Previous Article | Next Article 
Infection and Immunity, November 2001, p. 6676-6682, Vol. 69, No. 11
Department of Respiratory Medicine, National
Heart and Lung Institute,1 and
Departments of Pathology3 and
Infectious Diseases and Microbiology,2
Imperial College School of Medicine, London, United Kingdom
Received 2 April 2001/Returned for modification 24 May
2001/Accepted 26 July 2001
With a view to exploring the role of transforming growth factor Although bacillus
Calmette-Guérin (BCG) vaccination confers clear benefit against
disseminated forms of tuberculosis in children (15), its
efficacy against the predominant adult pulmonary disease has varied
widely in clinical trials (4). Recent progress in mycobacterial genetics (5) and an improved understanding
of the immunological mechanisms required for protection
(1) provide an opportunity to develop recombinant vaccines
designed to promote an enhanced immune response.
Cytokine-secreting recombinant BCG (rBCG) vaccines have been
shown to enhance the host immune responses to mycobacterial antigens (11, 12). To date, work has focused on the expression of
proinflammatory cytokines, such as interleukin 2 and gamma interferon
(IFN- TGF- TGF- In this study, we tested the hypothesis that the expression of LAP by
rBCG would result in a reduction in TGF- Construction of BCG strains expressing LAP.
Murine cDNA for
LAP was cloned from pSVTGF
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.11.6676-6682.2001
Enhanced Antimycobacterial Response to Recombinant
Mycobacterium bovis BCG Expressing
Latency-Associated Peptide
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
(TGF-) during mycobacterial infection, recombinant clones of
bacillus Calmette-Guérin (BCG) were engineered to express the
natural antagonist of TGF-, latency-activated peptide (LAP). Induction of TGF- activity was reduced when macrophages were infected with BCG expressing the LAP construct (LAP-BCG). There was a
significant reduction in the growth of LAP-BCG in comparison to that of
control BCG following intravenous infection in a mouse model. The
enhanced control of mycobacterial replication was associated with an
increase in the production of gamma interferon by splenocytes challenged during the acute stage of infection but with a diminished recall response assessed after 13 weeks. Organ weight and
hydroxyproline content, representing tissue pathology, were also lower
in mice infected with LAP-BCG. The results are consistent with the
hypothesis that TGF- has a detrimental effect on mycobacterial
immunity. While a reduction in TGF- activity augments the initial
response to BCG vaccination, early bacterial clearance may adversely
affect the induction of a long-term memory response by LAP-BCG.
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
). A complementary approach is to evaluate rBCG expressing
antagonists to endogenous immunosuppressive cytokines, such as
transforming growth factor (TGF-). This approach has the added
attraction of reducing the profibrotic contribution of TGF- and thus
potentially reducing BCG-associated scarring.
1 is a product of activated macrophages and other inflammatory
cells (26). It is one of five isoforms of a
multifunctional cytokine which is produced in response to tissue injury
and which exhibits a wide array of immunomodulatory and biological
activities (25). TGF- is a potent endogenous
immunosuppressive agent, deactivating macrophages and modulating T-cell
function (24). In addition, TGF- promotes tissue
fibrosis in human and rodent diseases by enhancing the synthesis of
extracellular matrix components (14, 16). TGF- is
produced early in the delayed-type hypersensitivity reaction to the
mycobacterial protein extract purified protein derivative (PPD)
(21, 27) and in tuberculous granulomas (22). It has also been implicated in the regulation of the immune response against Mycobacterium avium (2).
is produced in an inactive form noncovalently bound to its
natural antagonist, latency-associated peptide (LAP). The cDNA
sequences of a number of mammalian LAP genes have been established and
shown to exhibit extensive homology (6, 18). When LAP is
expressed independently in tissue culture cells, it acts as a
functional binding protein for mature TGF-1 (as well as related family members), masking its biological activity (8).
Recombinant LAP is a potent inhibitor of the effects of TGF- on the
replication of Mycobacterium tuberculosis in
monocytes in vitro (9), and continuous infusion of
recombinant LAP has been shown to reduce the growth of BCG in a murine
infection model (29).
activity, augmenting the
protective immune response of the host and reducing local inflammatory
side effects of BCG vaccination.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
1 (provided by Hal Moses, Vanderbilt
University School of Medicine, Nashville, Tenn., and described
elsewhere [23]) into plasmids pRBD3a and pRBD4a
(11, 12). These expression vectors contain a kanamycin resistance marker and origins of replication suitable for maintenance in mycobacteria and in Escherichia coli.
