin-12 mRNA expression after oral immunization with Salmonella dublin or the B subunit of Escherichia coli heat-labile enterotoxin.
Infect. Immun.
63:1076-1083[Abstract].
|
| 7.
|
Bost, K. L., and J. D. Clements.
1997.
Intracellular Salmonella dublin induces substantial secretion of the 40-kilodalton subunit of interleukin-12 (IL-12) but minimal secretion of IL-12 as a 70-kilodalton protein in murine macrophages.
Infect. Immun.
65:3186-3192[Abstract].
|
| 8.
|
Bost, K. L., and M. J. Mason.
1995.
Thapsigargin and cyclopiazonic acid initiate rapid and dramatic increases of IL-6 mRNA expression and IL-6 secretion in murine peritoneal macrophages.
J. Immunol.
155:285-296[Abstract].
|
| 9.
|
Bost, K. L.,
W. K. Ramp,
N. C. Nicholson,
J. L. Bento,
I. Marriott, and C. M. Hudson.
1999.
Staphylococcus aureus infection of mouse or human osteoblasts induces high levels of interleukin-6 and interleukin-12 production.
J. Infect. Dis.
180:1912-1920[CrossRef][Medline].
|
| 10.
|
Campbell, H. D.,
S. Ymer,
M. C. Fung, and I. G. Young.
1985.
Cloning and nucleotide sequence of the murine interleukin-3 gene.
Eur. J. Biochem.
150:297-304[Medline].
|
| 11.
|
Cecchini, M. G.,
W. Hofstetter,
J. Halasy,
A. Wetterwald, and R. Felix.
1997.
Role of CSF-1 in bone and bone marrow development.
Mol. Reprod. Dev.
46:75-83[CrossRef][Medline].
|
| 12.
|
Corboz, V. A.,
M. G. Cecchini,
R. Felix,
H. Fleisch,
G. van der Pluijm, and C. W. Lowik.
1992.
Effect of macrophage colony-stimulating factor on in vitro osteoclast generation and bone resorption.
Endocrinology
130:437-442[Abstract/Free Full Text].
|
| 13.
|
Costerton, J. W.,
P. S. Stewart, and E. P. Greenberg.
1999.
Bacterial biofilms: a common cause of persistent infections.
Science
284:1318-1322[Abstract/Free Full Text].
|
| 14.
|
Cunningham, R.,
A. Cockayne, and H. Humphreys.
1996.
Clinical and molecular aspects of the pathogenesis of Staphylococcus aureus bone and joint infections.
J. Med. Microbiol.
44:157-164[Abstract/Free Full Text].
|
| 15.
|
Dale, D. C.,
W. C. Liles,
W. R. Summer, and S. Nelson.
1995.
Review: granulocyte colony-stimulating factor role and relationships in infectious diseases.
J. Infect. Dis.
172:1061-1075[Medline].
|
| 16.
|
Daley, M.,
T. Williams,
P. Coyle,
G. Furda,
R. Dougherty, and P. Hayes.
1993.
Prevention and treatment of Staphylococcus aureus infections with recombinant cytokines.
Cytokine
5:276-284[CrossRef][Medline].
|
| 17.
|
DeLamarter, J. F.,
C. Hession,
D. Semon,
N. M. Gough,
R. Rothenbuhler, and J. J. Mermod.
1987.
Nucleotide sequence of a cDNA encoding murine CSF-1 (macrophage-CSF).
Nucleic Acids Res.
15:2389-2390[Free Full Text].
|
| 18.
|
de la Mata, J.,
H. L. Uy,
T. A. Guise,
B. Story,
B. F. Boyce,
G. R. Mundy, and G. D. Roodman.
1995.
Interleukin-6 enhances hypercalcemia and bone resorption mediated by parathyroid hormone-related protein in vivo.
J. Clin. Investig.
95:2846-2852.
|
| 19.
|
Ellington, J. K.,
S. S. Reilly,
W. K. Ramp,
M. S. Smeltzer,
J. F. Kellam, and M. C. Hudson.
1999.
