Previous Article | Next Article ![]()
Infection and Immunity, October 2001, p. 6201-6208, Vol. 69, No. 10
Departments of Molecular
Microbiology1 and
Pediatrics,2 Washington University
School of Medicine, St. Louis, Missouri 63110
Received 5 February 2001/Returned for modification 17 April
2001/Accepted 18 June 2001
A putative LysR-type transcriptional activator, Hre20, was
identified previously in an in vivo expression technology screen designed to identify factors which are expressed early during infection
by Yersinia enterocolitica (G. M. Young and V. L. Miller, Mol. Microbiol. 25:319-328, 1997). An insertion
in hre20, now designated rscR, resulted in
increased splenic dissemination of bacteria during infection in a
BALB/c mouse model. A nonpolar mutation was generated in
rscR, and examination of this strain in the BALB/c mouse
model demonstrated that the mutation in rscR was
responsible for the increased dissemination to the spleen that was seen
in the original experiments. RscR is homologous to the LysR family of
transcriptional regulators; thus, a screen was undertaken to identify
genes regulated by RscR. A strain containing an insertion in the
chromosomal rscR gene and carrying rscR on a
plasmid under the control of the inducible araBAD promoter
was mutagenized with an mTn5Km-2 transposon containing a
promoterless lacZY. Eighteen insertions were identified
which appeared to respond to levels of RscR, and these were classified
into four allelic groups based on Southern blot hybridization analysis.
Representative members were sequenced from three allelic groups.
Sequencing revealed insertions in an ORF with no known homologues, a
homologue of OmpF of Serratia marcescens, and a locus
(designated rscBAC) with similarity to the
hmwABC locus of Haemophilus influenzae. The hmwABC locus promotes adherence of H. influenzae to host cells (S. J. Barenkamp and J. W. St.
Geme III, Infect. Immun. 62:3320-3328, 1994; J. W. St. Geme III, S. Falkow, and S. J. Barenkamp, Proc. Natl. Acad.
Sci. USA 90:2875-2879, 1993). A strain containing a
deletion mutant of rscA, the hmwA homologue,
exhibits increased splenic dissemination of bacteria during infection
in a BALB/c mouse model, similar to the rscR mutant. This
suggests that the phenotype of an rscR mutant is due to the
loss of RscA.
Yersinia enterocolitica
infects a wide range of animal hosts, including humans, and is
transmitted through ingestion of contaminated food and water
(4). In humans, the infection generally leads to an acute
gastroenteritis which is self-limiting and manifests as fever,
diarrhea, and abdominal pain. However, in patients who are iron
overloaded or immunocompromised, a systemic infection, which frequently
is fatal, may ensue. Y. enterocolitica is a lymphotropic organism. After ingestion, the bacteria are able to cross the intestinal epithelium by invasion of specialized M cells and colonize the underlying lymphoid follicles, called Peyer's patches (PP), that line the small intestine (1). From the PP, the
bacteria can progress to the mesenteric lymph nodes (MLN) and
eventually establish a systemic infection (5).
A large number of virulence factors reside on a well-characterized
70-kb virulence plasmid (7). Several of these genes encode
a type III secretion system that exports factors, also encoded on the
virulence plasmid, into host cells which disrupt cellular function.
Other factors are chromosomally encoded, such as invasin, which has
been shown to bind to Due to the apparent role in the progression of Y. enterocolitica infection, rscR was further
characterized in the present study. Since RscR is proposed to be a
transcriptional regulator, the genes which it regulates are likely to
encode the effectors of the observed in vivo phenotype. A screen was
undertaken to identify genes regulated by RscR in order to further
understand the effect that these factors have on the course of infection.
Growth conditions.
All cultures were grown in Luria-Bertani
(LB) broth unless otherwise noted. E. coli was grown at
37°C and Y. enterocolitica was grown at 26°C, with
aeration on a roller drum. The following antibiotics were used at the
indicated concentrations: ampicillin, 100 µg/ml; CHL, 12.5 µg/ml; kanamycin (KAN), 100 µg/ml; nalidixic acid (NAL), 20 µg/ml; streptomycin, 50 µg/ml; and spectinomycin, 50 µg/ml. As a
chromogenic substrate for Bacterial strains and plasmids.
Bacterial strains and
plasmids used in this study are described in Table
1. A designation of "v"
indicates the presence of the 70-kb virulence plasmid. Electroporations
were performed as described previously (25). Restriction
enzymes and DNA ligase were purchased from New England Biolabs. PCR was
carried out using recombinant PFU (Stratagene). Sequencing was
performed with BigDye Terminator (Amersham) and reactions were
processed by the Protein and Nucleic Acid Chemistry Lab at Washington
University.
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.10.6201-6208.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Identification of a Locus Involved in Systemic
Dissemination of Yersinia enterocolitica
and
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
1 integrins on the surface of M cells and in Y. enterocolitica is important in
the initial steps of invasion (13, 21, 38). Previously, an
in vivo expression technology (IVET) screen was performed in order to
identify additional chromosomally encoded factors which are expressed
early during infection (36). In that study, random fragments of Y. enterocolitica DNA were
transcriptionally fused to a promoterless cat gene and
integrated onto the chromosome of wild-type Y. enterocolitica. Fusion of cat to an active promoter confers to the bacterium resistance to chloramphenicol (CHL). Strains
containing cat fusions were used to orally infect BALB/c mice. Y. enterocolitica strains in which the promoter
upstream of cat was transcriptionally active during
infection (i.e., in vivo) were enriched for by administration of CHL to
the mice. Fusions that were enriched in the animal were then screened
for the absence of expression under standard laboratory conditions. One
of the genes discovered by that screen was designated hre20. Hre20 was found by BLAST analysis to be 67% identical to YeiE from
Escherichia coli, which is a hypothetical protein with
homology to the LysR family of transcriptional regulators. An insertion in hre20 resulted in increased splenic dissemination of
bacteria during infection in a BALB/c mouse model, indicating a role
for the hre20 locus during infection. Based on the observed
in vivo phenotype, hre20 was designated rscR for
reduced splenic colonization regulator.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-galactosidase,
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal) was used at 40 µg/ml. For regulation of the
PBAD promoter, arabinose and glucose were used at
0.2% in LB.
