This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sebbane, F.
Right arrow Articles by Simonet, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sebbane, F.
Right arrow Articles by Simonet, M.

 Previous Article  |  Next Article 

Infection and Immunity, January 2001, p. 170-176, Vol. 69, No. 1
0019-9567/01/$04.00+0   DOI: 10.1128/IAI.69.1.170-176.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Silencing and Reactivation of Urease in Yersinia pestis Is Determined by One G Residue at a Specific Position in the ureD Gene

Florent Sebbane,1 Annie Devalckenaere,1 Jeannine Foulon,2 Elisabeth Carniel,2 and Michel Simonet1,*

Equipe Inserm E9919-Université JE2225, Département de Pathogenèse des Maladies Infectieuses et Parasitaires, Institut de Biologie de Lille, 59021 Lille,1 and Unité de Bactériologie Moléculaire et Médicale, Laboratoire des Yersinia, Institut Pasteur, 75724, Paris,2 France

Received 5 July 2000/Returned for modification 1 August 2000/Accepted 21 September 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Yersinia pestis, the plague agent, is a naturally nonureolytic microorganism, while all other Yersinia species display a potent urease activity. In this report we demonstrate that Y. pestis harbors a complete urease locus composed of three structural (ureABC) and four accessory (ureEFGD) genes. Absence of ureolytic activity is due to the presence of one additional G residue in a poly(G) stretch, which introduces a premature stop codon in ureD. The presence of the same additional G in eight other Y. pestis isolates indicates that this mutation is species specific. Spontaneous excision of the extra G occurs at a frequency of 10-4 to 10-5 and restores a ureolytic phenotype to Y. pestis. The virulence of two independent ureolytic clones of Y. pestis injected either intravenously, subcutaneously, or intragastrically did not differ from that of the parental strain in the mouse infection model. Coinfection experiments with an equal number of ureolytic and nonureolytic bacteria did not evidence any difference in the ability of the two variants to multiply in vivo and to cause a lethal infection. Altogether our results demonstrate that variation of one extra G residue in ureD determines the ureolytic activity of Y. pestis but does not affect its virulence for mice or its ability to multiply and disseminate.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Yersinia pestis and Yersinia pseudotuberculosis are gram-negative bacteria pathogenic for animals and humans. The former is transmitted by fleas and is responsible for plague, a fatal systemic infectious disease, whereas the latter causes a self-limiting mesenteric lymphadenitis and is transmitted by the oral route (10). Although Y. pestis and Y. pseudotuberculosis have distinct cycles of transmission and induce infection with different clinical manifestations, they are genetically closely related, with a DNA relatedness superior to 90% as determined by DNA-DNA hybridization (4). Sequence comparisons of homologous genes from both microorganisms revealed nucleotide identities ranging from 97 to 99% (1, 9, 28, 32, 33, 35, 36, 39, 40), and recent results suggest that Y. pestis is a clone of Y. pseudotuberculosis that emerged less than 20,000 years ago (1). Strikingly, several genes present in both species are intact in Y. pseudotuberculosis but mutated in Y. pestis. These include the virulence-associated plasmid (pYV)-borne gene yadA and the chromosomal invasion genes inv and ail. Nonexpression of yadA is due to a frameshift mutation in its coding sequence (33), while inactivation of inv and ail results from the disruption of their open reading frames by insertion sequences IS1541 (35) and IS285 (S. D. Torosian and R. M. Zsigray, Abstr. 96th Gen. Meet. Am. Soc. Microbiol. 1996, abstr. B-213, 1996), respectively. Furthermore, several phenotypic properties such as motility at 28°C; synthesis of a complete LPS molecule; and ability to ferment rhamnose and melibiose, to synthesize some amino acids (methionine, phenylalanine, threonine-glycine, and isoleucine-valine), and to degrade urea are expressed in Y. pseudotuberculosis but not in Y. pestis (reviewed in references 6 and 27).

We have recently characterized the chromosomal ure locus of the ureolytic species Y. pseudotuberculosis (30). This locus is composed of three structural genes (ureA, ureB, and ureC) and four accessory genes (ureE, ureF, ureG, and ureD) which are most likely organized in a polycistronic unit. Although Y. pestis is urease negative, hybridizations with ure probes from Y. enterocolitica suggested that a ure locus is also present in this species (15), but the reasons for the absence of urease activity in Y. pestis have never been elucidated. The aim of the present work was to investigate the molecular bases for the silencing of the ure locus of Y. pestis and to evaluate the impact of this natural mutation on the virulence and in vivo multiplication of the microorganism.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Bacterial strains, plasmids, and growth conditions. The main characteristics of the bacterial strains and plasmids used in this study are listed in Table 1. Yersinia strains were grown at 28°C and Escherichia coli strain DH5alpha was grown at 37°C, in Luria-Bertani broth or on agar plates. Ampicillin, 100 µg ml-1; kanamycin, 50 µg ml-1; and nalidixic acid, 50 µg ml-1, were used for bacterial selection. Characterization of Yersinia strains was achieved with API 20E and API 50CH strips (bioMérieux). Detection of urease activity was performed on urea segregation agar as described previously (30) or in urea-indole medium (Diagnostics Pasteur). The pigmentation (Pgm) phenotype of Y. pestis was determined on Congo red agar plates after 4 days of growth (37).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Strains and plasmids used in this study

Nucleic acid manipulations. Extraction of genomic DNA and small-scale isolation of plasmid DNA were done as previously described (5, 8, 16). Large-scale plasmid DNA preparations were purified on columns in accordance with the manufacturer's recommendations (Qiagen GmbH). Genomic or plasmid DNA was digested with the appropriate restriction endonuclease purchased from GIBCO BRL or Promega, and the resulting fragments were separated by electrophoresis on 0.8 to 1.2% agarose gels and transferred onto Hybond-N+ membrane (Amersham) by the Southern technique. Elution of restriction fragments from agarose gels was carried out with the Qia quick gel extraction kit (Qiagen GmbH). Pulsed-field gel electrophoresis of macrorestricted DNA fragments from Y. pestis was resolved as previously described (9). Total RNAs were extracted from exponentially growing Yersinia cells with the High Pure RNA isolation kit (Boehringer Mannheim) following the manufacturer's instructions. For dot blot analysis, 15 µg of RNA was spotted onto Hybond-N+ membrane.