Mechanisms of Staphylococcus aureus invasion of cultured osteoblasts.
Microb. Pathog.
26:317-323[CrossRef][Medline].
|
| 20.
|
Felix, R.,
M. G. Cecchini,
W. Hofstetter,
P. R. Elford,
A. Stutzer, and H. Fleisch.
1990.
Impairment of macrophage colony-stimulating factor production and lack of resident bone marrow macrophages in the osteopetrotic op/op mouse.
J. Bone Miner. Res.
5:781-789[Medline].
|
| 21.
|
Felix, R. M.,
G. Cecchini,
W. Hofstetter,
H. L. Guenther, and H. Fleisch.
1991.
Production of granulocyte-macrophage (GM-CSF) and granulocyte colony-stimulating factor (G-CSF) by rat clonal osteoblastic cell population CRP 10/30 and the immortalized cell line IRC10/30-myc1 stimulated by tumor necrosis factor alpha.
Endocrinology
128:661-667[Abstract/Free Full Text].
|
| 22.
|
Felix, R.,
J. Halasy-Nagy,
A. M. Wetterwald,
G. Cecchini,
H. Fleisch, and W. Hofstetter.
1996.
Synthesis of membrane- and matrix-bound colony-stimulating factor-1 by cultured osteoblasts.
J. Cell. Physiol.
166:311-322[CrossRef][Medline].
|
| 23.
|
Finlay, B. B.
1994.
Molecular and cellular mechanisms of Salmonella pathogenesis.
Curr. Top. Microbiol. Immunol.
192:163-185[Medline].
|
| 24.
|
Foster, T. J., and M. Hook.
1998.
Surface protein adhesins of Staphylococcus aureus.
Trends Microbiol.
6:484-488[CrossRef][Medline].
|
| 25.
|
Frenck, R. W.,
G. Sarman,
T. E. Harper, and E. S. Buescher.
1990.
The ability of recombinant murine granulocyte-macrophage colony-stimulating factor to protect neonatal rats from septic death due to Staphylococcus aureus.
J. Infect. Dis.
162:109-114[Medline].
|
| 26.
|
Freund, M., and H. D. Kleine.
1992.
The role of GM-CSF in infection.
Infection
20:S84-S92.
|
| 27.
|
Greenfield, E. M.,
S. M. Shaw,
S. A. Gornik, and M. A. Banks.
1995.
Adenyl cyclase and interleukin 6 are downstream effectors of parathyroid hormone resulting in stimulation of bone resorption.
J. Clin. Investig.
96:1238-1244.
|
| 28.
|
Gundle, R., and J. N. Beresford.
1995.
The isolation and culture of cells from explants of human trabecular bone.
Calcif. Tissue Int.
56:S8-S10.
|
| 29.
|
Hattersley, G., and T. J. Chambers.
1990.
Effects of interleukin 3 and of granulocyte-macrophage and macrophage colony stimulating factors on osteoclast differentiation from mouse hemopoietic tissue.
J. Cell. Physiol.
142:201-209[CrossRef][Medline].
|
| 30.
|
Hattersley, G.,
J. Owens,
A. M. Flanagan, and T. J. Chambers.
1991.
Macrophage colony stimulating factor (M-CSF) is essential for osteoclast formation in vitro.
Biochem. Biophys. Res. Commun.
177:526-531[CrossRef][Medline].
|
| 31.
|
Hofbauer, L. C., and A. E. Heufelder.
1996.
Intercellular chatter: osteoblasts, osteoclast and interleukin 6.
Eur. J. Endocrinol.
134:425-426[Abstract/Free Full Text].
|
| 32.
|
Horowitz, M. C.,
D. L. Coleman,
P. M. Flood,
T. S. Kupper, and R. L. Jilka.
1989.
Parathyroid hormone and lipopolysaccharide induce murine osteoblast-like cells to secrete a cytokine indistinguishable from granulocyte-macrophage colony-stimulating factor.
