Previous Article | Next Article 
Infection and Immunity, September 2000, p. 5450-5453, Vol. 68, No. 9
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Random Transposon Mutagenesis of
Campylobacter jejuni
Neal J.
Golden,1
Andrew
Camilli,2 and
David W. K.
Acheson1,3,*
Division of Geographic Medicine and
Infectious Diseases, New England Medical
Center,3 and Departments of Immunology
and Pathology1 and Molecular
Microbiology,2 Tufts University, Boston,
Massachusetts 02111
Received 3 February 2000/Returned for modification 22 March
2000/Accepted 14 June 2000
 |
ABSTRACT |
Genetic studies of Campylobacter jejuni have been
limited due to the lack of a transposon mutagenesis method. Here, we
describe a novel technique for random transposon mutagenesis using a
mariner-based transposon into C. jejuni strain
480. Insertions were random, as demonstrated by Southern blot analysis
and insertional junction sequencing. We have demonstrated, for the
first time, random in vivo transposon mutagenesis of C. jejuni.
 |
TEXT |
Campylobacter jejuni has
been identified as the leading cause of acute bacterial diarrhea in the
United States, and yet the mechanisms by which this bacterium causes
disease in humans are not well understood (11). This paucity
of information is partially due to a lack of genetic tools and the
relatively recent understanding of Campylobacter spp. as
important human pathogens. In particular, the lack of an in vivo
transposon mutagenesis method for the efficient generation of random
mutants of Campylobacter spp. has restricted molecular
genetic studies. To date, the generation of C. jejuni mutant
libraries has been limited to transposon shuttle mutagenesis (4) and homologous insertional mutagenesis (2,
16). Unsuccessful attempts have been made to introduce both
Gram-positive- and Gram-negative-organism-based transposons into
Campylobacter spp. (5). For example,
nonrandom site-specific insertional mutants were generated by a
TnphoA transposon in C. jejuni (13).
Recently, a highly permissive mariner-based transposon known
as Himar1 has been utilized for efficient in vivo random
transposon mutagenesis in Escherichia coli and mycobacteria (10). We therefore designed and tested an in vivo
mariner-based transposon mutagenesis system for the
production of random insertional mutants of C. jejuni.
Bacterial strains, media, and growth conditions.
C.
jejuni 480 is a highly electrocompetent strain isolated during an
outbreak of campylobacteriosis (provided by B. A. M. van der
Zeijst) (3). Strain 480 was grown routinely on
Mueller-Hinton (MH) agar supplemented with 5% sheep's blood,
vancomycin (10 µg/ml), polymyxin B (2.6 U/ml), and trimethoprim (5 µg/ml) at 42°C under microaerobic conditions (5% O2,
10% CO2, 85% N2 gas).
Construction of C. jejuni mini-transposon.
We
constructed an in vivo mini-transposon system for C. jejuni
using the mariner family of mini-transposons previously
applied to other bacteria (1, 10). Primers
(5'-CCAACGCGTGGGCTGCAGGGGAGATCTTCTAGATGCTCGGCGGTGTTCCTTTCCAAG-3' and 5'-CCAACGCGTTGCGCCCTTTAGTTCCTAAAGGGT-3')
were used to amplify the E. coli/C.
jejuni-compatible chloramphenicol resistance (Cmr)
cassette of pRY111 (provided by P. Guerry) (15). This
product was cut with MluI and subcloned in
MluI-digested plasmid pEMCAT (1; A. Camelli, unpublished results), replacing the resident Cmr
gene within the mini-transposon to create pEMCjCAT. To allow Himar1 transposase expression in C. jejuni, a
C. jejuni-specific promoter was used to replace the
original Himar1 promoter. A C. jejuni
promoter, GenBank accession no. AJ002027, was used for this purpose.