TABLE 1.
Bacterial strains and plasmids used in this study
(Sm/Sp) strain, YVM617, used
in the screen was constructed as follows. A plasmid, pGY31 (pWKS30 plus
ClaI-EcoRI hre20), was utilized which
carried a partial sequence of rscR, from the upstream
ClaI site to the EcoRI site within the gene. The
(Sm/Sp) cassette from pSmuC was cloned into the
HindIII site of the rscR gene in pGY31. The
pSmuC plasmid was provided by Hao Shen and was constructed by cloning
the
(Sm/Sp) cassette from pRU875 into pMTL24 and then cloning the
cassette into pUC1129 (32). The rscR-
(Sm/Sp)
fragment was isolated by digestion with ClaI/SacII and was ligated into these sites of
the suicide vector pEP185.2 to generate the construct pKN11. This
vector was conjugated as described above into strain JB580v. A
double-crossover event to completely replace the wild-type copy of
rscR was identified by selecting for the
(Sm/Sp) cassette
and not CHL resistance, which would have selected for
integration of the whole plasmid. Clones were then tested for
sensitivity to CHL. The crossover was confirmed by Southern blot
hybridization (data not shown). The plasmid pKN14 (see below) was
electroporated into this strain.
The strains YVM690 (
rscR) and YVM776
(
rscA)were generated by the same strategy. Flanking
regions to the deletion were amplified. The primers used to construct
rscR were as follows: IFD1 (5' GGGAACAAAAGCTGGGTACCG
3') and IFD2 (5' GGAAGATCTGCTGGCAGCAATGCGTAGTG 3') to
amplify the upstream region and IFD3
(5'GGAAGATCTGAGCTTGGGAATTCTGAGGC 3') and IFD4 (5'
GCTCTAGAGGTCAACGGCGATAGTCACC 3') to amplify the downstream
region. The primers used to construct
rscA were as follows: del1 (5' CCATCGATGGCTTACGGTATTGGCGAAG 3') and del2
(5' GGAAGATCTGCCATTCACCGGCAATGAAG 3') to amplify the
upstream region and del3 (5' GGAAGATCTGTAGCGGGGTGGATATTGGC
3') and del4 (5' GCTCTAGACCTGAGGCTGCGTTATCTGC 3') to
amplify the downstream region. These fragments were cloned sequentially into pEP185.2, with a BglII linker
joining the fragments, to create pKN10.2 and pKN16, and the deletions
were confirmed by sequence analysis. These plasmids were conjugated
into JB580v as described above. Each plasmid was integrated by a
single-crossover event at the locus of interest, and this was confirmed
by Southern blot hybridization (data not shown). Cycloserine enrichment
was utilized to resolve the merodiploid (19). Southern
blot hybridization then allowed identification of clones retaining the
deleted copy of the gene. Additionally, the
(Sm/Sp) cassette was
cloned into the BglII site of pKN16
(
rscA/pEP185.2), and this new construct, designated
pKN17, was crossed onto the chromosome of JB580v by selection for the
(Sm/Sp) cassette. This strain was confirmed by Southern blot
hybridization and was designated YVM777
[
rscA::
(Sm/Sp)] (data not shown).
The inducible rscR construct, pKN14, was generated by
amplifying the rscR open reading frame (ORF), including the
ribosome binding site but excluding the putative promoter region.
Primers hreR F2 (5' CGGGATCCGATGATAGCGTCCTCCATTCT 3') and
hreR R2 (5' GCTCTAGACACCAATTCAGGGAAGAAGG 3') amplified a
934-bp product with an XbaI cleavage site at the 3' end of
the ORF. This was digested with XbaI and cloned into the
SmaI-XbaI sites of pBAD33 to generate pKN14. The
correct construct was confirmed by sequencing. The fragment was moved
from pKN14 into the SacI-PstI sites of pBAD18 to
generate pKN15. This was used for some experiments in order to have an
inducible construct with Kanr rather than
Cmr.
The transposon delivery plasmid, pRev10, was constructed as
follows: the SphI fragment of pIVET8, carrying
lacZY, was cloned into the SphI site of
pUTmTn5-Km2. This was the delivery plasmid utilized in the
mutagenesis to identify rscR regulated genes.
Animal experiments. Six- to seven-week-old BALB/c mice were used. Oral infections were performed using a 1-ml syringe with 2 in. of intramedic tubing encompassing a 21-guage needle. Bacteria were grown 16 to 18 h at 26°C and then resuspended in sterile phosphate-buffered saline to the desired concentration. Bacterial suspension (200 µl) was administered. On the indicated day postinfection, the tissues of interest were harvested and homogenized in sterile phosphate-buffered saline. The homogenates were diluted and plated to determine viable cell counts. Y. enterocolitica was selected for using NAL. Bacterial load was reported as CFU per gram of tissue. The significance of the results was assessed using the Mann-Whitney test.
Mutagenesis.