J. Clin. Investig.
83:149-157.
|
| 33.
|
Horwood, N. J.,
N. Udagawa,
J. Elliott,
D. Grail,
H. Okamura,
M. Kurimoto,
A. R. Dunn,
T. Martin, and M. T. Gillespie.
1998.
Interleukin 18 inhibits osteoclast formation via T cell production of granulocyte macrophage colony-stimulating factor.
J. Clin. Investig.
101:595-603[Medline].
|
| 34.
|
Hudson, M. C.,
W. K. Ramp,
N. C. Nicholson,
A. S. Williams, and M. T. Nousiainen.
1995.
Internalization of Staphylococcus aureus by cultured osteoblasts.
Microb. Pathog.
19:409-419[CrossRef][Medline].
|
| 35.
|
Ishimi, Y.,
C. Miyaura,
C. H. Jin,
T. Akatsu,
E. Abe,
Y. Nakamura,
A. Yamaguchi,
S. Yoshiki,
T. Matsuda, and T. Hirano.
1990.
IL-6 is produced by osteoblasts and induces bone resorption.
J. Immunol.
145:3297-3303[Abstract].
|
| 36.
|
Jevon, M.,
C. Guo,
B. Ma,
N. Mordan,
S. P. Nair,
M. Harris,
B. Henderson,
G. Bentley, and S. Mehiji.
1999.
Mechanisms of internalization of Staphylococcus aureus by cultured human osteoblasts.
Infect. Immun.
67:2677-2681[Abstract/Free Full Text].
|
| 37.
|
Jimi, E.,
T. Shuto, and T. Koga.
1995.
Macrophage colony-stimulating factor and interleukin-1 alpha maintain the survival of osteoclast-like cells.
Endocrinology
136:808-811[Abstract].
|
| 38.
|
Kaplan, D. L.,
C. M. Eielson,
M. C. Horowitz,
K. L. Insogna, and E. C. Weir.
1996.
Tumor necrosis factor-alpha induces transcription of the colony-stimulating factor-1 gene in murine osteoblasts.
J. Cell. Physiol.
168:199-208[CrossRef][Medline].
|
| 39.
|
Kodama, H.,
M. Nose,
S. Niida, and A. Yamasaki.
1991.
Essential role of macrophage colony-stimulating factor in the osteoclast differentiation supported by stromal cells.
J. Exp. Med.
173:1291-1294[Abstract/Free Full Text].
|
| 40.
|
Kodama, H.,
A. Yamasaki,
M. Nose,
S. Niida,
Y. Ohgame,
M. Abe,
M. Kumegawa, and T. Suda.
1991.
Congenital osteoclast deficiency in osteopetrotic (op/op) mice is cured by injections of macrophage colony-stimulating factor.
J. Exp. Med.
173:269-272[Abstract/Free Full Text].
|
| 41.
|
Lee, V. T., and O. Schneewind.
1999.
Type III machines of pathogenic yersiniae secrete virulence factors into the extracellular milieu.
Mol. Microbiol.
31:1619-1629[CrossRef][Medline].
|
| 42.
|
Lees, R. L., and J. N. Heersche.
1999.
Macrophage colony stimulating factor increases bone resorption in dispersed osteoclast cultures by increasing osteoclast size.
J. Bone Miner. Res.
14:937-945[CrossRef][Medline].
|
| 43.
|
Lenhoff, S.,
B. Sallerfors, and T. Olofsson.
1998.
IL-10 as an autocrine regulator of CSF secretion by monocytes: disparate effects on GM-CSF and G-CSF secretion.
Exp. Hematol.
26:299-304[Medline].
|
| 44.
|
Lew, D. P., and F. A. Waldvogel.
1997.
Osteomyelitis.
N. Engl. J. Med.
336:999-1007[Free Full Text].
|
| 45.
|
Liggett, W., Jr.,
N. Shevde,
P. Anklesaria,
S. Sohoni,
J. Greenberger, and J. Glowacki.
1993.