This promoter was found to be active in C. jejuni and
inactive in E. coli, as indicated by
-galactosidase
activity (14), and was chosen due to concerns that an
overactive transposase might be toxic to E. coli
(10). The C. jejuni promoter was constructed using partially complementary primers (P1,
5'-CCATCTAGAAAGCTTACTTATGTTAAATTTAATTTATCTTATTTTTGCTATATTAACGCCATAAA-3'; P2, 5'-CCAGCATGCCCCCATATGAGCCTTTCTTAAATGTT AATTTTATGGCGTTAATATAGCAAA-3'). P1 and P2 were annealed and extended with Taq and
Pfu (Stratagene) DNA polymerase (10:1), and the product was
cut with NdeI. A promoterless Himar1 transposase
was amplified from a plasmid containing the C9 hyperactive mutant of
the Himar1 transposase (6) by using primers (H1,
5'-CCAAAGCTTCCCATATGGGAAAAAAAGGAATTTCGTG-3'; H2, 5'-CCAGCATGCTTATTATTCAACATAGTTCCCTTC-3'). This
product was cut with NdeI and ligated to the
NdeI-digested promoter product. Primers P1 and H2 were then
used to amplify the C. jejuni-compatible
promoter-Himar1 fusion by PCR, and the product was
cloned in pCR2.1 (Invitrogen) to generate pCRPH. The C. jejuni-compatible promoter-transposase construct and
mini-transposon sequences were moved into pUC19 in separate ligation
steps following double digestions of pCRPH and pEMCjCAT with
HindIII-SphI and
SphI-BamHI, respectively. This resulted in the
construction of pOTHM (Fig. 1), which is
incapable of replicating in C. jejuni and thus serves as a
suicide delivery vector.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 1.
Structure of pOTHM mini-transposon
mariner-based delivery system. Himar1
transposase, mariner-based transposase under C. jejuni-specific promoter; mini-transposon, mini-transposon of
short inverted repeats flanking antibiotic resistance marker; pro,
C. jejuni promoter; CAT, chloramphenicol acetyltransferase
antibiotic marker functional in E. coli and C. jejuni; ColE1, pUC19-derived origin of replication; Ap, E. coli ampicillin resistance gene.
|
|
Mini-transposon delivery into C. jejuni.
pOTHM was
introduced by electroporation into the C. jejuni strain 480 as described by Wassenaar et al. (13). This strain was
chosen because of its ability to readily accept exogenous DNA. One
microgram of pOTHM was used to electroporate approximately 50 µl of a
solution at 5 × 1011 bacteria/ml at 1.25 V, 600
,
and 25 µF in a 0.1-cm cuvette. Cells were allowed to recover on
Columbia blood agar plates (8) for 4 to 5 h at 37°C
under microaerobic conditions. The bacteria were harvested from the
plate surface and resuspended in 0.5 ml of MH broth. Transformants were
selected at 37°C for 72 h on MH agar supplemented with 5%
sheep's blood and 5 µg of chloramphenicol per ml. This procedure
typically resulted in 37 ± 4 (mean ± standard deviation)
chloramphenicol-resistant colonies per electroporation (n = 5). Transformants were picked and characterized as described below.
Analysis of pOTHM insertions.
Southern blot analysis was
performed on 19 randomly picked transformants obtained from a single
electroporation experiment. Genomic DNA was isolated using the G-nome
DNA kit (Bio101), digested with HindIII,
electrophoretically separated on a 1.8% agarose gel, and transferred
to a Hybond N+ membrane (Amersham). The membrane was then probed with
DNA containing the 5' and 3' portions of the mini-transposon (Fig.
2B) by using the ECL RPN 3000 detection system (Amersham). Two fragments of various sizes would be expected for
each transformant with these probes, provided that a single random
transposition event had occurred. C. jejuni 480 wild-type chromosomal DNA was used as a negative control and failed to hybridize with the probes as expected (data not shown). As demonstrated in Fig.
2A, each of the 19 transformants had two uniquely sized bands,
suggesting that a single random transposon insertion had occurred in
each transformant.

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 2.