Transcription is under the control of the mycobacterial
hsp60 promoter, and the insert gene is fused to the
signal sequence derived from the gene encoding the BCG alpha antigen,
targeting the expressed protein for secretion through the mycobacterial
cell membrane and wall. LAP cDNA was modified by PCR to replace the
endogenous signal sequence-encoding DNA using the following primers:
LAP-R-R1, CGGAATTCCTATCTCCGGTGCCGTGAGCTG; and LAP-F BAM, CGCGGATCCGGGAGGCCAGCCGCGGGAC.
THP-1 infection model.
Cells (5 × 106) from the THP-1 human macrophage cell line
were suspended in 50 ml of RPMI 1640 medium (supplemented with
glutamine but without antibiotics) in a 225-ml tissue culture flask
(Nunc). After 4 and 7 days, cells were removed from the flask,
centrifuged, and resuspended at a density of 5 × 105/ml in a 24-well plate (Nunc). Cells
were activated with phorbol myristate acetate (5 ng/ml) and IFN- (10 ng/ml) for 72 h. Before infection with BCG or BCG expressing the
LAP construct (LAP-BCG), the medium was removed from the now adherent
THP-1 cells, which were then washed once with phosphate-buffered saline
(PBS) and infected for different periods of time as described in
Results. Cell-free culture supernatants were harvested and stored at
70°C for measurement of TGF- bioactivity.
Murine infection model. Female C57BL6/J mice were purchased from Harlan OLAC (Bicester, United Kingdom) and raised under specific-pathogen-free conditions. The mice were maintained for at least 1 week and used for experiments at 6 to 8 weeks of age. On the day of injection, stored BCG or LAP-BCG samples were thawed and diluted in sterile PBS to a density of 107 CFU/ml. Cultures were thoroughly dispersed by repeated gentle passage through a 27-gauge needle. BCG strains in a total volume of 200 µl were injected into a lateral tail vein (five mice per group). Control mice were injected with the same volume of sterile PBS alone. Mice were weighed and killed by cervical dislocation on two different days postinfection. The spleen, liver, and lungs were removed and weighed, and histopathological changes were monitored by use of formalin-fixed and paraffin-embedded sections stained with Ziehl-Neelsen (Z-N) and hematoxylin-eosin stains. Hydroxyproline content was determined by the methods described by Stegemann and Stadler (20) and Wangoo et al. (28). Hydroxyproline content was expressed as content per total lung or liver.
To monitor mycobacterial growth, weighed pieces of each organ were homogenized and plated in serial dilutions on Middlebrook 7H11 medium supplemented with oleic acid-albumin-dextrose-catalase (Difco), amphotericin (10 µg/ml) (Squibb), and kanamycin (50 µg/ml). Colonies were counted after 3 weeks. To monitor the in vitro response to mycobacterial antigens, spleens were removed aseptically from naive and BCG-infected mice, teased through a cell strainer (Falcon; Becton-Dickinson), and washed three times with Hanks' balanced salt solution. Splenocytes from each group were pooled and resuspended at a concentration of 106 cells/ml in supplemented RPMI 1640 medium as previously described (19). Splenocytes were stimulated with mycobacterial PPD (Evans) at a concentration of 10 µg/ml. Supernatants were harvested at 72 h and stored at70°C.
Cytokine assays.
TGF- bioactivity was measured using the
Mv1Lu mink epithelial cell line (ATCC CCL-64). Cells grown to
confluence were detached using trypsin-EDTA, washed with Iscove's
modified Dulbecco medium (Sigma) containing 2% fetal calf serum,
resuspended in the same medium, and dispersed in 96-well plates at a
density of 3 × 104 cells/well. After 12 to
18 h, serial twofold dilutions of TGF- standard (R&D Systems)
or test sample were added to triplicate wells, and incubation was
continued for a further 24 h. On day 3, cells were pulsed with
3H-thymidine (1 µCi/well; Amersham Life
Science), and the plates were incubated for a further 4 to 6 h.
Cells were then washed, incubated with trypsin-EDTA, and harvested
using a Filtermate cell harvester (Packard). Radioactivity was measured
using a Top Count microplate scintillation counter (Packard). TGF-
activity was interpolated from a standard curve generated over a
concentration range of 0.005 to 2 ng/ml.
concentration in supernatants was measured by a sandwich
enzyme-linked immunosorbent assay (ELISA) technique using paired
antibodies from Pharmingen, San Diego, Calif.
