Previous Article | Next Article 
Infection and Immunity, November 2001, p. 6618-6624, Vol. 69, No. 11
Department of Microbiology, College of
Biological Sciences,1 and Department of
Molecular Virology, Immunology and Medical Genetics, College of
Medicine and Public Health,2 The Ohio State
University, Columbus, Ohio 43210
Received 17 May 2001/Returned for modification 7 July 2001/Accepted 6 August 2001
Iron is an important element for the growth of microorganisms as
well as in the defense of the host by serving as a catalyst for the
generation of free radicals via the Fenton/Haber-Weiss reactions. The
iron transporter natural resistance-associated macrophage protein 1 (Nramp1) confers resistance to the growth of a variety of intracellular
pathogens including Mycobacterium avium. Recently several
other proteins that are involved in iron transport, including the
highly homologous iron transporter Nramp2 and the transferrin
receptor-associated protein HFE (hereditary hemochromatosis protein),
have been described. The relationship of these proteins to host defense
and to the growth of intracellular pathogens is not known. Here, we
report that infection with M. avium differentially
regulates mRNA expression of the proteins associated with iron
transport in murine peritoneal macrophages. Both Nramp1 and Nramp2 mRNA
levels increase following infection, while the expression of
transferrin receptor mRNA decreases. The level of expression of HFE
mRNA remains unchanged. The difference in the expression of the mRNA of
these proteins following infection or cytokine stimulation suggests
that they may play an important role in host defense by maintaining a
delicate balance between iron availability for host defense and at the
same time limiting iron availability for microbial growth.
Iron is an important element for the
growth of microorganisms (42, 54, 55) as well as in the
defense mounted by the host (11, 12, 35, 58). Pathogens
secrete exochelins and siderophores to capture iron from mammalian
hosts (54, 56). At the same time, the host attempts to
limit the availability of iron to suppress the growth of a variety of
microorganisms (5, 57). During infection, the level of
iron in serum decreases, the import of iron from the intestinal lumen
into the circulation decreases, the expression of transferrin receptors
by host macrophages and other cells decreases, and the production of
reactive nitrogen intermediates further sequesters the available
iron (13, 17, 29, 38, 47). These changes in the
availability of iron, which ultimately affect the production of red
blood cells, have been referred to as an anemia of infection (13,
32).
Recently, several proteins that play important roles in controlling the
availability of iron in mammalian hosts have been described. These
include Nramp1, the natural resistance-associated protein (4, 21,
24) that is member of the solute carrier (SLC11A1) family of ion
transporters (30). Work by us (33) and by
Blackwell et al. (4) has shown that Nramp1 is an
antiporter, expressed on phagosomes and primary phagolysosomes
(26, 46), that transports iron into the phagosome
(33), where it catalyzes the Haber-Weiss reaction
(60). This results in an increase in the production of
highly microbiocidal hydroxyl radicals. Another protein, termed DMT-1
(divalent metal ion transporter) (1) or DCT-1 (divalent
cation transporter) (27), was identified by positional
cloning and shown to be associated with microcytic anemia in mice
(20, 25). This protein, which was initially cloned from
the mk/mk mice and shown to have 78% homology to Nramp1, has also been
referred to as Nramp2. The protein is expressed primarily in intestinal
epithelial cells and transports iron from the intestinal lumen into
blood circulation (10, 19, 59). Finally, HFE is a
nonclassical major histocompatibility complex class I protein with an
associated Given the importance of iron to the invading pathogen and its role in
homeostasis as well as its importance in host defense, we sought to
understand how the expression of these proteins is regulated on
infection with the intracellular pathogen Mycobacterium avium. Our results indicate that a complex relationship exists between the host cell and the pathogen that results in changes in the
expression of Nramp1, Nramp2, and TfR. The level of HFE remained
relatively constant throughout the course of infection.
Mice.
Male BALB/c mice were purchased from Harlan
Sprague-Dawley (Indianapolis, Ind.) when 4 to 6 weeks of age and given
food and water ad libitum. The mice were used as macrophage donors when 6 to 10 weeks old.
Reagents.
Iscove's modified Dulbecco's medium (IMDM),
phosphate-buffered saline, and penicillin/streptomycin were purchased
from Life Technologies (Gaithersburg, Md.). Fetal bovine serum was
purchased from Harlan Bioproducts for Science (Indianapolis, Ind.).
Recombinant mouse gamma interferon (IFN- Cell culture.
Mouse peritoneal macrophages were elicited by
intraperitoneal injection of 4% sterile thioglycollate medium (Difco,
Detroit, Mich.) 3 days previously. The macrophages were harvested by
lavage using phosphate-buffered saline washed and plated at 6 × 106 cells per well in six-well culture plates in complete
IMDM medium (10% fetal bovine serum 100 U of penicillin per ml, 100 µg of streptomycin per ml) at 37°C in 5% CO2 in air.