Effects of macrophage colony stimulating factor and granulocyte-macrophage colony stimulating factor on osteoclastic differentiation of hematopoietic progenitor cells.
Stem Cells
11:398-411[Abstract].
|
| 46.
|
Lorenzo, J. A.,
S. L. Sousa,
J. M. Fonseca,
J. M. Hock, and E. S. Medlock.
1987.
Colony-stimulating factors regulate the development of multinucleated osteoclasts from recently replicated cells in vitro.
J. Clin. Investig.
80:160-164.
|
| 47.
|
Marriott, I.,
K. L. Bost, and M. J. Mason.
1998.
Differential kinetics for induction of interleukin-6 mRNA expression in murine peritoneal macrophages: evidence for calcium-dependent and independent-signalling pathways.
J. Cell. Physiol.
177:232-240[CrossRef][Medline].
|
| 48.
|
Martin, T. J.,
E. Romas, and M. T. Gillespie.
1998.
Interleukins in the control of osteoclast differentiation.
Crit. Rev. Eukaryot. Gene Expr.
8:107-123[Medline].
|
| 49.
|
Mayer, P.,
E. Schutze,
C. Lam,
F. Kricek, and E. Liehl.
1991.
Recombinant murine granulocyte-macrophage colony-stimulating factor augments neutrophil recovery and enhances resistance to infections in myelosuppressed mice.
J. Infect. Dis.
163:584-590[Medline].
|
| 50.
|
Miyatake, S.,
T. Otsuka,
T. Yokota,
F. Lee, and K. Arai.
1985.
Structure of the chromosomal gene for granulocyte-macrophage colony stimulating factor: comparison of the mouse and human genes.
EMBO J.
4:2561-2568[Medline].
|
| 51.
|
Modrowski, D.,
A. Lomri, and P. J. Marie.
1997.
Endogenous GM-CSF is involved as an autocrine growth factor for human osteoblastic cells.
J. Cell. Physiol.
170:35-46[CrossRef][Medline].
|
| 52.
|
Morrissey, P. J., and K. Charrier.
1990.
GM-CSF administration augments the survival of ity-resistant A/J mice, but not ity-susceptible C57BL/6 mice, to a lethal challenge with Salmonella typhimurium.
J. Immunol.
144:557-561[Abstract].
|
| 53.
|
Murai, M.,
A. Usui,
K. Seki,
J. Sakurada, and S. Masuda.
1992.
Intracellular localization of Staphylococcus aureus within primary cultured mouse kidney cells.
Microbiol. Immunol.
36:431-443[Medline].
|
| 54.
|
Myint, Y. Y.,
K. Miyakawa,
M. Naito,
L. D. Shultz,
Y. Oike,
K. Yamamura, and K. Takahashi.
1999.
Granulocyte/macrophage colony-stimulating factor and interleukin-3 correct osteopetrosis in mice with osteopetrosis mutation.
Am. J. Pathol.
154:553-566[Abstract/Free Full Text].
|
| 55.
|
Nair, S. P.,
S. Meghji,
M. Wilson,
K. Reddi,
P. White, and B. Henderson.
1996.
Bacterially induced bone destruction: mechanisms and misconceptions.
Infect. Immun.
64:2371-2380[Abstract].
|
| 56.
|
Neale, S. D.,
A. Sabokbar,
D. W. Howie,
D. W. Murray, and N. A. Athanasou.
1999.
Macrophage colony-stimulating factor and interleukin-6 release by periprosthetic cells stimulates osteoclast formation and bone resorption.
J. Orthop. Res.
17:686-694[CrossRef][Medline].
|
| 57.
|
Overturf, G. D.
1999.
Infections and immunizations of children with sickle cell disease.
Adv. Pediatr. Infect. Dis.
14:191-218[Medline].
|
| 58.
|
Povolny, B. T., and M. Y. Lee.
1993.
The role of recombinant human M-CSF, IL-3, GM-CSF and calcitriol in clonal development of osteoclast precursors in primate bone marrow.