Statistical analysis. Data were analyzed using the Student t test. Statistical significance was taken as a P value of <0.05.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Construction of rBCG expressing LAP.
cDNA encoding murine LAP
was cloned in shuttle vectors pRBD3a and pRBD4a as a translational
fusion to the signal sequence from BCG alpha antigen, downstream of the
mycobacterial hsp60 promoter. The two constructs differed by
the presence of a hemagglutinin (HA) epitope tag in pRBD4a. These
vectors have previously been used to generate rBCG strains expressing a
range of biologically active mammalian cytokines (11, 12).
The LAP constructs and appropriate control vectors were introduced into
M. bovis BCG (Pasteur) by electroporation, and
kanamycin-resistant colonies were characterized by Western blot
analysis (Fig. 1). A single band reactive
with antiserum to human LAP was observed in sonicated preparations of
clones transformed with the pRBD3a and pRBD4a LAP constructs (3a/LAP
and 4a/LAP, respectively); there was no antibody reactivity to
corresponding extracts prepared from control BCG transformed with
vector alone. In spite of the fact that both constructs included a
signal peptide shown previously to promote the secretion of proteins
expressed in recombinant mycobacteria (11, 12), we were
unable to detect immunologically active LAP in filtrates prepared from
cultures of either of the positive clones. Recombinant LAP may have
structural features that preclude its secretion from BCG.
Alternatively, secreted LAP may be subject to degradation and its
steady-state concentration may be reduced below the level detectable in
the immunoassay.
|
Characterization of LAP-BCG constructs in tissue culture
models.
To test for the presence of biologically active LAP,
culture filtrates from the recombinant BCG transformed with two LAP
constructs 3a/LAP and 4a/LAP (3a/LAP-BCG and 4a/LAP-BCG,
respetively) were tested for their ability to inhibit the
activity of recombinant TGF- in a bioassay using the Mv1Lu mink lung
epithelial cell line. Again, we were unable to detect LAP activity in
the filtrate preparations. Evidence of the biological activity of
recombinant LAP was obtained, however, when LAP-BCG constructs were
used to infect the THP-1 human macrophage cell line. Cells were
infected with live rBCG at a multiplicity of infection of 10, 1, or 0.1 CFU per cell, and TGF- activity in culture supernatants was measured using the Mv1Lu bioassay. The highest TGF- activity was observed at
the highest multiplicity of infection, but at each dose, cytokine activity in 16-h supernatants was significantly lower in cultures infected with LAP-BCG constructs than in cultures infected with the
pRBD3a vector control strain (Fig. 2).
The pattern of lower TGF- activity was also observed in supernatants
prepared 40 h after infection (data not shown). These results
suggest that, although undetectable in filtrate preparations from
bacterial cultures, LAP expressed by rBCG strains has a suppressive
effect on the expression of biologically active TGF- by infected
THP-1 cells.
|
Growth of LAP-BCG constructs in a murine infection model.
Infection of mice with BCG results in a self-limiting infection
characterized by an initial acute phase of bacterial replication and
subsequent control by acquired cell-mediated immunity. To test the
effect of recombinant LAP expression on the growth of BCG in this
model, C57BL/6 mice were infected by intravenous injection of 2 × 106 CFU of 3a/LAP-BCG, 4a/LAP-BCG, or control BCG
transformed with the pRBD3a vector (pRBD3a-BGG). Mice were sacrificed
on days 13 and 20 after infection, and the bacterial loads in the
lungs, liver, and spleen were assessed (Fig.
3). The highest counts were found in the
liver, with 3.2 × 107 CFU of
pRBD3a-BCG at day 13, falling to 4.1 × 106 CFU by day 20. Similarly, in the lungs, a
high bacterial load at day 13 (3.0 × 106)
had declined 10-fold by day 20 (2.7 × 105).