After overnight culture, nonadherent cells were washed away with IMDM
and the macrophage monolayer was infected with M. avium
(ATCC 35712) at an 8:1 bacterium-to-macrophage ratio in complete IMDM
without antibiotics or stimulated as described in the text. Prior to
use, the bacteria were grown in Middlebrook 7H9 medium and stored as 1-ml aliquots at Construction of DNA plasmids of Nramp2, TfR, and HFE.
The
mRNA sequences for murine Nramp2, TfR, and HFE were obtained from
GenBank (accession numbers: L33415 for Nramp2, X57349 for TfR, and
NM010424 for HFE). The reverse transcription-PCR (RT-PCR) primers are
as follows: for Nramp2, forward (887)
5'TCAAGTCTAGACAGGTGAATCG3' and reverse (1620)
5'GGTCAAATAAGCCACGCTAAC3'; for TfR, forward (253) 5'TACCTGGGCTATTGTAAGCGT3' and reverse
(986) 5'GATGACTGAGATGGCGGAAAC3'; and for HFE,
forward (397) 5'CTGGACCATCATGGGCAACTA3' and
reverse (791) 5'GACACCTTAGAGAGGTCCCCGTAG3'.
Briefly, the cDNA fragments of Nramp2, TfR, and HFE were
amplified by RT-PCR with 1 to 2 µg of RAW264.7 macrophage total RNA
using a Titan One Tube RT-PCR kit from Roche (Indianapolis, Ind.) as
specified by the manufacturer. The RT-PCR products were confirmed by
electrophoresis in 1.5% agarose gels. The cDNA fragments of each gene
were then subcloned into a pGEM-T Easy vector from Promega
(Madison, Wis.) The plasmids were then transformed into
DH5 RPA.
Total-mouse RNA was extracted using the RNAqueous kit
(Ambion, Austin, Tex.) as specified by the manufacturer. A total of 6 to 20 µg of RNA was used for each RNase protection assay (RPA) sample. A mixture of purified linearized plasmid DNAs was used as a
template to synthesize radiolabeled RNA probes using the RiboQuant in
vitro transcription kit (BD PharMingen, San Diego, Calif.) with minor
modifications. A total of 900,000 cpm of probe was used for every 10 µg of total RNA. The RPA was performed using the RiboQuant RPA kit
(BD PharMingen). Denatured RNA samples were run on a 6% acrylamide
gel. Dried gels were exposed to Kodak MR film for various periods
depending on the efficiency of labeling.
Data analysis.
All films were scanned and intensities were
measured using the SigmaScanPro 4 software (SPSS Science, Chicago,
Ill.). The data were normalized to GAPDH and expressed as the
percentage of unstimulated cells. The results were analyzed by analysis
of variance (ANOVA).
Infection with M. avium stimulates the expression of
Nramp proteins.
The results in Fig.
1 show that infection of peritoneal
macrophages with M. avium resulted in an increase in both
Nramp1 and Nramp2 mRNA levels. The increase in the Nramp2 mRNA level
occurred within 2 h of infection and reached its peak within 8 h.
The increase in the Nramp1 mRNA level occurred at 8 h after infection
and reached its peak by 20 h. The levels of both Nramp1 and Nramp2
mRNA remained relatively constant thereafter. In contrast to the
increase in the expression of Nramp1 and Nramp2 mRNA, the expression of
the TfR mRNA gradually decreased following infection with the
mycobacterium (Fig. 1). There was little change in the level of HFE
mRNA in peritoneal macrophages.
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.11.6618-6624.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Infection with Mycobacterium avium
Differentially Regulates the Expression of Iron Transport Protein mRNA
in Murine Peritoneal Macrophages
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
2-microglobulin (14, 15, 18). A
mutation in HFE leads to hereditary hemochromatosis (iron overload
disease). The mutation is an S282Y mutation and occurs in the alpha 3 domain (15, 31). The mutated cysteine disrupts the
association with 2-microglobulin, resulting in an
unstable protein. The function of HFE is to regulate the binding of
transferrin by the transferrin receptor (TfR) (31, 44,
49). Association of HFE with TfR limits the amount of
transferrin that can be transported into cell (45).
Without HFE, transferrin binds to its receptors and is transported into
cells, thus causing iron overload. HFE is expressed in virtually all
tissues and is highly expressed in intestinal epithelial cells as well
as in circulating monocytes and granulocytes and in tissue macrophages
(41).
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) was also purchased from
Life Technologies, while bacterial lipopolysaccharide (LPS;
Escherichia coli O111:B4) and recombinant mouse tumor
necrosis factor alpha (TNF-
) were obtained from Sigma (St. Louis,
Mo.). Recombinant mouse interleukin-1 (IL-1) and
granulocyte-macrophage colony-stimulating factor (GM-CSF) were
purchased from R&D Systems (Minneapolis, Minn.).
NG-monomethyl-l-arginine (NMMA) was
from Calbiochem (La Jolla, Calif.). [-32P]UTP (3,000 Ci/mmol) was obtained from Amersham (Piscataway, N.J.). All reagents
contained less than 0.03 ng of LPS per ml. To minimize contamination by
environmental LPS, baked utensils, disposable plasticware, and
pyrogen-free water were used during the preparation of buffers and reagents.