Southern blot analysis of Campylobacter
mini-transposon insertion strains. (A) Lanes 1 to 19, randomly chosen
transformants isolated from one transformation experiment. (B) Plasmid
pOTHM was cut with HindIII and NotI, and
fragments were separated by agarose gel electrophoresis. DNA fragments
containing the 5' and 3' mini-transposon junctional sequences, probes 1 and 2, respectively, were then isolated and used together as a probe.
We believe differences in band intensities relate to variations in DNA
transfer.
|
|
To further confirm the randomness of insertion, the mini-transposon
chromosomal junctions were sequenced from 12 mutants obtained from two
independent transposition experiments and the sites of insertion were
mapped on the complete chromosomal sequence of C. jejuni
NCTC 11168 (C. jejuni NCTC 11168 Sequencing Group at the
Sanger Centre [http://www.sanger.ac.uk/Projects/C_jejuni/]) (Fig.
3). Inverse PCR of the 12 transformants
was performed using HindIII-cut circularized
transformant genomic DNA. Primer 1 (5'-CTTCCCAAACGTAAATATCGGCAGTAG-3') and primer 2 (5'TATCGCTCTTGAAGGGAACTATGTTG3') extended outward from
within the Cmr cassette and were used to determine the
insertion site within the C. jejuni genome. Primer
walking-directed sequencing of inverse PCR products (using primer 1)
was performed with the ABI PRISM Big Dye Terminator Cycle Sequencing
Ready Reaction Kit with Amplitaq DNA Polymerase, FS (Perkin-Elmer).
Cycling of oligonucleotides was performed in the thermal cycler
(GeneAmp 9600; Perkin-Elmer) by following the instructions in
Perkin-Elmer protocol P/N 402078. Reaction products were run on a 373 DNA Sequencer, Stretch (Applied Biosystems). The sequence data obtained
from each of the 12 junctions demonstrated a high degree of identity to
different segments of the C. jejuni NCTC 11168 chromosome.
Furthermore, each of the 12 derived sequences is of either known
Campylobacter genes or genes encoding putative proteins
homologous to other bacterial species and ORFs of unknown function
(Table 1). Analysis of the 30-bp sequence
flanking each of the 12 insertion sites revealed no consensus sequence
other than the invariant TA dinucleotide which the Himar1
mariner transposon recognizes (7, 10), which might indicate
insertion site preference. Based on these results, we conclude that the
mini-transposon inserts with a high degree of randomness throughout the
C. jejuni genome.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Locations of mini-transposon insertion sites within the
C. jejuni genome. The nucleotide sequences flanking the
insertion sites of 12 transformants were determined; their relative
positions within the C. jejuni NCTC 11168 chromosome
(9) are shown. Transformants 1 to 12 represent individual
C. jejuni 480 mutants selected randomly from two independent
transposon mutagenesis experiments. The corresponding C. jejuni genes disrupted by the insertion are as follows: 1, Cj0035c; 2, Cj0558c; 3, Cj0719c; 4, Cj0737; 5, Cj0823; 6, Cj0863c; 7, Cj0967; 8, Cj1205c; 9, Cj1283; 10, Cj1338c; 11, Cj1457c; 12, Cj1624c.
|
|
Significance.
We have been able to demonstrate, for the first
time, random in vivo transposon mutagenesis of C. jejuni.
Prior attempts to mutagenize C. jejuni by in vivo
transposition have been hindered by a combination of incompatibilities
with promoter usage resulting in little or no expression of the
transposase (12), the absence of species-specific cofactors
necessary for transposition, and a lack of natural transposons
(7). For these reasons, we chose to test the ability of the
highly permissive Himar1 transposase to mediate random
insertional mutagenesis in C. jejuni. As described above,
this novel method of transposon mutagenesis in C. jejuni has
resulted in the generation of highly random insertional mutations. The
efficiency of the procedure is high enough that an insertion library of
high complexity can be readily generated. This will greatly aid genetic
analysis of this intestinal pathogen by screening for putative
virulence determinants that have been inactivated by the insertional
mutagenesis process.
 |
ACKNOWLEDGMENTS |
Research support for this study includes the following grants from
the National Institutes of Health (NIH), Bethesda, Md.: HL-55660,
AI-16242, and AI-39067 (D.W.K.A.) and AI-40262 and P 30 DK-34928 (A.C.)
for the Center of Gastroenterology Research on Absorptive and Secretory Processes.