The strain YVM618 was mutagenized by delivery
of mTn5Km2-lacZY from pRev10. Conjugation was
carried out by filter mating of YVM617
[rscR::
(Sm/Sp)] carrying pKN14 and E. coli S17-1
pir containing pRev10. An aliquot (100 µl) of a 16- to 18-h culture of each strain was added to 3 ml of sterile 10 mM
MgSO4 and was pushed through a
0.45-µm-pore-size filter. The filter was placed on minimal
medium without glucose to prevent outgrowth and was incubated
overnight at 26°C. Filters were vortexed in 1 ml of
MgSO4, and 100 µl of a 1:4 dilution was plated
on LB containing NAL (to select against the E. coli donor
strain), KAN (to select for transposition), and CHL (to select for
pKN14). Plates were incubated at 26°C for 30 h, and then each
was replica plated to two plates
one containing NAL, KAN, CHL, X-Gal,
and 0.2% arabinose and one containing NAL, KAN, CHL, X-Gal, and 0.2%
glucose. Colonies were compared visually, with inspection for
differences in color after growth on arabinose compared to glucose.
Colonies displaying potential differential
-galactosidase expression
were purified, and enzyme assays were performed.
Enzyme assays.
-Galactosidase assays were performed as
previously described (19). Cultures (1 ml) were grown for
16 to 18 h at 26°C in LB containing appropriate antibiotics and
either 0.2% arabinose or 0.2% glucose as described above for the
plate assays. In initial screening, single assays were performed with
each mutant, and those displaying differential expression were then
repeated and assays were performed in duplicate. Fusions selected for
further characterization displayed fivefold or more induction in
arabinose or glucose in the repeated assays.
Screen controls.
To identify fusions to genes encoding
products involved in arabinose utilization, bacteria containing fusions
were patched onto minimal medium containing arabinose as the only
carbon source. To identify fusions responding to glucose or arabinose
rather than the presence or absence of RscR, the rscR
expression plasmid, pKN14, was cured by culturing without selection for
3 days. These cultures were diluted and plated on LB agar containing no
antibiotics. After 2 days of growth, colonies were patched to two
plates, one containing KAN and one containing CHL. Clones which
retained Kanr and lost Cmr
were selected. If both resistances were lost, this indicated a
transposon insertion on the plasmid. Selected plasmid-cured fusions
were analyzed as above for differential
-galactosidase levels in
arabinose and glucose. Fusions displaying induction after the loss of
the plasmid were removed from further consideration as it was likely
that the differential expression observed was due to the carbon source
rather than the presence or absence of RscR.
Cloning and sequencing. Chromosome-transposon junctions were cloned as follows. Total genomic DNA preparations of the mutant strains were digested with restriction enzymes known to have a unique restriction site between the KAN resistance gene and the lacZY genes of the transposon. Using the KAN resistance gene as a probe, Southern hybridization analysis was used to determine which fragment contained the fusion. After identification of potential fragments for cloning, the genomic DNA was digested with the selected enzyme and separated on an agarose gel. The approximately sized fragments, as determined from the Southern blot, were excised from the gel and the DNA was purified by Gene-Clean. These fragments were then ligated into the cloning vector pHG329 which had been linearized with the same enzyme. After the clones were obtained, these were sequenced using a primer, P6, designed from the transposon end which allows sequencing through the junction and into the disrupted gene (12).
To obtain additional sequence for the rsc locus, a clone was obtained containing the wild-type locus from an existing cosmid library described previously (37), and the clone containing the junction of the 21B2 fusion contained 12 kb of the locus, beginning within the rscB gene, was utilized. Subcloning and TnMax mutagenesis, as described previously (11), allowed compilation of the entire sequence of the region. The sequence of both strands of the DNA was determined. Nucleotide sequence accession numbers. The sequences for rscR and rscBAC may be found under accession numbers AF394928 and AF394927, respectively.| |
RESULTS |
|---|
|
|
|---|
The rscR mutation is responsible for increased
dissemination to the spleen.
The nucleotide sequence of
rscR, formerly hre20, and the surrounding DNA was
determined (Fig. 1). The predicted amino
acid sequence of RscR is 68% identical to the hypothetical protein YeiE and 24% identical to LysR of E. coli. Upstream of
rscR is a divergently transcribed ORF with 55% identity to
YeiH, the hypothetical protein encoded upstream of yeiE in
E. coli. YeiH has no homology to any other known proteins in
the database. The potential translational start site of the
yeiH homologue is 560 bp from the rscR initiation codon. Downstream of rscR is an ORF with 80% identity to
LysP of E. coli, which is also located downstream of
yeiE in E. coli. The translational start site of
the LysP homologue is 244 bp from the stop codon of rscR.
|
(lysP-lacZYA) fusion was
constructed. This fusion was integrated into the parental strain
(JB580v), a strain containing an in-frame deletion of rscR
[
rscR (YVM690)] and an
rscR::
(Sm/Sp) [YVM617] strain background
(mutant construction described below). Comparisons of
-galactosidase
activity from
(lysP-lacZYA) in the three strain
backgrounds demonstrated a modest polar effect of an insertional
mutation on the transcriptional levels of the lysP
homologue. The rscR::
(Sm/Sp) strain
had 50% less
-galactosidase activity than the wild type and the
rscR mutant (data not shown). These assays demonstrated
that an insertion in rscR,
rscR::
(Sm/Sp), did affect lysP
transcription, while the in-frame deletion of rscR,
rscR, did not exert any polar effects.