70°C until use. The number of bacteria was
confirmed by plate count on 7H11 agar plates supplemented with oleic
acid-albumin-dextrose complex (OADC; Difco).
-competent E. coli cells (Life Technologies) and
selected for ampicillin resistance. Resistant clones were grown in
Luria-Bartani broth with ampicillin, and plasmid DNA was isolated using
the High Pure plasmid isolation kit from Roche. The orientation of all
the plasmids was confirmed by sequencing from the T7 primer site (Ohio
State University Sequencing Facility). Construction of a plasmid
containing the DNA sequence for glyceraldehyde phosphate dehydrogenase
(GAPDH) has been described elsewhere by us (48). The
Nramp1 probe was derived by digesting a full-length Nramp1 cDNA clone
with BglI and XbaI. The resulting fragment,
nucleotides 858 to 1057, was gel purified and subcloned into
pBluescript SK(). The isolated plasmids containing the cDNA inserts
for Nramp1, Nramp2, TfR, HFE, and GAPDH were linearized by cutting with
XbaI, BamHI, HindIII,
PstI, and HindIII, respectively. The
linearized plasmid DNAs were purified separately on 1.5% agarose gels
and recovered by using the Concert Rapid Gel extraction system (Life Technologies).
RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
View larger version (46K):
[in a new window]
FIG. 1.
Time course of the effect of M. avium
stimulation on mRNA levels of iron transport proteins in
thioglycollate-elicited murine peritoneal macrophages. Total RNA was
extracted after macrophages were stimulated with M. avium
(M. a.) for the different periods. Equal amounts of total RNA were used
for RPA. (A) One representative experiment using purified BALB/c
thioglycollate-elicited peritoneal macrophages. (B) Data are expressed
as mean and standard deviation for six determinations. The increase in
Nramp1 and Nramp2 mRNA expression is significant at P < 0.05 and P < 0.01, respectively. The decrease in
TfR mRNA expression is significant at P < 0.05 as
determined by ANOVA.
Cycloheximide superinduces Nramp2 mRNA.
The addition of
cycloheximide (CHX) to cultures of BALB/c thioglycollate-elicited
peritoneal macrophages did not affect the expression of Nramp1 mRNA
(Fig. 2). However, CHX superinduced Nramp2 mRNA. Infection of macrophages with M. avium did not
result in a further increase in Nramp2 induction.
|
IFN- treatment differentially affects mRNA expression of the
iron transport proteins.
Treatment of thioglycollate-elicited
peritoneal macrophages with IFN- resulted in a decrease in the
expression of TfR mRNA (Fig. 3, top
panel). The decline in TfR expression was apparent within 8 h following the addition of 100 U of IFN- per ml. The level of HFE mRNA, which increased by 30% initially, returned to basal
levels within 8 h. IFN- resulted in a decrease in Nramp2 mRNA,
while the level of Nramp1 mRNA was not affected. Infection of
IFN--primed cells with M. avium resulted in a more rapid
decline in TfR expression as well as a decrease in HFE mRNA expression (Fig. 3, middle and bottom panels). Infection of IFN--primed macrophages with M. avium reversed the inhibitory effect of
IFN- on Nramp2 mRNA levels. The increase in Nramp2 mRNA expression in IFN- primed cells following M. avium infection was
similar to that observed in cells that had been infected with M. avium but not pretreated with IFN-. In contrast, the expression
of Nramp1 mRNA increased in IFN- primed macrophages following
M. avium infection, but not at the level attained by
infecting the cells with M. avium alone.
|
Treatment of macrophages with proinflammatory cytokines increases
the expression of Nramp 1 and Nramp 2 mRNA.
The results in Fig.
4 show that treatment of
thioglycollate-elicited peritoneal macrophages with LPS or with TNF-
stimulated an increase in Nramp1 and Nramp2 mRNA levels while
decreasing the expression of TfR mRNA. The expression of HFE mRNA
decreased following stimulation of the cells with GM-CSF, TNF-, or
LPS but was not affected by IL-1. Similarly, IL-1 did not affect the expression of the other iron transport protein mRNAs. GM-CSF also
did not affect the expression of Nramp1 and Nramp2 mRNA but did
decrease the expression of TfR mRNA.
|
Iron increases the expression of Nramp1 but not Nramp2 mRNA.
The addition of iron citrate to peritoneal macrophage cultures resulted
in a decrease in TfR mRNA expression and in a concomitant increase in
Nramp1 mRNA expression (Fig. 5). The
levels of Nramp2 and HFE mRNA remained unchanged by the addition of
iron. The addition of M. avium to the iron-treated cells
resulted in an increase in Nramp2 mRNA expression that is consistent
with the changes we observed following the addition of M. avium alone (data not shown). M. avium infection of
iron-treated cells also resulted in a decrease in TfR and HFE mRNA
expression.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
The results of this investigation indicate that infection of macrophages with the intracellular bacterium M. avium induced the expression of mRNA of both Nramp2 and Nramp1, members of the divalent cation transport family of proteins. At the same time, the synthesis and expression of TfR mRNA decreased. Nramp2 mRNA induction occurred several hours prior to Nramp1 mRNA induction. Infection, as well as activation of macrophages, resulted in a decrease in TfR mRNA expression.