We thank P. Guerry for her generous gift of pRY111 and B. A. M. van der Zeijst for kindly providing C. jejuni strain 480. We thank Xioping Zhang and Elizabeth A. Joyce for helpful discussions and Abraham L. Sonenshein for the reading of the manuscript. We also
thank Anne V. Kane and Ka Ly for their technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Geographic Medicine and Infectious Diseases, New England Medical
Center, Box 041, 750 Washington St., Boston, MA 02111. Phone: (617)
636-7002. Fax: (617) 636-5292. E-mail:
dacheson{at}lifespan.org.
Editor:
A. D. O'Brien
 |
REFERENCES |
| 1.
|
Akerley, B. J.,
E. J. Rubin,
A. Camilli,
D. J. Lampe,
H. M. Robertson, and J. J. Mekalanos.
1998.
Systematic identification of essential genes by in vitro mariner mutagenesis.
Proc. Natl. Acad. Sci. USA
95:8927-8932[Abstract/Free Full Text].
|
| 2.
|
Bleumink-Pluym, N. M.,
F. Verschoor,
W. Gaastra,
B. A. van der Zeijst, and B. N. Fry.
1999.
A novel approach for the construction of a Campylobacter mutant library.
Microbiology
145:2145-2151[Abstract].
|
| 3.
|
King, V.,
T. Wassenaar,
B. A. M. van der Zeijst, and D. G. Newell.
1991.
Variations in Campylobacter jejuni flagellin, and flagellin genes, during in vivo and in vitro passage.
Microb. Ecol. Health Dis.
4:135-140.
|
| 4.
|
Labigne, A.,
P. Courcoux, and L. Tompkins.
1992.
Cloning of Campylobacter jejuni genes required for leucine biosynthesis, and construction of leu-negative mutant of C. jejuni by shuttle transposon mutagenesis.
Res. Microbiol.
143:15-26[Medline].
|
| 5.
|
Labigne-Roussel, A.,
P. Courcoux, and L. Tompkins.
1988.
Gene disruption and replacement as a feasible approach for mutagenesis of Campylobacter jejuni.
J. Bacteriol.
170:1704-1708[Abstract/Free Full Text].
|
| 6.
|
Lampe, D. J.,
B. J. Akerley,
E. J. Rubin,
J. J. Mekalanos, and H. M. Robertson.
1999.
Hyperactive transposase mutants of the Himar1 mariner transposon.
Proc. Natl. Acad. Sci. USA
96:11428-11433[Abstract/Free Full Text].
|
| 7.
|
Lampe, D. J.,
M. E. Churchill, and H. M. Robertson.
1996.
A purified mariner transposase is sufficient to mediate transposition in vitro.
EMBO J.
15:5470-5479[Medline].
|
| 8.
|
Nuijten, P. J.,
N. M. Bleumink-Pluym,
W. Gaastra, and B. A. van der Zeijst.
1989.
Flagellin expression in Campylobacter jejuni is regulated at the transcriptional level.
Infect. Immun.
57:1084-1088[Abstract/Free Full Text].
|
| 9.
|
Parkhill, J.,
B. W. Wren,
K. Mungall,
J. M. Ketley,
C. Churcher,
D. Basham,
T. Chillingworth,
R. M. Davies,
T. Feltwell,
S. Holroyd,
K. Jagels,
A. V. Karlyshev,
S. Moule,
M. J. Pallen,
C. W. Penn,
M. A. Quail,
M. A. Rajandream,
K. M. Rutherford,
A. H. van Vliet,
S. Whitehead, and B. G. Barrell.
2000.