DNA fragments were ligated to endonuclease-restricted vectors according to standard techniques with T4 DNA ligase (GIBCO BRL). Recombinant plasmid DNAs were introduced by transformation into E. coli (34) or into Yersinia by electroporation (12).

Prehybridization, hybridization under stringent conditions of membrane-blotted DNA or RNA with digoxigenin-labeled DNA probe, and detection of nucleic acid hybrids were performed with the DIG hybridization and detection kit from Boehringer Mannheim.

Nucleotide sequence determination was performed by the dideoxy chain termination method, using the ABI PRISM dichloRhodamine Dye Terminator Sequencing kit with Amplitaq DNA polymerase FS (Perkin-Elmer), according to the manufacturer's instructions. Extension products were analyzed with the Applied Biosystems model ABI 373 automated DNA sequencing (Perkin-Elmer). The nucleotide sequences were analyzed with Perkin-Elmer softwares (Sequence Analysis and Sequence). Multiple protein alignment was carried out with the CLUSTAL_X program.

PCRs. PCR amplification was performed in a 100-µl reaction volume with a model 2400 thermal cycler (Perkin-Elmer Cetus). Fifty nanograms of target DNA, a 200 mM concentration of each deoxynucleoside triphosphate, 0.1 nmol of each primer, and 1 U of thermostable DNA polymerase were mixed in the corresponding 1× polymerase buffer. Amplification involved 30 cycles, each consisting of (i) a denaturation step of 1 min at 94°C, (ii) an annealing step of 1 min at 55°C, and (iii) a polymerization step of 1 min at 72°C. Digoxigenin-labeled PCR products were generated using PCR DIG labeling mix from Boehringer Mannheim. Amplimers were purified on SpinX columns (Corning Costar Corporation).

Oligonucleotide primers. Forty oligomers encompassing the ure locus (and its promoter region) from Y. pseudotuberculosis (GenBank accession number U40842) were synthesized by Genset and Oligo-Express. Forward (f) and reverse (r) primers and their nucleotide sequences (5' to 3') were as follows: 1f, AATGCTGCGTCAGATTGG; 2f, ACCTAATGTACAGGAGGAT; 3f, TTTTACCGATGGCAGCCGTCT; 4f, GTTAACCGCGCACTGG; 5f, GGCAAGAATACGCGGGTCTA; 6f, GGATGGCACTAACGGGACA; 7f, ATGCGTTCGAAGGTCGCA; 8f, GCGTTATCTCCATGTTCTC; 9f, CAATGTTTGGCGCGAT; 10f, GCTAATCTGAGGTAGCAG; 11f, GGTCTGGATCTGGGCATTTCT; 12f, CGAGGTGTATGTGCCTCTGA; 13f, CATGGTGATCACGATCATGAC; 14f, AATCTGCCATTCAAACCGGC; 15f, AGCTGGCAGAAATGTCGAT; 16f, GATCGCGTTACGCATTTC; 17f, ATTGGTATTGGTGGTCCGG; 18f, GCCGACATTTTAGTGATC; 19f, GAGTTACCTTGTGTCACC; 20f, ACTGATACCACGATCA; 21f, CGCCCAAAGAACAT; 22f, GATGCGCCATTTTAA; 1r, CTGCAGCGGTATTCGCTGCTC; 2r, GGGCTATCTTCCAAAAT; 3r, GTAATAAAACGGGAA; 4r, TAATGCGTGAGCGCGAA; 5r, AATGTTCATGCTCGGG; 6r, CCTTGTGCTGCCATAAC; 7r, GCCGGTTTGAATGGCAGATT; 8r, GTCATGATCGTGATCACCATG; 9r, GAAATGCCCAGATCCAGACC; 10r, ATAGCGCTGATTCATCGACG; 11r, CATCGCGCCAAACATTG; 12r, CATGGAGATAACGCCCATA; 13r, TGCGACCTTCGAACGCAT; 14r, TGTCCCGTTAGTGCCATCC; 15r, CAGATTATTGTTGGCCCCC; 16r, TAAAACCACGCTCGGCGGCAA; 17r, TCCAGTGCGCGGTTAACC; 18r, AGACGGCTGCCATCGGTAAAA; 19r, TCAGACAGCGTGTAGATC; 20r, CATCCTCCTGTACATTTAGGT. Primers Af (AAGTTCGAAATAAGGAGGTTTAAACCATGACAGCACAGAGCCAGAAT) and Ar (CGGTCTAGATCAGCGCCACAAAAATTGTTC) were also used in this work. Nucleotides (nt) 4 to 26 of primer Af included a Csp451 restriction site followed by nt 315 to 331 from vector pKK388-1, and the last 21 nt corresponded to the 5' end of Y. pestis ureD. Primer Ar corresponded to the 3' end of Y. pestis ureD with a XbaI recognition site linker.

Experimental infections. Five-week-old, OF1 female mice (Iffa Credo) were used. For 50% lethal dose (LD50) determinations, serial dilutions of bacterial suspensions in saline were inoculated intragastrically (i.g.) (0.2 ml) via a gastric tube, intravenously (i.v.) (0.5 ml), or subcutaneously (s.c.) (0.1 ml) to groups of five animals. For gastric inoculation, mice were first starved for 18 h. Infected animals were monitored for 3 weeks, and the LD50s were calculated according to the method of Reed and Muench (29).