TfRs and HFE become associated in a pre-Golgi compartment and undergo similar posttranslational modification during intracellular transport to the surface (16, 48). They remain associated on the cell surface and are internalized via coated pits (17, 36, 40). HFE forms complexes with TfR in duodenal epithelial cells (17, 49) and thus down regulates the absorption of iron by TfR-transferrin internalization (45). HFE reduces the number of transferrin binding sites on the cell surface by its physical interaction with the TfR (44). The association of TfR with HFE may also prevent the internalization of iron-bound transferrin (45). Recent studies have shown that HFE cocrystalizes with both TfR and Nramp2 (3). This suggests that once the transferrin-TfR complex is internalized, acidification of the endosome results in the release of transferrin-bound iron, which is then transported to the cell cytosol by Nramp2. In contrast, Nramp1, which is expressed exclusively on phagosomes, transports iron into the phagosome (33).
It would appear that the differential regulation of mRNAs of these iron transport proteins by M. avium infection in thioglycolate-elicited peritoneal macrophages may provide the cell with sufficient quantities of iron early in the infection to generate antimicrobial effector molecules, while, later in the infection, limiting available iron for the growth of surviving microorganisms. Thus, the early increase in Nramp2 mRNA expression while TfR mRNA levels are still high suggests that more Nramp2 proteins would be available to transport iron into the cytoplasm. As the infection progresses, the decrease in TfR mRNA expression, together with constant levels of HFE mRNA, suggests that less iron is entering the cells via this transport route. Initially, this occurs because there are fewer receptors to bind to iron containing transferrin. Also, the relative increase in the ratio of HFE to TfR mRNA further suggests that the TfRs that are expressed may be prevented from binding to transferrin by their association with HFE. At this critical juncture in the host-microbe interaction, little transferrin-associated iron is available within the cell to stimulate the growth of the surviving microorganisms. At the same time, however, the host cells finds itself starved of an essential supply of biologically active iron to mediate the generation of free radicals necessary to eliminate the intracellular pathogens. Thus, the late increase in Nramp1 mRNA levels may compensate for the decrease in available iron.
Our observations that both M. avium infection and treatment
of the cells with IFN-, independently and in combination, resulted in a decrease in TfR mRNA expression are similar to observations made
by others regarding TfR expression and mRNA stability in macrophages
(28, 39, 53). Also, treatment of macrophages with IFN-
results in a decrease in TfR expression, which leads to decrease in the
concentration of intracellular iron sufficient to inhibit the growth of
Legionella pneumophila (8). This
inhibition is completely reversed by the addition of iron
(9).
Two alternatively spliced isoforms of Nramp2 mRNA have been identified in humans and in mice (40, 51). This is not apparent in our study because our probe consisted of the mRNA sequence from bp 887 to 1620, which terminated immediately 5' to the alternative splicing site. Nevertheless, our results are similar to those of Wardrop and Richardson (52), who also found that LPS stimulation resulted in an increase in Nramp2 mRNA expression. Both of our observations suggest that Nramp2 mRNA is regulated to maintain the availability of iron in the cell. Since transferrin-mediated iron uptake is lowered, Nramp2 mRNA expression is increased in an attempt to restore the levels of biologically active iron. However, iron does not directly regulate Nramp2 mRNA levels, since both our observations and those of Wardrop and Richardson (52) have found that addition of iron to macrophage cultures does not result in an increase in Nramp2 mRNA expression even though the major isoform of Nramp2 mRNA contains an iron response element in its 3' untranslated region that has been shown to be capable of binding the iron response protein (IRP) (51). We have not, however, been able to identify an iron response element associated with the 3' untranslated region of Nramp1. The expression of Nramp2 but not Nramp1 mRNA was increased following the addition of CHX to the cells. This superinduction indicates that repressor proteins, whose synthesis is inhibited by CHX, may be controlling the level of Nramp2 mRNA.
We did not find that IFN- significantly increased the expression of
Nramp1. This observation is different from that which we have
previously reported for splenic macrophages (6, 7). Others
have also reported that peritoneal cells constitutively express Nramp1
(2, 23). Splenic macrophages do not (6, 7). This difference in the basal level of expression between the
macrophages from anatomically different compartments probably accounts
for the different responses to IFN-.