Counts in the spleen rose slightly from 3.9 × 106 on day 13 to 5.9 × 106 on day 20. In each organ, at both time
points, the bacterial load was significantly lower in mice infected
with the LAP-BCG constructs. This finding was particularly marked with
4a/LAP-BCG, with mean organ counts consistently being 1 to 2 log units
lower than those observed with the pBRD3a-BCG control. At day 104, CFU were only just detectable in organs of the 3a/LAP- and 4a/LAP-infected mice (total spleen counts, 6 ± 3.8 CFU for 3a/LAP-BCG and
0.3 ± 0.6 CFU for 4a/LAP-BCG) compared to BCG-infected control
mice (total spleen counts, 114 ± 35 CFU). Furthermore, plating of
samples of homogenized organs in the presence or absence of kanamycin confirmed that a higher percentage was drug sensitive, suggesting either instability of the plasmid within mycobacteria or even positive
selection from nonexpressing clones. The same pattern was
observed in two independent experiments.
|
Immunogenicity of LAP-BCG constructs.
The restricted growth of
the LAP-BCG constructs in the mouse model could have been caused by a
direct detrimental effect of LAP expression on bacterial replication in
murine tissues. Alternatively, LAP-mediated inhibition of TGF-
function could have resulted in an enhanced immune response and
consequent restriction of infection. To evaluate the latter
possibility, 13-day splenocytes from the different groups were compared
with respect to PPD-induced expression of IFN- (Fig.
4). The IFN- response was
significantly higher in splenocytes from mice infected with the LAP-BCG
constructs than in those receiving the pRBD3a-BCG control; the highest
level of IFN- production was found in mice infected with 4a/LAP-BCG, the construct associated with the lowest bacterial load. A similar pattern of responses was observed in two separate experiments. The
reciprocal relationship between bacterial load and IFN- response is
consistent with the proposal that the expression of recombinant LAP is
associated with enhanced immunogenicity. PPD-induced expression of
IFN- was also measured in a group of mice 104 days after infection. In contrast to the results obtained at the early time point, the highest response was found in mice receiving control BCG (Fig. 4). A
possible explanation for this result is that the rapid clearance of the
LAP-BCG constructs has a detrimental effect on the establishment of a
long-term memory response.
|
Pathogenicity of LAP-BCG constructs.
In light of the important
role of TGF- in fibrotic reactions, it was of interest to compare
pathological manifestations in mice infected with LAP-BCG and control
BCG. At day 13 after infection, mean organ indices (organ weight
expressed as a percentage of total body weight) were significantly
lower for the liver and lungs of mice infected with 3a/LAP-BCG or
4a/LAP-BCG than in those receiving pRBD3a-BCG (Fig.
5). Increasing organ indices in the LAP-BCG-infected mice over the next week of infection resulted in a
marked reduction in this difference by day 20. Similarly, hydroxyproline content
a marker of new collagen formationwas lower
in the lungs and liver of mice infected with LAP-BCG at day 13; there
was no significant difference by day 20.
|
predominantly mononuclear cells, with occasional neutrophils.
Some of the inflammatory foci had the appearance of early granuloma
formation. Multiple acid-fast bacilli were visible within these
inflammatory foci on Z-N staining. In the lungs, the inflammation
was again marked, with interstitial changes and intravascular
marginating cells, predominantly migrating macrophages. There
were no obvious differences among the three BCG-infected groups. At day
20 after infection, the inflammatory changes in the liver were
more intense; at this stage, the inflammation was granulomatous,
comprising central epithelioid cells with a cuff of lymphocytes. The
lung inflammation was also marked and predominantly interstitial. There
were no convincing differences among the three groups for both organs
examined, although there might have been a tendency for the granulomas
to be better formed in LAP-BCG-infected mice. It was not possible to
quantify this finding. Again, Z-N staining revealed multiple acid-fast
bacilli at the centers of the granulomas in all three groups. Naive
mice exhibited normal histologic findings.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
The pRBD shuttle vector system has been successfully exploited to
express a range of mammalian cytokines in BCG (10-12),
and the present study extends this repertoire to include LAP, a natural cytokine antagonist. rBCG strains provide important tools for analysis
of the contributions of individual cytokines to protective and
pathological immune responses during mycobacterial infection and may
also have a role as improved prophylactic or therapeutic vaccines.
LAP-BCG constructs were characterized by reduced expression of
functionally active TGF- following infection of macrophage cultures
in vitro and by an enhanced immune response during murine infection.
The mechanism by which recombinant LAP exerts an immunomodulatory effect remains to be clarified. Neutralization of TGF- released from
stimulated cells by LAP secreted by BCG prior to phagocytosis represents the simplest hypothesis but, in light of our inability to
detect LAP in culture filtrates, the possible contribution of LAP
released by lysis of intracellular mycobacteria cannot be ruled out.