To perform coinfection experiments, groups of 15 to 20 animals were challenged s.c. with approximately the same number of bacteria of each phenotype. Moribund mice were sacrificed, and their blood and spleen were removed aseptically. The spleens of freshly dead (less than 1 h) animals were also collected. Serial dilutions of the biological samples were plated in duplicate on Luria-Bertani-hemin agar plates with and without nalidixic acid. The number of bacteria grown in the presence or absence of the antibiotic was recorded. A more precise determination of the proportion of the two bacterial populations was obtained by spotting 100 colonies from the most appropriate dilutions onto plates with and without nalidixic acid. The association between urease activity and nalidixic acid resistance or susceptibility was subsequently checked on Nalr and Nals colonies.

Nucleotide sequence accession number. The nucleotide sequence data has been deposited in the GenBank nucleotide sequence database under accession number AF095636.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Nonexpression of the ure locus of Y. pestis does not result from transcriptional regulation or alteration of the promoter region. Since previous results suggested that Y. pestis possesses a ure locus (15), a possible explanation for its nonexpression was the absence of a positive regulator required for its activation, or the presence of a repressor that prevents its transcription. In both cases, introduction into Y. pestis of the functional ure locus of Y. pseudotuberculosis should not confer a urease activity on the recipient strain. To test this hypothesis, a 7.3-kb HindIII/PstI DNA fragment encompassing the entire ure locus of Y. pseudotuberculosis and its promoter region (30) was cloned into the low-copy-number vector pATT113 (Kmr) to yield the recombinant plasmid pFS98, which was subsequently introduced by electroporation into Y. pestis strain 6/69c. Transformants able to grow on kanamycin agar plates were tested for their ability to degrade urea in urea broth. trans-complemented clones were able to hydrolyze urea, thus suggesting that nonexpression of the ure locus of Y. pestis is not driven by a regulatory mechanism.

To confirm this hypothesis and to determine whether the promoter region upstream of ureA was functional in Y. pestis, a slot blot analysis was carried out on total RNAs extracted from an exponentially growing culture of strain 6/69c. ureABC and ureEF DNA probes from Y. pseudotuberculosis hybridized with Y. pestis RNA extracts but not with the RNase treated-preparation (not shown) demonstrating that the ure locus of Y. pestis is transcribed.

Therefore, the inability of Y. pestis to hydrolyze urea is due neither to a defect in transcriptional regulation nor to an alteration of the promoter region of the ure locus.

The sequences of the ure loci of Y. pestis and Y. pseudotuberculosis are highly similar, but the ureD gene of Y. pestis is disrupted. Cloning and sequencing of the complete ure locus of Y. pestis 6/69c (GenBank accession number AF095636) was performed to further investigate the differences with the ure locus of Y. pseudotuberculosis IP32777 (GenBank accession number U40842). The genetic organization of the ure locus of Y. pestis was identical to that of Y. pseudotuberculosis with the seven genes ureA, ureB, ureC, ureE, ureF, ureG, and ureD in the same order and polarity (Fig. 1).


View larger version (20K):
[in this window]
[in a new window]
 
FIG. 1.   Nucleotide and derived amino acid sequences of the 3' end of ureD in Y. pestis (Yp) and Y. pseudotuberculosis (Ypst). An extra G residue (the G-rich region is shown in the black box) in the Y. pestis gene results in a frameshift mutation which creates a premature stop codon (TAA).

The sequence of the ~0.8-kb region upstream of ureA and encompassing the promoter was identical in the two species. The structural genes ureA, ureB and ureC were highly conserved (99.6% nucleotide identity) in both species, and their putative products had identical amino acid sequences, except for UreC in which a Ser175 in Y. pseudotuberculosis was replaced by a Thr175 in Y. pestis. Accessory genes ureE, ureF, ureG, and ureD were also highly identical (98.6% nucleotide identity) in the two species. The amino acid sequence of the Y. pestis putative UreE differed from the homologous sequence of Y. pseudotuberculosis by only 1 amino acid (aa), i.e., the presence of a Glu206 instead of a Gly206. Similarly, only two residues differentiated the UreF proteins of the two species: a Val64 and a Met70 in Y. pestis replaced an Ala64 and a Val70, respectively, in Y. pseudotuberculosis. The UreG proteins were identical in the two bacteria. The major difference observed between the two species lay in ureD, the last gene of the ure locus. This gene had the capacity to code for a predicted product of 277 aa in Y. pestis instead of the 321-residue-long protein in Y. pseudotuberculosis, due to a premature stop codon in the Y. pestis ureD sequence (Fig. 1). This stop codon was generated by a frameshift caused by the presence of an additional guanine (G) residue in a seven-G stretch in the Y. pestis ureD coding sequence. The same additional G was also identified in eight other strains of Y. pestis of various geographical origins and biotypes (Table 1), as well in strains CO92 (biotype Orientalis) and KIM5 (biotype Medievalis) whose genome sequence is available online from the Sanger Centre (http://www.sanger.ac.uk/Projects/Y_pestis/blastserver.shtml) and the University of Wisconsin---Madison Genome Project (http://www.magpie.genome.wisc.edu/cgi-bin/Authenticate.cgi/uwgp_blast.html). The chromosomal fragment flanking the 3' end of the ure locus differed in the two species by a stretch of 178 bp, present only in Y. pseudotuberculosis.

Therefore, our data indicate that the ure loci of Y. pestis and Y. pseudotuberculosis are highly conserved at the nucleotide and amino acid level, except for the 3' end of this locus where the ureD gene of Y. pestis is truncated. The absence of a functional chaperone-like protein UreD, essential for the assembly of the urease structural subunits (24), could therefore be responsible for the inability of Y. pestis to degrade urea.