We have found important differences in the regulation of expression of Nramp1 and Nramp2 mRNA in murine macrophages. While the expression of both is induced following infection with M. avium, the synthesis of Nramp2 mRNA appears to be actively repressed, since the addition of CHX resulted in an increase in mRNA that was not observed for Nramp1. Furthermore, we found that iron increased the expression of Nramp1 mRNA while not affecting the expression of Nramp2 mRNA by macrophages. This observation is similar to that reported by Baker et al. (2) suggesting that Nramp1 might autoregulate its own expression. Studies are in progress to determine how infection with M. avium differentially regulates the expression of these iron transport proteins in macrophages.
| |
ACKNOWLEDGMENTS |
|---|
We thank Tianyi Wang for helpful discussion and technical advice.
This work is supported by grants DK-57667, AI-42901, and HL-59795 from the National Institutes of Health to B.S.Z. and W.P.L.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, The Ohio State University, 484 West 12th Ave., Columbus, OH 43210. Phone: (614) 292-3310. Fax: (614) 292-8120. E-mail: zwilling.1{at}osu.edu.
Editor: W. A. Petri Jr.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Andrews, N. C. 1999. The iron transporter DMT1. Int. J. Biochem. Cell. Biol. 31:991-994[CrossRef][Medline]. |
| 2. | Baker, S. T., C. H. Barton, and T. E. Biggs. 2000. A negative autoregulatory link between Nramp1 function and expression. J. Leukoc. Biol. 67:501-507[Abstract]. |
| 3. | Bennett, M. J., J. A. Lebron, and P. J. Bjorkman. 2000. Crystal structure of the hereditary haemochromatosis protein HFE complexed with transferrin receptor. Nature 403:46-53[CrossRef][Medline]. |
| 4. | Blackwell, J. M., S. Searle, T. Goswami, and E. N. Miller. 2000. Understanding the multiple functions of Nramp1. Microbes Infect. 2:317-321[CrossRef][Medline]. |
| 5. | Brock, J. H., and V. Mulero. 2000. Cellular and molecular aspects of iron and immune function. Proc. Nutr. Soc. 59:537-540[Medline]. |
| 6. | Brown, D. H., W. P. Lafuse, and B. S. Zwilling. 1997. Stabilized expression of mRNA is associated with mycobacterial resistance controlled by Nramp1. Infect. Immun. 65:597-603[Abstract]. |
| 7. | Brown, D. H., W. LaFuse, and B. S. Zwilling. 1995. Cytokine-mediated activation of macrophages from Mycobacterium bovis BCG-resistant and -susceptible mice: differential effects of corticosterone on antimycobacterial activity and expression of the Bcg gene (candidate Nramp). Infect. Immun. 63:2983-2988[Abstract]. |
| 8. | Byrd, T. F., and M. A. Horwitz. 1989. Interferon gamma-activated human monocytes downregulate transferrin receptors and inhibit the intracellular multiplication of Legionella pneumophila by limiting the availability of iron. J. Clin. Investig. 83:1457-1465. |
| 9. | Byrd, T. F., and M. A. Horwitz. 1991. Lactoferrin inhibits or promotes Legionella pneumophila intracellular multiplication in nonactivated and interferon gamma-activated human monocytes depending upon its degree of iron saturation. Iron-lactoferrin and nonphysiologic iron chelates reverse monocyte activation against Legionella pneumophila. J. Clin. Investig. 88:1103-1112. |
| 10. |
Canonne-Hergaux, F.,
S. Gruenheid,
P. Ponka, and P. Gros.
1999.
Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron.
Blood
93:4406-4417 |
| 11. |
Conrad, M. E., and J. N. Umbreit.
2000.
Iron absorption and transport an update.
Am. J. Hematol.
64:287-298[CrossRef][Medline].
|
| 12. | Conrad, M. E., J. N. Umbreit, and E. G. Moore. 1999. Iron absorption and transport. Am. J. Med. Sci. 318:213-229[CrossRef][Medline]. |
| 13. | Domachowske, J. B. 1997. The role of nitric oxide in the regulation of cellular iron metabolism. Biochem. Mol. Med. 60:1-7[CrossRef][Medline]. |
| 14. |
Ehrlich, R., and F. A. Lemonnier.
2000.
HFEa novel nonclassical class I molecule that is involved in iron metabolism.
Immunity
13:585-588[Medline].
|
| 15. | Feder, J. N., A. Gnirke, W. Thomas, Z. Tsuchihashi, D. A. Ruddy, A. Basava, F. Dormishian, R. Domingo, Jr., M. C. Ellis, A. Fullan, L. M. Hinton, N. L. Jones, et al. 1996. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat. Genet. 13:399-408[CrossRef][Medline]. |
| 16. |
Feder, J. N.,
Z. Tsuchihashi,
A. Irrinki,
V. K. Lee,
F. A. Mapa,
E. Morikang,
C. E. Prass,
S. M. Starnes,
R. K. Wolff,
S. Parkkila,
W. S. Sly, and R. C. Schatzman.
1997.
The hemochromatosis founder mutation in HLA-H disrupts beta2-microglobulin interaction and cell surface expression.