The native LAP molecule is a disulfide-linked homodimer modified by
glycosylation. Previous studies with bacterially expressed LAP have
demonstrated that glycosylation is not required for functional activity
(30). Dimerization is essential, however, and the
requirement for disulfide bond formation may impose an important
limitation in the secretion of active LAP by rBCG (17).
Murray et al. have previously reported an inverse relationship
between the number of disulfide bonds and the amount of
detectable cytokine in mycobacterial supernatants (11).
Wilkinson et al. recently reported a reduction of approximately 50% in
the growth of BCG following aerosol infection in the lungs of mice
treated with exogenous LAP delivered by an implanted osmotic pump
(29). We observed an analogous reduction in bacterial load
during infection with LAP-expressing rBCG. The more marked difference
in bacterial growth in the latter model (1 to 2 log units) may
reflect a greater potency of local delivery of LAP; alternatively, it
may reflect a more pronounced effect of TGF- modulation on the
systemic growth of mycobacteria following intravenous infection. There
was a difference between the two LAP-BCG constructs in terms of their
ability to multiply in mycobacteria, with the 4a/LAP-BCG construct
being more easily controlled in mice than the 3a/LAP-BCG construct. We
postulate that this result may have been due to the presence of the HA
tag in the 4a/LAP construct affecting the stability, expression, or
possibly the biological activity of recombinant LAP in these
constructs. Further work is required to elucidate the exact mechanism.
The reduced growth of LAP-BCG was associated with an enhanced immune
response in the early phase of infection, as evidenced by increased
mycobacterium-specific IFN- production by splenocytes. Again, this
effect parallels results obtained by systemic delivery of recombinant
LAP (29). The enhanced IFN- response is consistent with
the anticipated inhibition of the immunosuppressive effect of TGF-.
In addition to its role in the suppression of macrophage activation,
TGF- has an important profibrotic function (3).
Fibrosis may have some beneficial effect in sealing off tuberculous
lesions but may also seed the potential for cavitation and subsequent reactivation (13). During BCG vaccination, fibrosis has an
obvious detrimental effect in the promotion of scarring
(7). Comparison of LAP-BCG with control BCG demonstrated a
reduction in the pathological manifestations of infection, as assessed
by organ weight and by hydroxyproline content at early time points. Two
possible explanations can be proposed to account for these
observations. First, increased local concentrations of LAP may directly
inhibit the fibrotic function of TGF-. Alternatively, the slower
evolution of pathological manifestations may be an indirect consequence
of the reduced bacterial load resulting from enhanced immunogenicity.
We were unable to distinguish between these two possibilities in the
present experimental model. Analysis of the longer-term effects of
infection with equivalent LAP-expressing strains of M. tuberculosis would be of interest in this regard.
Overall, the results of these experiments indicate that a reduction of
TGF- activity has a beneficial effect on immunity to mycobacterial
infection. While this notion suggests a potential role for
LAP-expressing rBCG as an improved vaccine, preliminary experiments to
test the longer-term effects of LAP-BCG vaccination highlight an
important caveat. Although the immune response to LAP-BCG was
significantly enhanced during the acute phase of infection, the recall
response was substantially lower than that obtained with control BCG
when tested after several months. A likely explanation for this
observation is that initial mycobacterial replication has an important
influence on BCG vaccination and that reduced replication of LAP-BCG
results in suboptimal immunization. The association of an enhanced
early response to vaccination with a reduced memory response may have
general relevance in relation to the development of improved live
vaccines for tuberculosis.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by the British Medical Association (support given to B.G.M.) and by project grants (to A.W., R.J.S., and D.B.Y.) and a program grant (to D.B.Y.) from the Wellcome Trust.
We thank Peter Murray for the generous gift of the plasmid DNA from which the LAP-BCG clones were derived and Rod Shipley for technical support.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Respiratory Medicine, Southampton University Hospitals NHS Trust, Southampton, Hampshire, United Kingdom. Phone: 44 2380 796228. Fax: 44 2380 794585. E-mail:ben.marshall{at}suht.swest.nhs.uk.
Editor: J. D. Clements
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Barnes, P. F., and B. Wizel.
2000.
Type 1 cytokines and the pathogenesis of tuberculosis.
Am. J. Respir. Crit. Care Med.
161:1773-1774 |
| 2. |
Bermudez, L. E.