The region encompassing the ure locus is conserved in Y. pestis. The conservation of the region encompassing the ure locus was studied in eight additional isolates of Y. pestis with different biotypes and ribotypes (Table 1). The entire ure locus and promoter region of these strains were amplified by PCR using four sets of primers defined on the basis of the ure sequences of Y. pestis 6/69c. For all strains tested, primer sets 1 (1f and 15r), 2 (6f and 1r), 3 (11f and 7r), and 4 (15f and 2r) yielded PCR products with sizes identical to those of strain 6/69c, i.e., 2.2, 2.1, 1.0, and 2.4 kb, respectively. Digestion of these amplimers with either HaeIII or MboI (two endonucleases that have several restriction sites in the ure locus) generated restriction fragments exhibiting electrophoretic patterns identical to those of strain 6/69c (not shown). Furthermore, comparisons of the nucleotide sequence of the ure locus of strain 6/69c with that of strain CO92 (per the Sanger Centre website) showed only one difference, at position 4561 in ureF, resulting in the replacement of a Met70 in 6/69c by a Val70 in CO92.

Thus, the chromosomal region encompassing the ure locus appears to be well conserved in different strains of Y. pestis.

Spontaneous ureolytic mutants of Y. pestis 6/69c arise by a single nucleotide deletion in the accessory gene ureD. Brubaker and Sulen (7) previously reported the occurrence of urease-positive mutants in laboratory strains of Y. pestis. This observation suggested that the silent ure locus of Y. pestis could be reactivated under certain circumstances. By cultivating strain 6/69c on urea agar, we were able to obtain ureolytic colonies at high frequencies (10-4 to 10-5). These colonies had a particular morphology on urea agar plates, characterized by an irregular and enlarged shape. This unusual aspect of the colonies was subsequently lost upon storage, although the organisms retained their ureolytic activity. To investigate the molecular bases for this shift to urease activity in the 6/69c mutants, the nucleotide sequence of the entire ure locus and promoter region from one ureolytic mutant (6/69c U.1) was determined. Over the 6,961-nt region sequenced, only one difference was observed between the wild-type strain and its isogenic derivative, and this difference corresponded to the deletion of the additional G in the G-rich region of ureD. Absence of this G residue restored an intact ureD open reading frame (ORF) having the capacity to code for a complete 321-aa protein whose sequence was identical to that of Y. pseudotuberculosis with the exception of one substitution of an Arg for a Cys at position 58. Demonstration that the extra G was responsible for the silencing of the ure locus in Y. pestis and therefore that the C terminus of UreD was crucial for urease activity was obtained by trans-complementing wild-type strain 6/69c with plasmid pFS99, which contains the functional ureD gene of the ureolytic clone 6/69c U.1. The trans-complemented colonies acquired the ability to hydrolyze urea.

Three other spontaneous ureolytic clones of strain 6/69c (6/69c U.2, U.3, and U.4) obtained from independent experiments exhibited the same deletion of the extra G in ureD. Similarly, ureolytic clones obtained from another strain of Y. pestis (strain EV76) exhibited the same mutation in ureD. Altogether, our data demonstrate that the absence of urease activity in Y. pestis is due to the insertion of a G residue in the ureD locus and that high-frequency deletion of this additional G results in a shift to a ureolytic phenotype.

Switch to a ureolytic phenotype does not modify the pathogenicity of Y. pestis in the mouse experimental model. The impact of urease activity on bacterial pathogenicity was assessed in the mouse experimental model of infection. Ureolytic clones of the fully virulent wild-type strain 6/69 (pYV+, pPst+, pFra+, Pgm+) were selected on urea agar as described above. Since genomic rearrangements occur at high frequencies in Y. pestis (19), the presence of the three resident plasmids, the colony pigmentation on Congo red agar plates, and the NotI- and SpeI-restriction profiles of the ureolytic mutants were checked before performing virulence assays. Two independent ureolytic mutants, designated 6/69 U2.1 and 6/69 U5.1, were selected; sequencing of the ureD gene in both strains showed, as expected, that it contained six G residues in the G-rich region. Strains 6/69 U2.1 and 6/69 U5.1 were injected i.v. and s.c. into mice. As illustrated in Table 2, the LD50 for mice of the two mutants injected either by the s.c. or the i.v. route was similar to that of the wild-type strain. No difference in the kinetics of killing was noted between animals inoculated with ureolytic and nonureolytic strains (not shown).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Virulence of ureolytic and nonureolytic strains of Y. pestis

To determine whether in vivo growth of ureolytic Y. pestis could lead to the reversion to a nonureolytic state, bacteria were recovered from the blood and spleen of moribund mice infected with ureolytic strains 6/69 U2.1 and 6/69 U5.1. Upon isolation from these animals, all bacterial colonies tested were ureolytic, indicating that no silencing of the urease locus was induced in vivo. Similarly, all colonies harvested from animals infected with the wild-type Y. pestis 6/69 remained nonureolytic.

Urease has been shown to be important for Y. enterocolitica survival during passage through the acidic environment of the stomach (14, 18). Since Y. pestis is not commonly transmitted by the oral route, absence of a urease activity may not affect its dissemination from the site of the flea bite. However, this mutation may have an effect when the bacteria are administered orally. This hypothesis was tested by determining the LD50 of wild-type Y. pestis and of the two ureolytic derivatives in mice infected i.g. No statistically (Student's t test) significant difference in LD50 was observed between the wild-type strain and the two ureolytic derivatives by this route of infection. Therefore, our results indicate that expression or nonexpression of the ure locus does not affect the LD50 of Y. pestis in the mouse model, whatever the route of infection.