Exp. Hematol.
21:532-537[Medline].
|
| 59.
|
Quinn, J. M.,
S. Neale,
Y. Fujikawa,
J. O. McGee, and N. A. Athanasou.
1998.
Human osteoclast formation from blood monocytes, peritoneal macrophages, and bone marrow cells.
Calcif. Tissue Int.
62:527-531[CrossRef][Medline].
|
| 60.
|
Ramp, W. K.,
R. M. Dillaman,
L. G. Lenz,
D. M. Gay,
R. D. Roer, and T. A. Ballard.
1991.
A serum substitute promotes osteoblast-like phenotypic expression in cultured cells from chick calvariae.
Bone Miner.
15:1-17[CrossRef][Medline].
|
| 61.
|
Reilly, S. S.,
M. C. Hudson,
J. F. Kellam, and W. K. Ramp.
2000.
In vivo internalization of Staphylococcus aureus by embryonic chick osteoblasts.
Bone
26:63-70[Medline].
|
| 62.
|
Rubin, J.,
D. M. Biskobing,
L. Jadhay,
D. Fan,
M. S. Nanes,
S. Perkins, and X. Fan.
1998.
Dexamethasone promotes expression of membrane-bound macrophage colony-stimulating factor in murine osteoblast-like cells.
Endocrinology
139:1006-1012[Abstract/Free Full Text].
|
| 63.
|
Rubin, J.,
X. Fan,
D. Thornton,
R. Bryant, and D. Biskobing.
1996.
Regulation of murine osteoblast macrophage colony-stimulating factor production by 1,25(OH)2D3.
Calcif. Tissue Int.
59:291-296[CrossRef][Medline].
|
| 64.
|
Sallerfors, B., and T. Olofsson.
1992.
Granulocyte-macrophage colony-stimulating factor (GM-CSF) and granulocyte colony-stimulating factor (G-CSF) secretion by adherent monocytes measured by quantitative immunoassays.
Eur. J. Haematol.
49:199-207[Medline].
|
| 65.
|
Shuto, T.,
E. Jimi,
T. Kukita,
M. Hirata, and T. Koga.
1994.
Granulocyte-macrophage colony stimulating factor suppresses lipopolysaccharide-induced osteoclast-like cell formation in mouse bone marrow cultures.
Endocrinology
134:831-837[Abstract/Free Full Text].
|
| 66.
|
Shuto, T.,
T. Kukita,
M. Hirata,
E. Jimi, and T. Koga.
1994.
Dexamethasone stimulates osteoclast-like cell formation by inhibiting granulocyte-macrophage colony-stimulating factor production in mouse bone marrow cultures.
Endocrinology
134:1121-1126[Abstract/Free Full Text].
|
| 67.
|
Suzuki, M.,
Y. Sakamaki,
A. Miyoshi,
K. Adachi,
M. Usami,
H. Nakayama, and K. Doi.
1997.
Histopathological study on bone changes induced by recombinant granulocyte colony-stimulating factor in rats.
Exp. Toxicol. Pathol.
49:253-259[Medline].
|
| 68.
|
Taichman, R. S., and S. G. Emerson.
1994.
Human osteoblasts support hematopoiesis through the production of granulocyte colony-stimulating factor.
J. Exp. Med.
179:1677-1682[Abstract/Free Full Text].
|
| 69.
|
Takahashi, N.,
N. Udagawa,
T. Akatsu,
H. Tanaka,
M. Shionome, and T. Suda.
1991.
Role of colony-stimulating factors in osteoclast development.
J. Bone Miner. Res.
6:977-985[Medline].
|
| 70.
|
Takahashi, T.,
T. Wada,
M. Mori,
Y. Kokai, and S. Ishii.
1996.
Overexpression of the granulocyte colony-stimulating factor gene leads to osteoporosis in mice.
Lab. Investig.
74:827-834[Medline].
|
| 71.
|
Takamatsu, Y.,
P. J. Simmons,
R. J. Moore,
H. A. Morris,
L. B. To, and J. P. Levesque.
1998.
