Previous Article | Next Article 
Infection and Immunity, November 2001, p. 7083-7090, Vol. 69, No. 11
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.11.7083-7090.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Analysis of Borrelia burgdorferi
vlsE Gene Expression and Recombination in the Tick
Vector
Karl J.
Indest,1,
Jerrilyn K.
Howell,2
Mary B.
Jacobs,1
Dorothy
Scholl-Meeker,1
Steven J.
Norris,2 and
Mario T.
Philipp1,*
Department of Parasitology, Tulane Regional
Primate Research Center, Tulane University Health Sciences Center,
Covington, Louisiana 70433,1 and
Department of Pathology and Laboratory Medicine and Department
of Microbiology and Molecular Genetics, University of Texas Medical
School at Houston, Houston, Texas 770302
Received 20 April 2001/Returned for modification 10 July
2001/Accepted 27 July 2001
 |
ABSTRACT |
Expression and recombination of the antigenic variation
vlsE gene of the Lyme disease spirochete Borrelia
burgdorferi were analyzed in the tick vector. To assess
vlsE expression, Ixodes scapularis nymphs
infected with the B. burgdorferi strain B31 were fed on
mice for 48 or 96 h or to repletion and then crushed and acetone
fixed either immediately thereafter (ticks collected at the two earlier
time points) or 4 days after repletion. Unfed nymphs also were
examined. At all of the time points investigated, spirochetes were able
to bind a rabbit antibody raised against the conserved invariable
region 6 of VlsE, as assessed by indirect immunofluorescence, but not
preimmune serum from the same rabbit. This same antibody also bound to
B31 spirochetes cultivated in vitro. Intensity of fluorescence appeared
highest in cultured spirochetes, followed by spirochetes present in
unfed ticks. Only a dim fluorescent signal was observed on spirochetes
at the 48 and 96 h time points and at day 4 postrepletion.
Expression of vlsE in vitro was affected by a rise in pH
from 7.0 to 8.0 at 34°C. Hence, vlsE expression
appears to be sensitive to environmental cues of the type found in the
B. burgdorferi natural history. To assess
vlsE recombination, nymphs were capillary fed the
B. burgdorferi B31 clonal isolate 5A3. Ticks thus
infected were either left to rest for 4 weeks (Group I) or fed to
repletion on a mouse (Group II). The contents of each tick from both
groups were cultured and 10 B. burgdorferi clones from
the spirochetal isolate of each tick were obtained. The
vlsE cassettes from several of these clones were
amplified by PCR and sequenced. Regardless of whether the isolate was
derived from Group I or Group II ticks, no changes were observed in the
vlsE sequence. In contrast, vlsE
cassettes amplified from B. burgdorferi clones derived
from a mouse that was infected with B31-5A3 capillary-fed nymphs showed
considerable recombination. It follows that vlsE
recombination does not occur in the tick vector.
 |
INTRODUCTION |
Antigenic variation of
surface-exposed proteins has been identified as an important immune
evasion mechanism in several pathogenic bacteria and parasites
(2, 3, 18, 28, 29). Recently, it was shown that antigenic
variation occurs in the Lyme disease spirochete Borrelia
burgdorferi (31). The underlying mechanism entails
segmental recombination within a plasmid-borne locus. This locus was
named variable-major-protein (Vmp)-like sequence, or vls
(31) and is situated on the linear plasmid lp28-1. The vls locus has been characterized extensively in the B31
strain of B. burgdorferi sensu stricto
(31-33). It consists of an expression site,
vlsE, and a ca. 8-kb array of 15 silent cassettes that are
located upstream (31). The B31 vlsE gene
encodes a lipoprotein, VlsE, which has a predicted molecular mass of 34 kDa (31). The coding sequence of vlsE consists
of a variable central cassette segment that is flanked by invariant 5'
and 3' segments. During an experimental infection in mice, variable
regions within the vlsE cassette undergo recombination with
the vls silent cassettes via a gene conversion mechanism
(32). This recombination leads to variation in the
antigenic properties of VlsE (31). Thus far it has been
determined that vlsE recombination occurs in the vertebrate
host but not in spirochetes cultured in vitro (33).
Interestingly, the VlsE protein is indeed expressed in vitro
(12-14), thus indicating that vlsE
transcription and recombination can occur independently. Each of the
three pathogenic genospecies of B. burgdorferi sensu lato,
namely B. burgdorferi sensu stricto, B. garinii,
and B. afzelii, is able to express VlsE in vitro
(12-14).
The natural history of B. burgdorferi includes a vertebrate
host, usually a rodent (the white-footed mouse Peromyscus
leucopus in the United States), and an invertebrate host, a tick.
Spirochetes cycle primarily between the rodent host and the larval and
nymphal stages of ticks from the Ixodes ricinus species
complex (in the United States, mostly Ixodes scapularis).
Spirochetes, which are acquired by Ixodes larvae from
infected rodents, survive larval molting and are then transmitted by
the ensuing nymph to another vertebrate host. Infectivity of B. burgdorferi to I. scapularis larvae in the white-footed
mouse is inversely dependent on the length of time mice have been
infected, diminishing significantly 3 weeks after infection
(15). In contrast, virtually all reservoir mice in nature
have serum antibodies to several B. burgdorferi antigens,
regardless of the intensity of transmission
(4). Hence, it is possible that there are
available in the wild large numbers of mice that harbor a
nontransmissible, low-level infection, or no infection at all, yet
still have residual circulating anti-B. burgdorferi
antibody. When infected nymphs feed on such mice, it is conceivable
that anti-VlsE antibodies taken in by the tick in a blood meal may
impair spirochetal infectivity. Under these circumstances, antigenic
variation, were it to occur within the tick, might offer a selective
advantage to the spirochete. Expansion of the antigenic heterogeneity
of a rapidly dividing spirochete population could facilitate its
survival in the tick and subsequently in the vertebrate host.