To determine if the increased dissemination to the spleen of the
originally reported rscR mutant was a result of the mutation in rscR rather than a result of polar effects on downstream
genes, the animal infection studies were repeated using the
rscR in-frame deletion strain,
rscR. To create
rscR, an rscR mutant containing a 360-bp
deletion was exchanged for the wild-type rscR by homologous recombination (see Materials and Methods). Mice were inoculated orally
with 5 × 107 CFU of either JB580v or the
rscR mutant. Mice were sacrificed on days 3, 5, and 7 postinfection. Viable cell counts of bacteria recovered from the PP,
MLN, and spleen were determined. This experiment was performed twice
and demonstrated increased dissemination to the spleen by the strain
containing the
rscR mutation on day 5 postinfection. This
result is similar to what was previously observed for the original
insertional mutant (data not shown). Therefore, the rscR
mutation, not the polar effect on downstream transcription, was
responsible for the increased dissemination to the spleen.
Screening for rscR-regulated genes.
rscR has been demonstrated to play a role in the course of
infection by Y. enterocolitica. Since RscR has homology to
the LysR family of transcriptional regulators, it was presumed that RscR does not have a direct effect on the course of infection but
instead may regulate one or more genes involved in pathogenesis. Therefore, it was of interest to determine what genes are regulated by
RscR, because these would be expected to be the effectors of the
virulence phenotype. The screen for RscR-regulated genes utilized transposon mutagenesis (Fig. 2). The
transposon used was an mTn5 derivative containing a KAN
resistance gene and a promoterless lacZY on the plasmid
designated pRev10. Transposition into a given gene in the correct
orientation will generate a transcriptional fusion to lacZY.
|
-galactosidase activity in response to
different levels of RscR. Conditions permitting control of the levels
of RscR needed to be identified. Additionally, it was of interest to
characterize the expression patterns of rscR since under
standard in vitro growth conditions (LB, 26°C) rscR was not expressed. Various in vitro conditions were examined using
-galactosidase assays in order to identify those which induced expression of
(rscR::lacZYA) and
thus could be utilized in the screen for RscR-regulated genes. The
conditions tested were the following: temperature (26 and 37°C),
O2 levels (high aeration in a flask, low aeration
in a screw-cap tube), pH {20 mM morpholineethanesulfonic acid
(MES), pH 5.5; 20 mM
piperazine-N,N'-bis(2-ethanesulfonic acid)
(PIPES), pH 6.5; 20 mM
N-tris[hydroxymethyl]methyl-3-amino-propanesulfonic acid
(TAPS), pH 8.0}, RPMI, minimal medium, iron-depleted LB (100 µM
dipyridyl), calcium-depleted LB (20 mM MgCl2, 20 mM Na oxalate), and growth phase (2-h time points for 10 h,
beginning at an optical density at 600 nm of 0.05). None of the
conditions tested affected activity from the rscR reporter
more than twofold, and therefore none were suitable to screen for
RscR-regulated genes (data not shown). To control levels of RscR,
plasmid pKN14, which carried the rscR gene under control of
the araBAD promoter (PBAD), was constructed (see Materials and Methods). This construct allowed for the
identification of genes whose transcription was affected by RscR.
The strain that was mutagenized was
rscR::
(Sm/Sp) (YVM617), which contains an
(Sm/Sp) cassette disruption in the HindIII site of
the rscR gene. rscR::
(Sm/Sp) was
created by allelic exchange utilizing selection for the resistance
marker (see Materials and Methods). pKN14 was electroporated into
rscR::
(Sm/Sp) and allows differential
expression of rscR; growth on arabinose induces expression, and growth on glucose represses expression. pRev10 was mated into the
strain rscR::
(Sm/Sp) containing the plasmid
pKN14, and transposon insertions were selected using KAN.
Kanr colonies were then replica plated to plates
containing X-Gal and either arabinose or glucose. Approximately 40,000 colonies from 38 independent matings were examined for a difference in color on arabinose or glucose, to identify fusions to genes whose expression responds to the presence or absence of RscR. Approximately 250 mutants displaying differential expression of lacZY on
plates containing arabinose or glucose were then analyzed by
-galactosidase assays. Thirty-two mutants demonstrated an induction
of fivefold or more on either arabinose or glucose and were examined further.
Several control assays were performed on these 32 mutants to identify
fusions that were differentially expressed due to factors other than
RscR levels. Mutants were tested for ability to grow on minimal medium
supplemented with arabinose in order to identify genes whose products
are involved in arabinose utilization. Two mutants were unable to grow
on minimal medium supplemented with arabinose. Additionally, mutants
were cultured without selection in order to cure the pKN14 plasmid and
then tested for induction by arabinose or glucose. This allowed
identification of genes responding to the presence of arabinose or
glucose and not to RscR; three mutants fell into this group. Curing the
plasmid also allowed identification of transposition events in which
the transposon inserted into the PBAD region of
pKN14, which resulted in lacZY expression that was
controlled by the PBAD promoter. Nine mutants were identified which contained plasmid insertions. After these control
assays, 18 mutants remained which appeared to respond to levels of RscR.
Identification and sequencing of RscR-regulated genes. Southern blot analysis indicated that the eighteen mutants belong to four allelic groups (Fig. 3). Southern blotting was performed using the KAN resistance gene as a probe. Allelic groups were determined on the basis of the same size fragments containing the KAN resistance gene for at least two different restriction enzyme digests (data not shown). To identify the potential RscR-regulated genes, transposon-chromosome junctions were cloned. Sequence data were obtained by using a primer that annealed to sequences at the transposon end. This allowed the DNA sequence of the cloned junction to be determined. The sequence was then analyzed for potential ORFs and used to search available databases for sequence homology. Other than the mutant 39A5, representative sequence data were obtained for each allelic group.