The ability of the ureolytic and nonureolytic clones to disseminate in vivo and to cause an infection was further compared by coinfecting mice with an equal number of Ure- (6/69r, Nalr) and Ure+ (6/69 U5.1, Nals) cells. Animals were challenged s.c. with approximately 50 bacteria of each phenotype. The proportion of Ure+ and Ure- clones recovered from the infected animals was determined on agar plates with and without nalidixic acid. The results of two independent experiments are presented in Fig. 2. The proportions of Ure+ and Ure- colonies recovered from their spleen ranged from 0 to 100%. Of the 14 mice analyzed, one died with an equal amount of Ure+ and Ure- strains while the 13 remaining animals were predominantly infected with either the Ure+ (7 of 13) or the Ure- (6 of 13) variant. The fact that the number of animals massively infected with ureolytic or nonureolytic bacteria did not differ significantly (chi-square test) indicates no selective advantage of one variant over the other and suggests that infection resulted from the random expansion of either a Ure+ or Ure- clone in vivo. The proportion of Ure+ and Ure- colonies recovered from the blood of the infected animals correlated perfectly with that found in their spleen (data not shown).


View larger version (27K):
[in this window]
[in a new window]
 
FIG. 2.   Percentages of Ure+ and Ure- Y. pestis cells recovered from the spleen of individual mice. OF1 mice were infected s.c. with an equal number of Ure- (strain 6/69r) and Ure+ (strain 6/69 U5.1) Y. pestis cells. Two separate experiments were performed with a bacterial inoculum of 115 and 85 bacteria per animal, respectively. The percentage of Ure+ (black columns) and Ure- (grey columns) bacteria in spleens of moribund animals was determined as described in Materials and Methods. Results obtained for each individual mouse are presented.

Altogether, our data indicate that a switch to a ureolytic phenotype does not modify the virulence of Y. pestis for mice or its ability to multiply and disseminate in vivo.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Bacterial ureases are commonly composed of three subunits, UreA, UreB, and UreC, which assemble to form a multimeric complex, (UreABC)3. Activation of the apoenzyme requires the presence of nickel ion, carbon dioxide, and auxiliary proteins UreD, UreF, UreG, and UreE (24). During the initial step of activation, UreD, a chaperone-like protein, is thought to form a complex with the apoenzyme, essential for the assembly of the urease structural subunits. UreF and UreG then associate with the complex, allowing the apoenzyme to accept nickel ions within the enzymatic catalytic site of the structural subunit UreC. These proteins may function in delivering the carbon dioxide molecule that reacts with the apoprotein to become a nickel ligand. Alternatively, UreF and/or UreG may facilitate interaction between the urease apoprotein and the nickel donor, UreE. Upon activation, all these accessory proteins dissociate from the enzyme and are recycled (24). In this study, we showed that the inability of Y. pestis to hydrolyze urea results from nonactivation of the urease complex, due to truncation of the accessory protein UreD. Introduction of a functional ureD gene from a ureolytic mutant confers on the wild-type strain the capacity to degrade urea.

The ureolytic phenotype depends on the number of G residues in a stretch of G located between nt 6624 and 6630 in ureD. When the number of bases in this poly(G) tract is seven, Y. pestis synthesizes a truncated UreD protein and is unable to degrade urea (phase off). When this number is six, the microorganism produces a complete protein and is capable of hydrolyzing urea (phase on). Phase-on variants, detected by growing Y. pestis on urea agar, were obtained at a high frequency (10-4 to 10-5 cell). The frequency of reversion to the nonureolytic phase could not be determined on this medium because urease-negative revertants cannot be identified among a high number of ureolytic colonies. However, the fact that some fresh clinical isolates of Y. pestis had the capacity to degrade urea upon isolation and rapidly lose this property upon storage or subculture (26) argues for an on-to-off switch. Such phase variations due to an alteration in a stretch of polymononucleotides within a translating reading frame have already been described for several genes, mainly pathogenicity ones, including genes from Neisseria meningitidis, Neisseria gonorrhoeae, Bordetella pertussis, Vibrio cholerae, Mycoplasma pneumoniae, and Helicobacter pylori (2, 20, 22). These repeats, mostly composed of 6 to 15 polypurines or polypyrimidines, represent a hot spot for DNA replication errors caused by slipped-strand mispairing (20, 31). This process is thought to involve a triple-stranded DNA (H-DNA) conformation of the repetitive region which interacts with the DNA replication machinery, and stability or ease of formation of the H-DNA structure is dependent on the length of the repeat (21). In the case of the ureD gene of Y. pestis, the poly(G) tract is composed of only six or seven bases, a number which might be quite short for the latter mechanism to take place.

Production of urease contributes to the pathogenicity of some microorganisms. This is well established for the human gastric pathogen Helicobacter pylori in which inactivation of urease abrogates its capacity to colonize the stomach (24). Since Y. pestis has acquired, during evolution, the ability to be transmitted by fleas, it is not surprising that genes facilitating its oral transmission have been subsequently lost. This may also explain the absence of difference in virulence or in vivo multiplication and dissemination observed between ureolytic and nonureolytic clones of Y. pestis injected i.v. or s.c. However, the LD50s for Ure+ and Ure- cells inoculated i.g. were also of the same magnitude, indicating that urease does not contribute to acid resistance of Y. pestis in the stomach. This observation corroborates a previous study which showed that a urease-negative mutant of Y. pseudotuberculosis is as virulent as the wild-type strain upon i.g. infection of mice (30). Remarkably, our results as well as those previously reported by Butler et al. (11) demonstrate that virulence of Y. pestis by the oral route is similar to or even higher than that of its enteropathogenic progenitor Y. pseudotuberculosis (13). Not only urease but two other adhesins or invasins (Inv and YadA) thought to be important for the virulence of enteropathogenic Yersinia are nonfunctional in Y. pestis. This suggests either that none of these proteins are essential for pathogenesis of Y. pestis by the oral route or that this species has acquired specific factors that may replace the defective proteins for enteric invasion.