J. Biol. Chem.
272:14025-14028 |
| 17. |
Feder, J. N.,
D. M. Penny,
A. Irrinki,
V. K. Lee,
J. A. Lebron,
N. Watson,
E. Sigal,
Z. Tsuchihashi,
P. J. Bjorkman, and R. C. Schatzman.
1998.
The hemochromatosis gene product complexes with the transferrin receptor and lowers its affinity for ligand binding.
Proc. Natl. Acad. Sci USA.
95:1472-1477 |
| 18. | Felitti, V. J., and E. Beutler. 1999. New developments in hereditary hemochromatosis. Am. J. Med. Sci. 318:257-268[CrossRef][Medline]. |
| 19. | Fleet, J. C. 1998. Identification of Nramp2 as an iron transport protein: another piece of the intestinal iron absorption puzzle. Nutr. Rev. 56:88-89[Medline]. |
| 20. | Fleming, M. D., C. C. Trenor, M. A. Su, D. Foernzler, D. R. Beier, W. F. Dietrich, and N. C. Andrews. 1997. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat. Genet. 16:383-386[CrossRef][Medline]. |
| 21. | Gomes, M. S., and R. Appelberg. 1998. Evidence for a link between iron metabolism and Nramp1 gene function in innate resistance against Mycobacterium avium. Immunology 95:165-168[CrossRef][Medline]. |
| 22. | Goswami, T., A. Bhattacharjee, P. Babal, S. Searle, E. Moore, M. Li, and J. M. Blackwell. 2001. Natural-resistance-associated macrophage protein 1 is an H+/bivalent cation antiporter. Biochem. J. 354:511-519[CrossRef][Medline]. |
| 23. | Govoni, G., S. Gauthier, F. Billia, N. N. Iscove, and P. Gros. 1997. Cell-specific and inducible Nramp1 gene expression in mouse macrophages in vitro and in vivo. J. Leukoc. Biol. 62:277-286[Abstract]. |
| 24. | Govoni, G., and P. Gros. 1998. Macrophage NRMAP1 and its role in resistanve to microbial infection. Inflamm. Res. 47:277-284[CrossRef][Medline]. |
| 25. | Gruenheid, S., M. Cellier, S. Vidal, and P. Gros. 1995. Identification and characterization of a second mouse Nramp gene. Genomics 25:514-525[CrossRef][Medline]. |
| 26. |
Gruenheid, S.,
E. Pinner,
M. Desjardins, and P. Gros.
1997.
Natural resistance to infection with intracellular pathogens: the Nramp1 protein is recruited to the membrane of the phagosome.
J. Exp. Med.
185:717-730 |
| 27. | Gunshin, H., B. Mackenzie, U. V. Berger, Y. Gunshin, M. F. Romero, W. F. Boron, S. Nussberger, J. L. Gollan, and M. A. Hediger. 1997. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 388:482-488[CrossRef][Medline]. |
| 28. | Hamilton, T. A., P. W. Gray, and D. O. Adams. 1984. Expression of the transferrin receptor on murine peritoneal macrophages is modulated by in vitro treatment with interferon gamma. Cell. Immunol. 89:478-488[CrossRef][Medline]. |
| 29. |
Hentze, M. W., and L. C. Kuhn.
1996.
Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits operated by iron, nitric oxide, and oxidative stress.
Proc. Natl. Acad. Sci. USA
93:8175-8182 |
| 30. | Horin, P., and J. Matiasovic. 2000. Two polymorphic markers for the horse SLC11A1 (NRAMP1) gene. Anim. Genet. 31:152[CrossRef][Medline]. |
| 31. | Jazwinska, E. C. 1998. Hemochromatosis: a genetic defect in iron metabolism. Bioessays 20:562-568[CrossRef][Medline]. |
| 32. | Jurado, R. L. 1997. Iron, infections, and anemia of inflammation. Clin. Infect. Dis. 25:888-895[Medline]. |
| 33. | Kuhn, D. E., B. D. Baker, W. P. Lafuse, and B. S. Zwilling. 1999. Differential iron transport into phagosomes isolated from the RAW264.7 macrophage cell lines transfected with Nramp1Gly169 or Nramp1Asp169. J. Leukoc. Biol. 66:113-119[Abstract]. |
| 34. |
Kuhn, D. E.,
W. P. Lafuse, and B. S. Zwilling.
2001.
Iron transport into Mycobacterium avium-containing phagosomes from an Nramp1(Gly169)-transfected RAW264.7 macrophage cell line.
J. Leukoc. Biol.
69:43-49 |
| 35. | Kuhn, L. C. 1998. Iron and gene expression: molecular mechanisms regulating cellular iron homeostasis. Nutr. Rev. 56:S11-19, S54-S75. |
| 36. | Lebron, J. A., M. J. Bennett, D. E. Vaughn, A. J. Chirino, P. M. Snow, G. A. Mintier, J. N. Feder, and P. J. Bjorkman. 1998. Crystal structure of the hemochromatosis protein HFE and characterization of its interaction with transferrin receptor. Cell 93:111-123[CrossRef][Medline]. |
| 37. | Lee, P. L., T. Gelbart, C. West, C. Halloran, and E. Beutler. 1998. The human Nramp2 gene: characterization of the gene structure, alternative splicing, promoter region and polymorphisms. Blood Cells Mol. Dis. 24:199-215[CrossRef][Medline]. |
| 38. | Miller, R. A., and B. E. Britigan. 1997. Role of oxidants in microbial pathophysiology. Clin. Microbiol. Rev. 10:1-18[Abstract]. |
| 39. |
Pantopoulos, K., and M. W. Hentze.