Osteoclast-mediated bone resorption is stimulated during short-term administration of granulocyte colony-stimulating factor but is not responsible for hematopoietic progenitor cell mobilization.
Blood
92:3465-3473[Abstract/Free Full Text].
|
| 72.
|
Tanaka, S.,
N. Takahashi,
N. Udagawa,
T. Tamura,
T. Akatsu,
E. R. Stanley,
T. Kurokawa, and T. Suda.
1993.
Macrophage colony-stimulating factor is indispensable for both proliferation and differentiation of osteoclast progenitors.
J. Clin. Investig.
91:257-263.
|
| 73.
|
Teitelbaum, S. L.,
M. M. Tondravi, and F. P. Ross.
1997.
Osteoclasts, macrophages, and the molecular mechanisms of bone resorption.
J. Leukoc. Biol.
61:381-388[Abstract].
|
| 74.
|
Trinchieri, G.
1998.
Interleukin-12: a cytokine at the interface of inflammation and immunity.
Adv. Immunol.
70:83-243[Medline].
|
| 75.
|
Tsuchiya, M.,
S. Asano,
Y. Kaziro, and S. Nagata.
1986.
Isolation and characterization of the cDNA for murine granulocyte colony-stimulating factor.
Proc. Natl. Acad. Sci. USA
83:7633-7637[Abstract/Free Full Text].
|
| 76.
|
Udagawa, N.,
N. J. Horwood,
J. Elliott,
A. Mackay,
J. Owens,
H. Okamura,
M. Kurimoto,
T. J. Chambers,
T. J. Martin, and M. T. Gillespie.
1997.
Interleukin-18 (interferon-gamma-inducing factor) is produced by osteoblasts and acts via granulocyte/macrophage colony-stimulating factor and not via interferon-gamma to inhibit osteoclast formation.
J. Exp. Med.
185:1005-1012[Abstract/Free Full Text].
|
| 77.
|
Usui, A.,
M. Murai,
K. Seki,
J. Sakurada, and S. Masuda.
1992.
Conspicuous ingestion of Staphylococcus aureus organisms by murine fibroblasts in vitro.
Microbiol. Immunol.
36:545-550[Medline].
|
| 78.
|
Van Snick, J.
1990.
Interleukin-6: an overview.
Annu. Rev. Immunol.
8:253-278[Medline].
|
| 79.
|
Weir, E. C.,
M. C. Horowitz,
R. Baron,
M. Centrella,
B. M. Kacinski, and K. L. Insogna.
1993.
Macrophage colony-stimulating factor release and receptor expression in bone cells.
J. Bone Miner. Res.
8:1507-1518[Medline].
|
| 80.
|
Weir, E. C.,
K. L. Insogna, and M. C. Horowitz.
1989.
Osteoblast-like cells secrete granulocyte-macrophage colony-stimulating factor in response to parathyroid hormone and lipopolysaccharide.
Endocrinology
124:899-904[Abstract/Free Full Text].
|
| 81.
|
Workman, M. R.,
J. Philpott-Howard,
S. Bragman,
F. Brito-Babapulle, and A. J. Bellingham.
1996.
Emergence of ciprofloxacin resistance during treatment of Salmonella osteomyelitis in three patients with sickle cell disease.
J. Infect.
32:27-32[CrossRef][Medline].
|
| 82.
|
Yao, G. Q.,
B. Sun,
E. E. Hammond,
E. N. Spencer,
M. C. Horowitz,
K. L. Insogna, and E. C. Weir.
1998.
The cell-surface form of colony-stimulating factor-1 is regulated by osteotropic agents and supports formation of multinucleated osteoclast-like cells.
J. Biol. Chem.
273:4119-4128[Abstract/Free Full Text].
|
| 83.
|
Yoshida, H.,
S. Hayahsi,
T. Kunisada,
M. Ogawa,
S. Nishikawa,
H. Okamura,
T. Sudo, and L. D. Shultz.
1990.