Why is Y. pestis nonureolytic while the urease activity of Y. pseudotuberculosis is so strong and so well conserved? Loss of this property by the plague agent may have been either advantageous or neutral for the organism. In the first possibility, the benefit would reside in the mammalian host or in the flea vector. The results of this study demonstrate that production of an active urease does not alter the course of infection in the mouse model and thus does not appear to play a role in the mammalian host. Alternatively, urease silencing could enhance flea transmission of the plague bacillus. A measurement of the survival rate of urease-positive and -negative Y. pestis within the flea vector could help answer this question. If, on the other hand, urease silencing has no effect, it may be because this function is no longer required in the new flea-host-flea life cycle adopted by Y. pestis. Indeed, loss of a function useful for oral infection is predictable in an organism that has acquired the ability to be transmitted by fleas. However, this hypothesis is not valid since our results and those of other authors (11) indicate that Y. pestis is at least as virulent as the enteropathogen Y. pseudotuberculosis when injected orally. Therefore, the various genes that have been silenced in Y. pestis are not necessary for oral transmission. The primary use of urease in prokaryotes is to permit microorganisms living in soil and water to use urea, the main nitrogenous waste product of mammals in the environment, as a source of nitrogen through ammonia generation. Since Y. pestis spends its life most exclusively in a flea-host-flea cycle, the organism can lose with impunity functions once needed to assure survival in natural environments in competition with saprophytes. Nonetheless, Y. pestis also has the capacity of long-term survival in the soil, like Y. pseudotuberculosis (3, 6, 23, 25). Therefore, transient expression of an active urease by Y. pestis might be useful for the pathogen during the temporary saprophytic stage of its life cycle.


    ACKNOWLEDGMENTS

This work was supported partly by the Conseil Régional Nord-Pas de Calais; the DGA (grant 99 34 028); and the European Regional Development Fund. Florent Sebbane received a scholar fellowship from the Ministère de l'Enseignement Supérieur, de la Recherche et de la Technologie.

The contribution of Annie Guiyoule to the initial step of this work is gratefully acknowledged. We also thank Pascal Vincent for assistance in statistical analysis and Shamila Nair for reading the manuscript.


    FOOTNOTES

* Corresponding author. Mailing address: Département de Pathogenèse des Maladies Infectieuses et Parasitaires, Institut de Biologie de Lille, 1, rue du Professeur Calmette, 59021 Lille Cedex, France. Phone: 33 3 20 87 11 78. Fax: 33 3 20 87 11 83. E-mail: michel.simonet{at}ibl.fr.