1995.
Nitric oxide signaling to iron-regulatory protein: direct control of ferritin mRNA translation and transferrin receptor mRNA stability in transfected fibroblasts.
Proc. Natl. Acad. Sci. USA
92:1267-1271 |
| 40. |
Parkkila, S.,
A. Waheed,
R. S. Britton,
B. R. Bacon,
X. Y. Zhou,
S. Tomatsu,
R. E. Fleming, and W. S. Sly.
1997.
Association of the transferrin receptor in human placenta with HFE, the protein defective in hereditary hemochromatosis.
Proc. Natl. Acad. Sci. USA
94:13198-13202 |
| 41. |
Parkkila, S.,
A. K. Parkkila,
A. Waheed,
R. S. Britton,
X. Y. Zhou,
R. E. Fleming,
S. Tomatsu,
B. R. Bacon, and W. S. Sly.
2000.
Cell surface expression of HFE protein in epithelial cells, macrophages, and monocytes.
Haematologica
85:340-345 |
| 42. | Ratledge, C., and L. G. Dover. 2000. Iron metabolism in pathogenic bacteria. Annu. Rev. Microbiol. 54:881-941[CrossRef][Medline]. |
| 43. | Ryan, L. K., D. T. Golenbock, J. Wu, and M. W. Vermeulen. 1997. Characterization of proinflammatory cytokine production and CD14 expression by murine alveolar macrophage cell lines. In Vitro Cell Dev. Biol. Anim. 33:647-653[Medline]. |
| 44. |
Salter-Cid, L.,
A. Brunmark,
Y. Li,
D. Leturcq,
P. A. Peterson,
M. R. Jackson, and Y. Yang.
1999.
Transferrin receptor is negatively modulated by the hemochromatosis protein HFE: implications for cellular iron homeostasis.
Proc. Natl. Acad. Sci. USA
96:5434-5439 |
| 45. | Salter-Cid, L., A. Brunmark, P. A. Peterson, and Y. Yang. 2000. The major histocompatibility complex-encoded class I-like HFE abrogates endocytosis of transferrin receptor by inducing receptor phosphorylation. Genes Immun. 1:409-417[CrossRef][Medline]. |
| 46. | Searle, S., N. A. Bright, T. I. Roach, P. G. Atkinson, C. H. Barton, R. H. Meloen, and J. M. Blackwell. 1998. Localization of Nramp1 in macrophages: modulation with activation and infection. J. Cell Sci. 111:2855-2866[Abstract]. |
| 47. | Sunder-Plassmann, G., S. I. Patruta, and W. H. Horl. 1999. Pathobiology of the role of iron in infection. Am. J. Kidney Dis. 34(Suppl. 2):S25-S29[Medline]. |
| 48. |
Waheed, A.,
S. Parkkila,
X. Y. Zhou,
S. Tomatsu,
Z. Tsuchihashi,
J. N. Feder,
R. C. Schatzman,
R. S. Britton,
B. R. Bacon, and W. S. Sly.
1997.
Hereditary emochromatosis: effects of C282Y and H63D mutations on association with beta2-microglobulin, intracellular processing, and cell surface expression of the HFE protein in COS-7 cells.
Proc. Natl. Acad. Sci. USA
94:12384-12389 |
| 49. |
Waheed, A.,
S. Parkkila,
J. Saarnio,
R. E. Fleming,
X. Y. Zhou,
S. Tomatsu,
R. S. Britton,
B. R. Bacon, and W. S. Sly.
1999.
Association of HFE protein with transferrin receptor in crypt enterocytes of human duodenum.
Proc. Natl. Acad. Sci. USA
96:1579-1584 |
| 50. |
Wang, T.,
W. P. Lafuse, and B. S. Zwilling.
2000.
Regulation of toll-like receptor 2 expression by macrophages following Mycobacterium avium infection.