The murine mutation osteopetrosis is in the coding region of the macrophage colony stimulating factor gene.
Nature
345:442-444[CrossRef][Medline].
|
Infection and Immunity, September 2000, p. 5075-5083, Vol. 68, No. 9
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Delpino, M. V., Fossati, C. A., Baldi, P. C.
(2009). Proinflammatory Response of Human Osteoblastic Cell Lines and Osteoblast-Monocyte Interaction upon Infection with Brucella spp.. Infect. Immun.
77: 984-995
[Abstract]
[Full Text]
-
Somayaji, S. N., Ritchie, S., Sahraei, M., Marriott, I., Hudson, M. C.
(2008). Staphylococcus aureus Induces Expression of Receptor Activator of NF-{kappa}B Ligand and Prostaglandin E2 in Infected Murine Osteoblasts. Infect. Immun.
76: 5120-5126
[Abstract]
[Full Text]
-
Potter, B. K., Burns, T. C., Lacap, A. P., Granville, R. R., Gajewski, D. A.
(2007). Heterotopic Ossification Following Traumatic and Combat-Related Amputations. Prevalence, Risk Factors, and Preliminary Results of Excision. JBJS
89: 476-486
[Abstract]
[Full Text]
-
Marriott, I., Rati, D. M., McCall, S. H., Tranguch, S. L.
(2005). Induction of Nod1 and Nod2 Intracellular Pattern Recognition Receptors in Murine Osteoblasts following Bacterial Challenge. Infect. Immun.
73: 2967-2973
[Abstract]
[Full Text]
-
Zhang, X., Aubin, J. E., Kim, T.-H., Payne, U., Chiu, B., Inman, R. D.
(2004). Synovial Fibroblasts Infected with Salmonella enterica Serovar Typhimurium Mediate Osteoclast Differentiation and Activation. Infect. Immun.
72: 7183-7189
[Abstract]
[Full Text]
-
Marriott, I., Gray, D. L., Tranguch, S. L., Fowler, V. G. Jr, Stryjewski, M., Scott Levin, L., Hudson, M. C., Bost, K. L.
(2004). Osteoblasts Express the Inflammatory Cytokine Interleukin-6 in a Murine Model of Staphylococcus aureus Osteomyelitis and Infected Human Bone Tissue. Am. J. Pathol.
164: 1399-1406
[Abstract]
[Full Text]
-
Tsao, S.-m., Hsu, C.-c., Yin, M.-c.
(2003). Garlic extract and two diallyl sulphides inhibit methicillin-resistant Staphylococcus aureus infection in BALB/cA mice. J Antimicrob Chemother
52: 974-980
[Abstract]
[Full Text]
-
Madrazo, D. R., Tranguch, S. L., Marriott, I.
(2003). Signaling via Toll-Like Receptor 5 Can Initiate Inflammatory Mediator Production by Murine Osteoblasts. Infect. Immun.
71: 5418-5421
[Abstract]
[Full Text]
-
Schrum, L. W., Marriott, I., Butler, B. R., Thomas, E. K., Hudson, M. C., Bost, K. L.
(2003). Functional CD40 Expression Induced following Bacterial Infection of Mouse and Human Osteoblasts. Infect. Immun.
71: 1209-1216
[Abstract]
[Full Text]
-
Okahashi, N., Sakurai, A., Nakagawa, I., Fujiwara, T., Kawabata, S., Amano, A., Hamada, S.
(2003). Infection by Streptococcus pyogenes Induces the Receptor Activator of NF-{kappa}B Ligand Expression in Mouse Osteoblastic Cells. Infect. Immun.
71: 948-955
[Abstract]
[Full Text]
-
Gasper, N. A., Petty, C. C., Schrum, L. W., Marriott, I., Bost, K. L.
(2002). Bacterium-Induced CXCL10 Secretion by Osteoblasts Can Be Mediated in Part through Toll-Like Receptor 4. Infect. Immun.
70: 4075-4082
[Abstract]
[Full Text]