1993.
Production of transforming growth factor- by Mycobacterium avium-infected human macrophages is associated with unresponsiveness to IFN-.
J. Immunol.
150:1838-1845[Abstract].
|
| 3. |
Brocklemann, T. J.,
A. H. Limper,
T. V. Colby, and J. A. McDonald.
1991.
Transforming growth factor beta 1 is present at sites of extracellular matrix gene expression in human pulmonary fibrosis.
Proc. Natl. Acad. Sci. USA
88:6642-6646 |
| 4. |
Colditz, G. A.,
T. F. Brewer,
C. S. Berkey,
M. E. Wilson,
E. Burdick,
H. V. Fineberg, and F. Mosteller.
1994.
Efficacy of BCG vaccine in the prevention of tuberculosis. Meta-analysis of the published literature.
JAMA
271:698-702 |
| 5. | Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry, I. I. I., and F. Tekaia. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393:537-544[CrossRef][Medline]. |
| 6. |
Derynck, R.,
J. A. Jarrett,
E. Y. Chen, and D. V. Goeddel.
1986.
The murine transforming growth factor- precursor.
J. Biol. Chem.
261:4377-4379 |
| 7. | Fang, J. W. S., B. M. L. Ko, and J. A. Wilson. 1993. BCG vaccination scars: incidence and acceptance amongst British high-school children. Child Care Health Dev. 19:37-43[CrossRef][Medline]. |
| 8. |
Gentry, L. E., and B. W. Nash.
1990.
The pro domain of pre-pro-transforming growth factor 1 when independently expressed is a functional binding protein for the mature growth factor.
Biochemistry
29:6851-6857[CrossRef][Medline].
|
| 9. |
Hirsch, C.,
S. Ellner,
J. J. Blinkhorn, R., and Z. Toossi.
1997.
In vitro restoration of T cell responses in tuberculosis and augmentation of monocyte effector function against Mycobacterium tuberculosis by natural inhibitors of transforming growth factor beta.
Proc. Natl. Acad. Sci. USA
94:3926-3931 |
| 10. | Kong, D., and D. Y. Kunimoto. 1995. Secretion of human interleukin-2 by recombinant Mycobacterium bovis BCG. Infect. Immun. 63:799-803[Abstract]. |
| 11. |
Murray, P. J.,
A. Aldovini, and R. A. Young.
1996.
Manipulation and potentiation of antimycobacterial immunity using recombinant bacille Calmette-Guerin strains that secrete cytokines.
Proc. Natl. Acad. Sci. USA
93:934-939 |
| 12. |
O'Donnell, M. A.,
A. Aldovini,
R. B. Duda,
H. Yang,
A. Szilvasi,
R. A. Young, and W. C. DeWolf.
1994.
Recombinant Mycobacterium bovis BCG secreting functional interleukin-2 enhances gamma interferon production by splenocytes.
Infect. Immun.
62:2508-2514 |
| 13. | Orme, I. 1998. The immunopathogenesis of tuberculosis: a new working hypothesis. Trends Microbiol. 6:94-97[CrossRef][Medline]. |
| 14. |
Roberts, A. B.,
M. B. Sporn,
R. K. Assoian,
J. M. Smith,
N. S. Roche, and L. M. Wakefield.
1986.
Transforming growth factor type : rapid induction of fibrosis and angiogenesis in vivo and stimulation of collagen formation in vitro.
Proc. Natl. Acad. Sci. USA
83:4167-4171 |
| 15. |
Rodrigues, L. C.,
V. K. Diwan, and J. G. Wheeler.
1993.
Protective efficacy of BCG against tuberculous meningitis and miliary tuberculosis: meta-analysis.
Int. J. Epidemiol.
22:1154-1158 |
| 16. |
Sanderson, N,
V. Factor,
P. Nagy,
J. Kopp,
P. Kandaiah,
L. Wakefield,
A. B. Roberts,
M. B. Sporn, and S. S. Thorgeirsson.
1995.
Hepatic expression of mature transforming growth factor 1 in transgenic mice results in multiple tissue lesions.
Proc. Natl. Acad. Sci. USA
92:2572-2576 |
| 17. |
Sha, X.,
L. Yang, and L. E. Gentry.
1991.
Identification and analysis of discrete functional domains in the pro region of pre-pro-transforming growth factor beta 1.