The chromosome-transposon junction of mutant 24A2 was cloned and sequenced. An ORF was present but displayed no significant homology to any proteins in the database. No apparent motifs were present to indicate function. Sequence collected from the 3I6, 23A3, and 23A4 allelic group indicates insertions in an ompF homologue most closely related to ompF from Serratia marcescens. The partial DNA sequence obtained from the clones was 71% identical and 84% similar to the S. marcescens OmpF. This allelic group retained threefold induction after curing of the plasmid but was still included because the original induction in the presence of RscR was 10-fold or greater.
-Galactosidase assays were performed comparing activity without NaCl
and with 0.3 M NaCl. Expression was 10-fold higher without NaCl,
as would be expected from a fusion to an ompF homologue
(data not shown) (23). These insertions have not been
studied further.
|
|
Expression of the rsc locus.
The 13 insertions
in the rscBAC locus all map to the hxuB
homologue, rscB, although the gene arrangement suggests an
operon structure in which insertions could have been isolated from each of the three ORFs. To begin to address the question of why transposon insertions were not isolated from rscA and rscC,
a chromosomal lacZYA fusion to rscA, the putative
effector, was generated by integration of a suicide plasmid, pFUSE,
carrying a fragment of rscA.
(rscA::lacZYA) was generated in
JB580v,
rscR, and
rovA::erm (YVM641), to create strains
YVM796, YVM797, and YVM885, respectively. RovA regulates the expression
of inv and is expected to regulate other genes in Y. enterocolitica (24). Levels of expression from the
rscA promoter as determined by monitoring
-galactosidase activity from
(rscA::lacZYA)
from these three strains were equivalent (141 ± 2, 140 ± 3, and 141 ± 2 Miller units, respectively [results are given as means ± standard deviations]). To recreate the conditions of the
screen, plasmid pKN15 containing an arabinose inducible rscR
was moved into the
rscR mutant containing
(rscA::lacZYA). When
rscR was induced with 0.2% arabinose the
-galactosidase activity from
(rscA::lacZYA) was
318 ± 31 Miller units. When rscR expression was
repressed by 0.2% glucose, the
-galactosidase activity from
(rscA::lacZYA) was 84 ± 2 Miller units. In the presence of RscR, rscA was induced
fourfold, which is an induction level that would have been excluded in
the original screen. As a control, plasmid pBAD18 was also moved into
the
rscR mutant containing
(rscA::lacZYA). No induction was
observed with the control plasmid;
-galactosidase activity from
(rscA::lacZYA) was 84 ± 3 Miller units in arabinose and 100 ± 3 Miller units in glucose.
This suggests that transposon insertions in rscA or rscC may not have displayed sufficient differential
expression to be selected in the screen, and this could explain why
none were identified.
Analysis of an rscA mutant.
In order to
determine if the rscBAC locus encodes the factor responsible
for the increased splenic colonization observed for an rscR
mutant, a deletion was made in the rscA gene, designated
rscA (YVM776). This gene was chosen because by analogy to
H. influenzae RscA would be the predicted effector and RscB
and RscC would be accessory proteins. The ORF of rscA is
6,195 bp, and the deletion removes 5,131 bp to create the
rscA mutant (see Materials and Methods). BALB/c mice were
infected orally with 108 CFU of the
rscA mutant, the
rscR mutant, or JB580v;
the
rscR strain and JB580v were tested in parallel for
comparison. For each strain, 12 mice were infected. On days 4 and 6 postinfection, six mice per strain were sacrificed, and the MLN and
spleen were harvested and viable cell counts were assessed for each
tissue. On day 4, mice infected with the parental strain looked similar to mice infected with the
rscA mutant or the
rscR mutant (Fig. 5A). By
day 6, more mice infected with either the
rscA mutant or
the
rscR mutant had a high bacterial load in the spleen
compared to mice infected with the parental strain (Fig. 5B). A second experiment again demonstrated increased bacterial dissemination to the
spleen of mice infected with the
rscA mutant or the
rscR mutant compared to JB580v at day 6 postinfection
(Fig. 5C). These results were significantly different compared to those
from wild-type-infected mice, with P values of 0.008 and
0.03 for
rscA and
rscR, respectively. In
both experiments, it appeared that the rscA mutation caused a more severe phenotype than the rscR mutation
(P = 0.06). These results demonstrate that a mutation
in rscA mimicked the phenotype observed when mice were
infected with the rscR mutant and potentially a mutation in
rscA causes an even more severe phenotype than a mutation in
rscR.
|
| |
DISCUSSION |
|---|
|
|
|---|
A previous study by Young and Miller examined the effect on
infection of an insertion in rscR (formerly called
hre20) and found that the mutant spread more rapidly to the
liver and spleen of infected mice than did the parental strain
(36). Sequencing of the region surrounding rscR
showed a gene arrangement that is similar to the organization of
yeiE and lysP in E. coli, with a
homologue of lysP downstream of rscR. In this
study, we demonstrated that an in-frame deletion in the rscR
gene also results in increased dissemination of bacteria to the spleen
after oral infection of BALB/c mice. This suggests that the phenotype
of the previously described rscR mutant was not a result of
polar effects on the downstream gene. This was confirmed by comparing
the kinetics of infection for mice infected with wild-type bacteria to
mice infected with a mutant containing the nonpolar
rscR allele.