Editor:   E. I. Tuomanen


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Achtman, M., K. Zurth, G. Morelli, G. Torrea, A. Guiyoule, and E. Carniel. 1999. Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis. Proc. Natl. Acad. Sci. USA 96:14043-14048[Abstract/Free Full Text].
2. Appelmelk, B. J., S. L. Martin, M. A. Monteiro, C. A. Clayton, A. A. McColm, P. Zheng, T. Verboom, J. J. Maaskant, D. H. van den Eijnden, C. H. Hokke, M. B. Perry, C. M. Vandenbroucke-Grauls, and J. G. Kusters. 1999. Phase variation in Helicobacter pylori lipopolysaccharide due to changes in the lengths of poly(C) tracts in 3-alpha fucosyltransferase genes. Infect. Immun. 67:5361-5366[Abstract/Free Full Text].
3. Barre, N., H. Bercovier, M. Treignier, and J. Brault. 1979. Bilan d'une enquête épidémiologique sur les yersinioses dans un écosystème agrosylvatique en région parisienne. I - Recherche des Yersinia dans le sol, les oligochètes et la végétation. Med. Mal. Infect. 9:34-39.
4. Bercovier, H., H. H. Mollaret, J.-M. Alonso, J. Brault, G. R. Fanning, A. G. Steigerwalt, and D. J. Brenner. 1980. Intra- and interspecies relatedness of Yersinia pestis by DNA hybridization and its relationship to Yersinia pseudotuberculosis. Curr. Microbiol. 4:225-229.
5. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7:1513-1523[Abstract/Free Full Text].
6. Brubaker, R. R. 1991. Factors promoting acute and chronic diseases caused by yersiniae. Clin. Microbiol. Rev. 4:309-324[Abstract/Free Full Text].
7. Brubaker, R. R., and A. Sulen, Jr. 1971. Mutations influencing the assimilation of nitrogen by Yersinia pestis. Infect. Immun. 3:580-588[Abstract/Free Full Text].
8. Buchrieser, C., S. D. Weagant, and C. W. Kaspar. 1994. Molecular characterization of Yersinia enterocolitica by pulsed-field gel electrophoresis and hybridization of DNA fragments to ail and pYV probes. Appl. Environ. Microbiol. 60:4371-4379[Abstract/Free Full Text].
9. Buchrieser, C., R. Brosch, S. Bach, A. Guiyoule, and E. Carniel. 1998. The high-pathogenicity island of Yersinia pseudotuberculosis can be inserted into any of the three chromosomal asn tRNA genes. Mol. Microbiol. 30:965-978[CrossRef][Medline].
10. Butler, T. 1983. Plague and other Yersinia infections. Plenum Press, New York, N.Y.
11. Butler, T., Y.-S. Fu, L. Furman, C. Almeida, and A. Almeida. 1982. Experimental Yersinia pestis infection in rodents after intragastric inoculation and ingestion of bacteria. Infect. Immun. 36:1160-1167[Abstract/Free Full Text].
12. Conchas, R. F., and E. Carniel. 1990. A highly efficient electroporation system for transformation of Yersinia. Gene 87:133-137[CrossRef][Medline].
13. de Almeida, A. M., A. Guiyoule, I. Guilvout, I. Iteman, G. Baranton, and E. Carniel. 1993. Chromosomal irp2 gene in Yersinia: distribution, expression, deletion and impact on virulence. Microb. Pathog. 14:9-21[CrossRef][Medline].
14. De Koning-Ward, T. F., and R. M. Robins-Browne. 1995. Contribution of urease to acid tolerance in Yersinia enterocolitica. Infect. Immun. 63:3790-3795[Abstract].
15. De Koning-Ward, T. F., and R. M. Robins-Browne. 1996. Analysis of the urease gene complex of members of the genus Yersinia. Gene 182:225-228[CrossRef][Medline].
16. Ellington, A. 1990. Preparation of genomic DNA from bacteria, p. 241-245. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y.
17. Girard, G., and J. Robic. 1936. La vaccination de l'homme contre la peste au moyen de bacilles vivants (virus vaccin E.V.), son application à Madagascar. Bull. Off. Int. Hyg. Publique 28:1078-1087.
18. Gripenberg-Lerche, C., L. Zhang, P. Ahtonen, P. Toivanen, and M. Skurnik. 2000. Construction of urease-negative mutants of Yersinia enterocolitica serotypes O:3 and O:8. Role of urease in virulence and arthritogenicity. Infect. Immun. 68:942-947[Abstract/Free Full Text].
19. Guiyoule, A., F. Grimont, I. Iteman, P. A. D. Grimont, M. Lefèvre, and E. Carniel. 1994. Plague pandemics investigated by ribotyping of Yersinia pestis strains. J. Clin. Microbiol. 32:634-641[Abstract/Free Full Text].
20. Henderson, I. R., P. Owen, and J. P. Nataro. 1999. Molecular switches - the ON and OFF of bacterial phase variation. Mol. Microbiol. 33:919-932[CrossRef][Medline].
21. Htun, H., and J. E. Dahlberg. 1988. Single strands, triple strands, and kinks in H-DNA. Science 241:1791-1796[Abstract/Free Full Text].
22. Jennings, M. P., Y. N. Srikhanta, E. R. Moxon, M. Kramer, J. T. Poolman, B. Kuipers, and P. van der Ley. 1999. The genetic basis of phase variation repertoire of lipopolysaccharide immunotypes in Neisseria meningitidis. Microbiology 145:3013-3021[Abstract/Free Full Text].
23. Karimi, Y. 1963. Conservation naturelle de la peste dans le sol. Bull. Soc. Pathol. Exot. 6:1183-1186.
24. Mobley, H. L. T., M. D. Island, and R. P. Hausinger. 1995. Molecular biology of microbial ureases. Microbiol. Rev. 59:451-480[Abstract/Free Full Text].
25. Mollaret, H. H. 1963. Conservation expérimentale de la peste dans le sol. Bull. Soc. Pathol. Exot. 6:1168-1182.
26. Mollaret, H. H., V. B. Nguyen, M. Vandekerkove, Y. Karimi, and M. Eftekhari. 1964. Sur l'uréase du bacille de Yersin. Ann. Inst. Pasteur 107:424-429[Medline].
27. Perry, R. D., and J. D. Fetherston. 1997. Yersinia pestis: etiologic agent of plague. Clin. Microbiol. Rev. 10:35-66[Abstract].
28. Perry, R. D., S. C. Straley, J. D. Fetherston, D. J. Rose, J. Gregor, and F. R. Blattner. 1998. DNA sequencing and analysis of the low-Ca2+-response plasmid pCD1 of Yersinia pestis KIM5. Infect. Immun. 66:4611-4623[Abstract/Free Full Text].
29. Reed, L. J., and H. A. Muench. 1938. A simple method of estimating fifty per cent endpoints. Am. J. Hyg. 27:493-497.
30. Riot, B., P. Berche, and M. Simonet. 1997. Urease is not involved in the virulence of Yersinia pseudotuberculosis in mice. Infect. Immun. 5:1985-1990.
31. Ripley, L. S. 1990. Frameshift mutation: determinants of specificity. Annu. Rev. Genet. 24:189-213[CrossRef][Medline].
32. Roggenkamp, A., A. M. Geiger, L. Leitritz, A. Kessler, and J. Heesemann. 1997. Passive immunity to infection with Yersinia spp. mediated by anti-recombinant V antigen is dependent on polymorphism of V antigen. Infect. Immun. 65:446-451[Abstract].
33. Rosqvist, R., M. Skurnik, and H. Wolf-Watz. 1988. Increased virulence of Yersinia pseudotuberculosis by two independent mutations. Nature 334:522-525[CrossRef][Medline].
34. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
35. Simonet, M., B. Riot, N. Fortineau, and P. Berche. 1996. Invasin production by Yersinia pestis is abolished by insertion of an IS200-like element within the inv gene. Infect. Immun. 64:375-379[Abstract].
36. Skurnik, M., A. Peippo, and E. Ervela. 2000. Characterization of the O-antigen gene clusters of Yersinia pseudotuberculosis and the cryptic O-antigen cluster of Yersinia pestis shows that the plague bacillus is most closely related to and has evolved from Y. pseudotuberculosis serotype O:1b. Mol. Microbiol. 37:316-330[CrossRef][Medline].
37. Surgalla, M. J., and E. D. Beesley. 1969. Congo red agar plating medium for detecting pigmentation in Pasteurella pestis. Appl. Microbiol. 18:834-837[Medline].
38. Trieu-Cuot, P., C. Carlier, C. Poyart-Salmeron, and P. Courvalin. 1991. An integrative vector exploiting the transposition properties of Tn1545 for insertional mutagenesis and cloning of genes from Gram-positive bacteria. Gene 106:21-27[CrossRef][Medline].
39. Wren, B. W., S. M. Colby, R. R. Cubberley, and M. J. Pallen. 1992. Degenerate PCR primers for the amplification of fragments from genes encoding response regulators from a range of pathogenic bacteria. FEMS Microbiol. Lett. 78:287-291[Medline].
40. Yang, Y., J. J. Merriam, J. P. Mueller, and R. R. Isberg. 1996. The psa locus is responsible for thermoinducible binding of Yersinia pseudotuberculosis to cultured cells. Infect. Immun. 64:2483-2489[Abstract].