J. Cell Biol.
114:827-839 |
| 18. |
Sharples, K.,
G. D. Plowman,
T. M. Rose,
D. R. Twardzik, and A. F. Purchio.
1987.
Cloning and sequence analysis of simian transforming growth factor- cDNA.
DNA
6:239-244[Medline].
|
| 19. |
Snewin, V. A.,
M. P. Gares,
Z. Hasan,
I. N. Brown, and D. B. Young.
1999.
Assessment of immunity to mycobacterial infection with luciferase reporter constructs.
Infect. Immun.
67:4586-4593 |
| 20. | Stegemann, H., and K. Stadler. 1967. Determination of hydroxyproline. Clin. Chim. Acta 18:267-273[CrossRef][Medline]. |
| 21. |
Toossi, Z.,
T. G. Young,
L. E. Averill,
B. D. Hamilton,
H. Shiratsuchi, and J. J. Ellner.
1995.
Induction of transforming growth factor 1 by purified protein derivative of Mycobacterium tuberculosis.
Infect. Immun.
63:224-228[Abstract].
|
| 22. |
Toossi, Z.,
P. Gogate,
H. Shiratsuchi,
T. Young, and J. J. Ellner.
1995.
Enhanced production of TGF- by blood monocytes from patients with active tuberculosis and presence of TGF- in tuberculous granulomatous lung lesions.
J. Immunol.
154:465-473[Abstract].
|
| 23. |
Torre-Amione, G.,
R. D. Beauchamp,
H. Koeppen,
B. H. Park,
H. Schreiber,
H. L. Moses, and D. A. Rowley.
1990.
A highly immunogenic tumor transfected wth a murine transforming growth factor type 1 cDNA escapes immune surveillance.
Proc. Natl. Acad. Sci. USA
87:1486-1490 |
| 24. |
Tsunawaki, S.,
M. Sporn,
A. Ding, and C. Nathan.
1988.
Deactivation of macrophages by transforming growth factor .
Nature
334:260-262[CrossRef][Medline].
|
| 25. |
Wahl, S.,
D. A. Hunt,
L. M. Wakefield,
N. McCartney-Francis,
L. M. Wahl,
A. B. Roberts, and M. B. Sporn.
1987.
Transforming growth factor type induces monocyte chemotaxis and growth factor production.
Proc. Natl. Acad. Sci. USA
8:354-360.
|
| 26. |
Wahl, S. M.,
N. McCartney-Francis, and S. E. Mergenhagen.
1989.
Inflammatory and immunomodulatory roles for TGF-.
Immunol. Today
10:258-261[CrossRef][Medline].
|
| 27. |
Wangoo, A.,
H. T. Cook,
G. M. Taylor, and R. J. Shaw.
1995.
Enhanced expression of type 1 procollagen and Transforming growth factor- in tuberculin induced delayed type hypersensitivity.
J. Clin. Pathol.
48:339-345 |
| 28. | Wangoo, A., I. Brown, B. G. Marshall, D. B. Young, and R. J. Shaw. 2000. BCG-associated inflammation and fibrosis: modulation by recombinant BCG expressing interferon gamma. Clin. Exp. Immunol. 119:92-98[CrossRef][Medline]. |
| 29. |
Wilkinson, K. A.,
T. D. Martin,
S. M. Reba,
H. Aung,
R. W. Redline,
W. H. Boom,
Z. Toossi, and S. A. Fulton.
2000.
Latency-associated peptide of transforming growth factor enhances mycobacterial immunity in the lung during Mycobacterium bovis BCG infection in C57BL/6 mice.
Infect. Immun.
68:6505-6508 |
| 30. | Yang, Y., J. D. Dignam, and L. E. Gentry. 1997. Role of carbohydrate in the binding of beta1-latency-associated peptide to ligands. Biochemistry 36:11923-11932[CrossRef][Medline]. |
Infection and Immunity, November 2001, p. 6676-6682, Vol. 69, No. 11
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.11.6676-6682.2001
This article has been cited by other articles:
-
Weiss, D. J., Evanson, O. A., Deng, M., Abrahamsen, M. S.
(2004). Gene Expression and Antimicrobial Activity of Bovine Macrophages in Response to Mycobacterium avium subsp. paratuberculosis. Vet Pathol
41: 326-337
[Abstract] [Full Text] -
Young, D. B, Stewart, G. R
(2002). Tuberculosis vaccines. Br Med Bull
62: 73-86
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»