J. Immunol.
165:6308-6313 |
| 51. | Wardrop, S. L., and D. R. Richardson. 1999. The effect of intracellular iron concentration and nitrogen monoxide on Nramp2 expression and non-transferrin-bound iron uptake. Eur. J. Biochem. 263:41-49[Medline]. |
| 52. | Wardrop, S. L., and D. R. Richardson. 2000. Interferon-gamma and lipopolysaccharide regulate the expression of Nramp2 and increase the uptake of iron from low relative molecular mass complexes by macrophages. Eur. J. Biochem. 267:6586-6593[Medline]. |
| 53. | Weiel, J. E., D. O. Adams, and T. A. Hamilton. 1985. Biochemical models of gamma-interferon action: altered expression of transferrin receptors on murine peritoneal macrophages after treatment in vitro with PMA or A23187. J. Immunol. 134:293-298[Abstract]. |
| 54. | Weinberg, E. D. 1998. Patho-ecological implications of microbial acquisition of host iron. Rev. Med. Microbiol. 9:171-178. |
| 55. | Weinberg, E. D. 1999. The role of iron in protozoan and fungal infectious diseases. J. Eukaryot. Microbiol. 46:231-238[Medline]. |
| 56. | Weinberg, E. D. 1999. Iron loading and disease surveillance. Emerg. Infect. Dis. 5:346-352[Medline]. |
| 57. | Weinberg, E. D. 2000. Modulation of intramacrophage iron metabolism during microbial cell invasion. Microbes. Infect. 2:85-89[CrossRef][Medline]. |
| 58. | Wessling-Resnick, M. 1999. Biochemistry of iron uptake. Crit. Rev. Biochem. Mol. Biol. 34:285-314[CrossRef][Medline]. |
| 59. |
Wood, R. J., and O. Han.
1998.
Recently identified molecular aspects of intestinal iron absorption.
J. Nutr.
128:1841-1844 |
| 60. |
Zwilling, B. S.,
D. E. Kuhn,
L. Wikoff,
D. Brown, and W. Lafuse.
1999.
Role of iron in Nramp1-mediated inhibition of mycobacterial growth.
Infect. Immun.
67:1386-1392 |
Infection and Immunity, November 2001, p. 6618-6624, Vol. 69, No. 11
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.11.6618-6624.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Van Zandt, K. E., Sow, F. B., Florence, W. C., Zwilling, B. S., Satoskar, A. R., Schlesinger, L. S., Lafuse, W. P.
(2008). The iron export protein ferroportin 1 is differentially expressed in mouse macrophage populations and is present in the mycobacterial-containing phagosome. J. Leukoc. Biol.
84: 689-700
[Abstract] [Full Text] -
Sow, F. B., Florence, W. C., Satoskar, A. R., Schlesinger, L. S., Zwilling, B. S., Lafuse, W. P.
(2007). Expression and localization of hepcidin in macrophages: a role in host defense against tuberculosis. J. Leukoc. Biol.
82: 934-945
[Abstract] [Full Text] -
Olakanmi, O., Schlesinger, L. S., Britigan, B. E.
(2007). Hereditary hemochromatosis results in decreased iron acquisition and growth by Mycobacterium tuberculosis within human macrophages. J. Leukoc. Biol.
81: 195-204
[Abstract] [Full Text] -
Appelberg, R.
(2006). Macrophage nutriprive antimicrobial mechanisms. J. Leukoc. Biol.
79: 1117-1128
[Abstract] [Full Text] -
Wagner, D., Maser, J., Lai, B., Cai, Z., Barry, C. E. III, Honer zu Bentrup, K., Russell, D. G., Bermudez, L. E.
(2005). Elemental Analysis of Mycobacterium avium-, Mycobacterium tuberculosis-, and Mycobacterium smegmatis-Containing Phagosomes Indicates Pathogen-Induced Microenvironments within the Host Cell's Endosomal System. J. Immunol.
174: 1491-1500
[Abstract] [Full Text] -
Wagner, D., Maser, J., Moric, I., Boechat, N., Vogt, S., Gicquel, B., Lai, B., Reyrat, J.-M., Bermudez, L.
(2005). Changes of the phagosomal elemental concentrations by Mycobacterium tuberculosis Mramp. Microbiology
151: 323-332
[Abstract] [Full Text] -
Olakanmi, O., Schlesinger, L. S., Ahmed, A., Britigan, B. E.
(2004). The Nature of Extracellular Iron Influences Iron Acquisition by Mycobacterium tuberculosis Residing within Human Macrophages. Infect. Immun.
72: 2022-2028
[Abstract] [Full Text] -
Prendergast, B. J., Hotchkiss, A. K., Bilbo, S. D., Kinsey, S. G., Nelson, R. J.
(2003). Photoperiodic Adjustments in Immune Function Protect Siberian Hamsters from Lethal Endotoxemia. J Biol Rhythms
18: 51-62
[Abstract] -
Olakanmi, O., Schlesinger, L. S., Ahmed, A., Britigan, B. E.
(2002). Intraphagosomal Mycobacterium tuberculosis Acquires Iron from Both Extracellular Transferrin and Intracellular Iron Pools. IMPACT OF INTERFERON-gamma AND HEMOCHROMATOSIS. J. Biol. Chem.
277: 49727-49734
[Abstract] [Full Text] -
Olakanmi, O., Rasmussen, G. T., Lewis, T. S., Stokes, J. B., Kemp, J. D., Britigan, B. E.
(2002). Multivalent Metal-Induced Iron Acquisition from Transferrin and Lactoferrin by Myeloid Cells. J. Immunol.
169: 2076-2084
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»