After establishing that RscR plays a role in the course of infection, we wanted to identify genes that were regulated by RscR, because RscR is predicted to be a LysR-type transcriptional regulator. Members of the LysR family of transcriptional regulators typically utilize a coinducer for optimal function (26). Hence, it was of interest to determine in vitro conditions which could produce optimal levels of RscR and would more likely be permissive for a coinducer to be present if one is required. In vitro conditions which allowed expression of rscR from its own promoter were not identified, and the presence or absence of a necessary coinducer can only be speculated. This made it necessary to artificially induce expression of rscR from a PBAD promoter for the purpose of screening for genes regulated by RscR. A strain containing an inducible rscR was mutagenized with the mTn5Km2-lacZY transposon. However, because RscR levels may not be physiological or a necessary coinducer may not be present, some genes regulated by RscR may have been missed in the screen and the level of regulation observed is not likely to be representative of true in vivo values.
Several RscR-regulated fusions were identified in the screen and placed
into four allelic groups based on Southern blot analysis. The 39A5
mutant was not cloned or sequenced. The second group also contained
only one fusion, 24A2, and although this junction was cloned and
sequenced, the sequence did not display significant similarity to any
known proteins in the databases. The third group contained three
fusions to a gene exhibiting homology to ompF. These fusions
demonstrated differential expression in response to RscR levels
(
10-fold induction in arabinose) but also displayed differential
expression to arabinose and glucose in the absence of RscR (threefold
induction in arabinose). Studies in other systems have shown
ompF to be regulated by many factors, including the carbon
source (23). The fourth group of 13 insertions was located in a 12-kb region of the chromosome. This region was sequenced, and
three ORFs were identified which were designated rscBAC (for reduced splenic colonization).
Although indirect, the observed in vivo phenotype of the
rscA mutant indicates that RscR regulates expression of
rscBAC in the host environment. If the presence of RscR is
necessary for proper expression of the rscBAC locus, then
one would predict that a mutation in the regulator would have an effect
on infection similar to that of a deletion of one of the genes in the
locus. A comparison of the kinetics of infection of the parental
strain, the
rscR mutant, and the
rscA
mutant demonstrated that for both mutants there were increased numbers
of mice with bacterial colonization of the spleen, with the
rscA mutant colonizing the largest number of spleens by
day 6 postinfection. The phenotype of a
rscA mutant appears slightly more severe than that of a
rscR mutant,
which could be explained if there is a basal level of transcription of
the rscBAC locus in the absence of RscR. If this were the
case, then a
rscR mutant would be producing a low level
of RscA during infection and this could prevent the phenotype from
being as severe as a
rscA mutant which expresses no
functional RscA. These data along with the reporter fusion studies
suggest that RscR, directly or indirectly, activates rscA expression.
The rscBAC locus is most similar to the hmwABC locus of H. influenzae. HmwA is a surface-expressed protein which promotes adherence to various epithelial cell lines in vitro and has been demonstrated to be expressed in clinical isolates from patients with acute otitis media (17). HmwA is expressed as a 150-kDa protein which contains a nontraditional signal sequence of 68 amino acids (9). These 68 amino acids are cleaved after secretion across the inner membrane by the general secretory pathway. A second cleavage event takes place after amino acid 441, concurrent with secretion across the outer membrane, to produce the mature 125-kDa protein, though this processing has been shown not to be essential for adherence. HmwB is essential for surface expression and the second cleavage of HmwA (30). Mutations in hmwB lead to the presence of unprocessed HmwA and probable degradation in the periplasm. Mutations in hmwC result in reduced levels of HmwA, and the protein is present in the unprocessed form. Null mutations in both hmwB or hmwC result in loss of adherence.
RscA has a putative nontraditional signal sequence which contains a number of charged residues in the first 47 amino acids followed by a typical signal sequence with a predicted cleavage site after residue 69. This is the same distribution of residues present in the HmwA 68-amino-acid signal sequence (9). Additionally, the second cleavage event of HmwA at amino acid 441 contains WLLDP, and this motif is present in RscA at residues 460 to 464, with predicted cleavage after residue 463. Another motif, NPNGI, is present in the amino terminus of HmwA (residues 150 to 154) as well as three related proteins: ShlA of S. marcescens, HpmA of Proteus mirabilis, and HhdA of Haemophilus ducreyi (20, 27, 30, 33). This family of proteins is grouped together based upon the mechanism of processing and secretion. Each protein has an associated outer membrane protein that functions in processing the protein to its mature form and in transport across the outer membrane. The NPNGI sequence is suggested to be a point of contact with the outer membrane transporter, which is identified as HmwB for HmwA (14, 28). The NPNGI motif is also present in RscA at residues 154 to 158, suggesting that RscA is a new member of this family of proteins. The hmwABC locus is unique in that it encodes a third functional protein, HmwC, which does not have homologues in the other related loci (2). RscC is the first identified homologue of HmwC, and this could suggest that HmwABC and RscBAC are functionally similar. RscA has the highest similarity to the adhesin HmwA, and the similarity spans the entire protein. However, RscA does have significant homology to other outer membrane and some secreted proteins with diverse functions and activities. For example, RscA is similar to a filamentous hemagglutinin-like protein of H. ducreyi which is suspected to be involved in forming lesions in the rabbit model of infection (35). RscA is also similar to the ShdA protein of Salmonella enterica, which is involved in fecal shedding of the bacteria and believed to be important in the spread of the bacteria among livestock and domestic fowl populations (16).
Adhesins have been shown to be important in the pathogenesis of
numerous bacteria. Initial colonization of a pathogen at a particular
site often requires a surface molecule which promotes adherence to the
host cells. From these experiments it does not appear that RscA would
function in initial colonization. Kinetic analysis of the
rscR and
rscA did not demonstrate a defect
in the colonization of the PP, the initial site of a Y. enterocolitica infection (data not shown). In contrast, a mutation
in inv, the gene encoding the surface protein invasin,
results in greatly decreased colonization of the PP at early time
points postinfection (21). Adhesins can function in later
steps of infection as well. The YadA adhesin of Y. enterocolitica has been demonstrated to be important in the
persistence of bacterial colonization in the PP (22). It
is possible that RscA could function as an adhesin for a particular
cell type during infection, and loss of adherence in an rscA
mutant results in the altered kinetics seen in this study. Future
experiments will examine the ability of the rscBAC locus to
promote adherence to different cell types in vitro.