The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences.
Nature
403:665-668[CrossRef][Medline].
|
| 10.
|
Rubin, E. J.,
B. J. Akerley,
V. N. Novik,
D. J. Lampe,
R. N. Husson, and J. J. Mekalanos.
1999.
In vivo transposition of mariner-based elements in enteric bacteria and mycobacteria.
Proc. Natl. Acad. Sci. USA
96:1645-1650[Abstract/Free Full Text].
|
| 11.
|
Tauxe, R. V.
1992.
Epidemiology of Campylobacter jejuni infections in the United States and other industrialized nations, p. 9-19.
In
I. Nachamkin, M. J. Blaser, and L. S. Tompkins (ed.), Campylobacter jejuni: current status and future trends. American Society for Microbiology, Washington, D.C.
|
| 12.
|
Tompkins, L. S.
1992.
Genetic and molecular approach to Campylobacter pathogenesis, p. 241-254.
In
I. Nachamkin, M. J. Blaser, and L. S. Tompkins (ed.), Campylobacter jejuni: current status and future trends. American Society for Microbiology, Washington, D.C.
|
| 13.
|
Wassenaar, T. M.,
B. N. Fry, and B. A. van der Zeijst.
1993.
Genetic manipulation of Campylobacter: evaluation of natural transformation and electro-transformation.
Gene
132:131-135[CrossRef][Medline].
|
| 14.
|
Wosten, M. M.,
M. Boeve,
M. G. Koot,
A. C. van Nuene, and B. A. van der Zeijst.
1998.
Identification of Campylobacter jejuni promoter sequences.
J. Bacteriol.
180:594-599[Abstract/Free Full Text].
|
| 15.
|
Yao, R.,
R. A. Alm,
T. J. Trust, and P. Guerry.
1993.
Construction of new Campylobacter cloning vectors and a new mutational cat cassette.
Gene
130:127-130[CrossRef][Medline].
|
| 16.
|
Yao, R.,
D. H. Burr,
P. Doig,
T. J. Trust,
H. Niu, and P. Guerry.
1994.
Isolation of motile and non-motile insertional mutants of Campylobacter jejuni: the role of motility in adherence and invasion of eukaryotic cells.
Mol. Microbiol.
14:883-893[Medline].
|
Infection and Immunity, September 2000, p. 5450-5453, Vol. 68, No. 9
0019-9567/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
McLennan, M. K., Ringoir, D. D., Frirdich, E., Svensson, S. L., Wells, D. H., Jarrell, H., Szymanski, C. M., Gaynor, E. C.
(2008). Campylobacter jejuni Biofilms Up-Regulated in the Absence of the Stringent Response Utilize a Calcofluor White-Reactive Polysaccharide. J. Bacteriol.
190: 1097-1107
[Abstract]
[Full Text]
-
Julien, B., Fehd, R.
(2003). Development of a mariner-Based Transposon for Use in Sorangium cellulosum. Appl. Environ. Microbiol.
69: 6299-6301
[Abstract]
[Full Text]
-
Golden, N. J., Acheson, D. W. K.
(2002). Identification of Motility and Autoagglutination Campylobacter jejuni Mutants by Random Transposon Mutagenesis. Infect. Immun.
70: 1761-1771
[Abstract]
[Full Text]
-
Lara-Tejero, M., Galan, J. E.
(2001). CdtA, CdtB, and CdtC Form a Tripartite Complex That Is Required for Cytolethal Distending Toxin Activity. Infect. Immun.
69: 4358-4365
[Abstract]
[Full Text]
-
Colegio, O. R., Griffin, T. J. IV, Grindley, N. D. F., Galán, J. E.
(2001). In Vitro Transposition System for Efficient Generation of Random Mutants of Campylobacter jejuni. J. Bacteriol.
183: 2384-2388
[Abstract]
[Full Text]