Infection and Immunity, January 2001, p. 170-176, Vol. 69, No. 1
0019-9567/01/$04.00+0   DOI: 10.1128/IAI.69.1.170-176.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Arafah, S., Rosso, M.-L., Rehaume, L., Hancock, R. E. W., Simonet, M., Marceau, M. (2009). An iron-regulated LysR-type element mediates antimicrobial peptide resistance and virulence in Yersinia pseudotuberculosis. Microbiology 155: 2168-2181 [Abstract] [Full Text]  
  • Ayyadurai, S., Houhamdi, L., Lepidi, H., Nappez, C., Raoult, D., Drancourt, M. (2008). Long-term persistence of virulent Yersinia pestis in soil. Microbiology 154: 2865-2871 [Abstract] [Full Text]  
  • Huang, X.-Z., Nikolich, M. P., Lindler, L. E. (2006). Current trends in plague research: from genomics to virulence.. Clin Med Res 4: 189-199 [Abstract] [Full Text]  
  • Sebbane, F., Jarrett, C. O., Linkenhoker, J. R., Hinnebusch, B. J. (2004). Evaluation of the Role of Constitutive Isocitrate Lyase Activity in Yersinia pestis Infection of the Flea Vector and Mammalian Host. Infect. Immun. 72: 7334-7337 [Abstract] [Full Text]  
  • Marceau, M., Sebbane, F., Ewann, F., Collyn, F., Lindner, B., Campos, M. A., Bengoechea, J.-A., Simonet, M. (2004). The pmrF polymyxin-resistance operon of Yersinia pseudotuberculosis is upregulated by the PhoP-PhoQ two-component system but not by PmrA-PmrB, and is not required for virulence. Microbiology 150: 3947-3957 [Abstract] [Full Text]  
  • Nakano, M., Iida, T., Honda, T. (2004). Urease activity of enterohaemorrhagic Escherichia coli depends on a specific one-base substitution in ureD. Microbiology 150: 3483-3489 [Abstract] [Full Text]  
  • Chain, P. S. G., Carniel, E., Larimer, F. W., Lamerdin, J., Stoutland, P. O., Regala, W. M., Georgescu, A. M., Vergez, L. M., Land, M. L., Motin, V. L., Brubaker, R. R., Fowler, J., Hinnebusch, J., Marceau, M., Medigue, C., Simonet, M., Chenal-Francisque, V., Souza, B., Dacheux, D., Elliott, J. M., Derbise, A., Hauser, L. J., Garcia, E. (2004). Insights into the evolution of Yersinia pestis through whole-genome comparison with Yersinia pseudotuberculosis. Proc. Natl. Acad. Sci. USA 101: 13826-13831 [Abstract] [Full Text]  
  • Motin, V. L., Georgescu, A. M., Fitch, J. P., Gu, P. P., Nelson, D. O., Mabery, S. L., Garnham, J. B., Sokhansanj, B. A., Ott, L. L., Coleman, M. A., Elliott, J. M., Kegelmeyer, L. M., Wyrobek, A. J., Slezak, T. R., Brubaker, R. R., Garcia, E. (2004). Temporal Global Changes in Gene Expression during Temperature Transition in Yersinia pestis. J. Bacteriol. 186: 6298-6305 [Abstract] [Full Text]  
  • Oyston, P.C. F., Prior, J.L., Kiljunen, S., Skurnik, M., Hill, J., Titball, R.W. (2003). Expression of heterologous O-antigen in Yersinia pestis KIM does not affect virulence by the intravenous route. J Med Microbiol 52: 289-294 [Abstract] [Full Text]  
  • Collyn, F., Lety, M.-A., Nair, S., Escuyer, V., Ben Younes, A., Simonet, M., Marceau, M. (2002). Yersinia pseudotuberculosis Harbors a Type IV Pilus Gene Cluster That Contributes to Pathogenicity. Infect. Immun. 70: 6196-6205 [Abstract] [Full Text]  
  • Sebbane, F., Mandrand-Berthelot, M.-A., Simonet, M. (2002). Genes Encoding Specific Nickel Transport Systems Flank the Chromosomal Urease Locus of Pathogenic Yersiniae. J. Bacteriol. 184: 5706-5713 [Abstract] [Full Text]  
  • Carnoy, C., Floquet, S., Marceau, M., Sebbane, F., Haentjens-Herwegh, S., Devalckenaere, A., Simonet, M. (2002). The Superantigen Gene ypm Is Located in an Unstable Chromosomal Locus of Yersinia pseudotuberculosis. J. Bacteriol. 184: 4489-4499 [Abstract] [Full Text]  
  • Rossi, M.-S., Fetherston, J. D., Letoffe, S., Carniel, E., Perry, R. D., Ghigo, J.-M. (2001). Identification and Characterization of the Hemophore-Dependent Heme Acquisition System of Yersinia pestis. Infect. Immun. 69: 6707-6717 [Abstract] [Full Text]  
  • Klevytska, A. M., Price, L. B., Schupp, J. M., Worsham, P. L., Wong, J., Keim, P. (2001). Identification and Characterization of Variable-Number Tandem Repeats in the Yersinia pestis Genome. J. Clin. Microbiol. 39: 3179-3185 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sebbane, F.
Right arrow Articles by Simonet, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sebbane, F.
Right arrow Articles by Simonet, M.