This study demonstrated that the RscR protein affects the normal progression of disease in the BALB/c mouse model of Y. enterocolitica infection. The rscBAC locus was identified in a transposon mutagenesis screen to be regulated by RscR, and a deletion in the rscA gene results in an alteration of the normal infection kinetics of Y. enterocolitica similar to that of an rscR mutant. The rapid dissemination to the spleen of the rscR and rscA mutants is an unusual phenotype. This alteration of infection kinetics could impact the virulence of Y. enterocolitica. Further study should elucidate more specifically the role that the rscBAC locus and related loci in other pathogenic bacteria play during infection.
| |
ACKNOWLEDGMENTS |
|---|
We thank A. S. Gort for excellent assistance in inoculations of all animals used in this study and critical review of the manuscript. We also thank P. A. Revell for construction of the pRev10 plasmid and the members of the Miller laboratory for valuable discussions.
This work was supported by National Institute of Health (NIH) grant AI 42736 awarded to V. L. Miller. K. M. Nelson was also supported by the NIH Cellular and Molecular Biology training grant 5 T32 GM07067 between 1 September 1997 and 1 August 2000.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Pediatrics, Washington University School of Medicine, 660 S. Euclid Ave., Campus Box 8208, St. Louis, MO 63110. Phone: (314) 286-2891. Fax: (314) 286-2896. E-mail: virginia{at}borcim.wustl.edu.
Present address: Department for Food Science and Technology,
University of California, Davis, CA 95616.
Editor: V. J. DiRita
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Autenrieth, I. B., and R. Firsching.
1996.
Penetration of M cells and destruction of Peyer's patches by Yersinia enterocolitica: an ultrastructural and histological study.
J. Med. Microbiol.
44:285-294 |
| 2. |
Barenkamp, S. J., and J. W. St. Geme, III.
1994.
Genes encoding high-molecular-weight adhesion proteins of nontypeable Haemophilus influenzae are part of gene clusters.
Infect. Immun.
62:3320-3328 |
| 3. | Baumler, A. J., R. M. Tsolis, A. W. M. van der Veldon, I. Stojiljkovic, S. Anic, and F. Heffron. 1996. Identification of a new iron regulated locus of Salmonella typhi. Gene 183:207-213[CrossRef][Medline]. |
| 4. |
Bottone, E. J.
1997.
Yersinia enterocolitica: the charisma continues.
Clin. Microbiol. Rev.
10:257-276 |
| 5. |
Carter, P. B.
1975.
Pathogenicity of Yersinia enterocolitica for mice.
Infect. Immun.
11:164-170 |
| 6. |
Cope, L. D.,
R. Yogev,
U. Muller-Eberhard, and E. J. Hansen.
1995.
A gene cluster involved in the utilization of both free heme and heme:hemopexin by Haemophilus influenzae type B.
J. Bacteriol.
177:2644-2653 |
| 7. | Cornelis, G. R., and H. Wolf-Watz. 1997. The Yersinia Yop virulon: a bacterial system for subverting eukaryotic cells. Mol. Microbiol. 23:861-867[CrossRef][Medline]. |
| 8. |
de Lorenzo, V.,
M. Herrero,
U. Jakubzik, and K. N. Timmis.
1990.
Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria.
J. Bacteriol.
172:6568-6572 |
| 8a. | Dube, P. H., P. A. Revell, D. D. Chaplin,
R. G. Lorenz, and V. L. Miller. A role for IL-1 in
inducing pathologic inflammation during bacterial infection. Proc.
Natl. Acad. Sci. USA, in press.
|
| 9. | Grass, S., and J. W. St. Geme, III. 2000. Maturation and secretion of the non-typeable Haemophilus influenzae HMW1 adhesin: roles of the N-terminal and C-terminal domains. Mol. Microbiol. 36:55-67[CrossRef][Medline]. |
| 10. |
Guzman, L.,
D. Belin,
M. J. Carson, and J. Beckwith.
1995.
Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter.
J. Bacteriol.
177:4121-4130 |
| 11. |
Haas, R.,
A. F. Kahrs,
D. Facius,
H. Allmeier,
R. Schmitt, and T. F. Meyer.
1993.
TnMax a versatile mini-transposon for the analysis of cloned genes and shuttle mutagenesis.
Gene
130:23-31[CrossRef][Medline].
|
| 12. |
Hensel, M.,
J. E. Shea,
C. Gleeson,
M. D. Jones,
E. Dalton, and D. W. Holden.
1995.
Simultaneous identification of bacterial virulence genes by negative selection.
Science
269:400-403 |
| 13. |
Isberg, R. R., and J. M. Leong.
1990.
Multiple 1 chain integrins are receptors for invasin, a protein that promotes bacterial penetration into mammalian cells.
Cell
60:861-871[CrossRef][Medline].
|
| 14. |
Jacob-Dubuisson, F.,
C. Buisine,
E. Willery,
G. Renauld-Mongeniw, and C. Locht.
1997.
Lack of functional complementation between Bordetella pertussis filamentous hemagglutinin and Proteus mirabilis HpmA hemolysin secretion machineries.
J. Bacteriol.
179:775-783 |
| 15. |
Kinder, S. A.,
J. L. Badger,
G. O. Bryant,
J. C. Pepe, and V. L. Miller.
1993.
Cloning of the YenI restriction endonuclease and methyltransferase from Yersinia enterocolitica serotype O:8 and construction of a transformable R M+ mutant.
Gene
136:271-275[CrossRef][Medline].
|
| 16. |
Kingsley, R. A.,
K. van Amsterdam,
N. Kramer, and A. J. Baumler.
2000.
The shdA gene is restricted to serotypes of Salmonella enterica subspecies I and contributes to efficient and prolonged fecal shedding.
Infect. Immun.
68:2720-2727 |
| 17. |
Krasan, G. P.,
D. Cutter,
S. L. Block, and J. W. St. Geme, III.
1999.
Adhesin expression in matched nasopharyngeal and middle ear isolates of nontypeable Haemophilus influenzae from children with acute otitis media.
Infect. Immun.
67:449-454 |
| 18. |
Mahan, M. J.,
J. W. Tobias,
J. M. Slauch,
P. C. Hanna,
R. J. Collier, and J. J. Mekalanos.
1995.
Antibiotic-based selection for bacterial genes that are specifically induced during infection of a host.
Proc. Natl. Acad. Sci. USA
92:669-673 |
| 19. | Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 20. | Palmer, K. L., and R. S. Munson, Jr. 1995. Cloning and characterization of the genes encoding the haemolysin of Haemophilus ducreyi. Mol. Microbiol. 18:821-830[CrossRef][Medline]. |
| 21. |
Pepe, J. C., and V. L. Miller.
1993.
Yersinia enterocolitica invasin: a primary role in the initiation of infection.
Proc. Natl. Acad. Sci. USA
90:6473-6477 |
| 22. |
Pepe, J. C.,
M. R. Wachtel,
E. Wagar, and V. L. Miller.
1995.
Pathogenesis of defined invasion mutants of Yersinia enterocolitica in a BALB/c mouse model of infection.
Infect. Immun.
63:4837-4848 |
| 23. | Pratt, L. A., W. Hsing, K. E. Gibson, and T. J. Silhavy. 1996. From acids to osmZ: multiple factors influence synthesis of the OmpF and OmpC porins in Escherichia coli. Mol. Microbiol. 20:911-917[CrossRef][Medline]. |
| 24. | Revell, P. A., and V. L. Miller. 2000. A chromosomally encoded regulator is required for expression of the Yersinia enterocolitica inv gene and for virulence. Mol. Microbiol. 35:677-685[CrossRef][Medline]. |
| 25. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 26. | Schell, M. A. 1993. Molecular biology of the LysR family of transcriptional regulators. Annu. Rev. Microbiol. 47:597-626[CrossRef][Medline]. |
| 27. |
Schiebel, E.,
H. Schwarz, and V. Braun.
1989.
Subcellular location and unique secretion of the hemolysin of Serratia marcescens.
J. Biol. Chem.
264:16311-16320 |
| 28. | Schonherr, R., R. Tsolis, T. Focareta, and V. Braun. 1993. Amino acid replacements in the Serratia marcescens hemolysin ShlA define sites involved in activation and secretion. Mol. Microbiol. 6:1229-1237. |
| 29. | Stewart, G. S. A. B., S. Lubinsky-Mink, C. G. Jackson, A. Kassel, and J. Kuhn. 1986. pHG165: a pBR322 copy number derivative of pUC8 for cloning and expression. Plasmid 15:172-181[CrossRef][Medline]. |
| 30. | St. Geme, J. W., III, and S. Grass. 1998. Secretion of the Haemophilus influenzae HMW1 and HMW2 adhesins involves a periplasmic intermediate and requires the HMWB and HMWC proteins. Mol. Microbiol. 27:617-630[CrossRef][Medline]. |
| 31. |
St. Geme, J. W., III,
S. Falkow, and S. J. Barenkamp.
1993.
High-molecular-weight proteins of non-typeable Haemophilus influenzae mediate attachment to human epithelial cells.
Proc. Natl. Acad. Sci. USA
90:2875-2879 |
| 32. | Ubben, D., and R. Schmitt. 1987. A transposable promoter and transposable promoter probes derived from Tn1721. Gene 53:127-134[CrossRef][Medline]. |
| 33. |
Uphoff, T. S., and R. A. Welch.
1990.
Nucleotide sequencing of the Proteus mirabilis calcium-independent genes (hpmA and hpmB) reveals sequence similarity with the Serratia marcescens hemolysin genes (shlA and shlB).
J. Bacteriol.
172:1206-1216 |
| 34. | Wang, R. F., and S. R. Kushner. 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100:195-199[CrossRef][Medline]. |
| 35. |
Ward, C. K.,
S. R. Lumbley,
L. D. Cope, and E. J. Hansen.
1998.
Haemophilus ducreyi secretes a filamentous hemagglutinin-like protein.
J. Bacteriol.
180:6013-6022 |
| 36. | Young, G. M., and V. L. Miller. 1997. Identification of novel chromosomal loci affecting Yersinia enterocolitica pathogenesis. Mol. Microbiol. 25:319-328[CrossRef][Medline]. |
| 37. |
Young, G. M.,
M. J. Smith,
S. A. Minnich, and V. L. Miller.
1999.
The Yersinia enterocolitica motility master regulatory operon, flhDC, is required for flagellin production, swimming motility, and swarming motility.
J. Bacteriol.
181:2823-2833 |
| 38. |
Young, V. B.,
S. Falkow, and G. K. Schoolnik.
1992.
The invasin protein of Yersinia enterocolitica: internalization of invasin-bearing bacteria is associated with reorganization of the cytoskeleton.
J. Cell Biol.
116:197-207 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»