Alternatively, if VlsE were not expressed in the tick, anti-VlsE
antibodies would be harmless to the spirochete.
In this study, we examined whether vlsE is expressed and
undergoes sequence variation in infected ticks and whether
vlsE recombination occurs in mice following tick
inoculation. In addition, we assessed if expression of vlsE
is affected in vitro by environmental cues that may influence B. burgdorferi lipoprotein expression in the tick, such as changes in
pH and/or temperature. Expression of the VlsE protein in the tick was
determined by immunofluorescence of tick smears before and at different
time intervals after feeding on mice, as a way of assessing the effects
of a blood meal on VlsE expression. Ticks were also infected with in
vitro-cultured spirochetes of the clonal isolate B31-5A3 using the
technique of capillary feeding. In this way, the arthropods were
infected with a B. burgdorferi population that had not
undergone vlsE recombination, as would occur in infection by
feeding on mice. The vlsE sequences of individual
spirochetal clones isolated from the capillary-inoculated ticks were
compared to determine whether vlsE sequence changes occur in
infected ticks, both before and after taking a blood meal. Furthermore,
ticks infected with B31-5A3 by capillary feeding were allowed to feed
on a mouse to assess whether vlsE sequence variation
occurred in the mammalian host after tick inoculation, as had been
shown following needle inoculation in previous studies (31,
32).
 |
MATERIALS AND METHODS |
Source of ticks, capillary feeding, and isolation of spirochetes
from ticks.
Larval I. scapularis ticks, a gift from
Thomas Mather (University of Rhode Island, Kingston), were fed to
repletion on an uninfected 8-week-old outbred mouse of the CD-1 strain
(Charles River Laboratories, Wilmington, Mass.). Larvae were allowed to molt, and the resulting nymphs were used for capillary feeding. B. burgdorferi spirochetes from the clonal isolate B31-5A3
(passage 5) were grown in Barbour-Stoenner-Kelly (BSK)-H medium
(Sigma Chemical Co., St. Louis, Mo.) to stationary phase
(
108 spirochetes per ml) as described
previously (27) and drawn up by capillary action into
pulled borosilicate tubes with filament (Sutter Instrument Co., Novato,
Calif.). The tubes were drawn into thin capillaries with a
needle-pipette puller (model 700C; David Kopf Instruments, Tujunga,
Calif.). Uninfected nymphs were placed on their backs on double-sided
tape. The tape itself was attached to the bottom of a petri dish.
Capillary tubes were situated in a groove made in molding clay. Each
tube was aligned with the tick such that the pulled tip could be fitted
at a 30o angle from the tick's head to cover the
hypostome, keeping the palpae free. Two or three ticks were placed on
each petri dish, which was then placed in a humidifier tray and
incubated for up to 1 h at 37oC. Successful
feeding was indicated by the bloating of the tick and subsequent
excretion of fluid. Capillary tubes were then removed, and ticks were
gently lifted off the tape and maintained thereafter in a humidified
environment at 22oC using a photoperiod of
16 h of light and 8 h of dark. Following capillary feeding,
ticks were divided into two groups. Ticks of Group I (five nymphs) were
maintained for 4 weeks before culturing. Ticks of Group II (four
nymphs) were kept for 10 days and then fed on a CD-1 mouse until fully
engorged. This group was kept for an additional 4 weeks postrepletion.
Infectivity of capillary-fed B31-5A3 spirochetes was confirmed by the
recovery of spirochetes from mouse ear punch biopsy cultures. Such
spirochetes also were used to assess vlsE recombination
within mice. Biopsies were collected 3 weeks postrepletion. To culture
tick-borne spirochetes, ticks of both groups were surface sterilized by
immersion in 3% hydrogen peroxide for 20 min, followed by an equally
long immersion in 70% ethanol. After the ticks were allowed to air
dry, each one was placed individually into a sterile 1.7-ml conical
microtube with 100 µl of BSK-H medium and crushed using a sterile
molecular grinding pestle (Geno Technology, Inc., St. Louis, Mo.).
After decanting the larger tick body parts, medium containing
spirochetes was transferred to a 15-ml culture and spirochetes were
allowed to proliferate. To control contamination, the medium antibiotic concentration was doubled, to a final concentration of 0.5 µg of
amphotericin B per ml, 90.8 µg of rifampin per ml, and 0.39 mg of
phosphomycin per ml (all from Sigma). Cells were grown to a
concentration between 106 and
108 cells per ml and then cryopreserved in liquid
nitrogen until further testing.
PCR amplification and sequencing of amplified cassette
fragments.
Frozen stocks of spirochetes isolated by cultivation
from the five ticks of Group I and the four ticks of Group II were
grown in BSK-H medium and allowed to reach stationary phase.
Spirochetes of each isolate were then subsurface plated on BSK-H
agarose as described previously (31). Ten well-separated
colonies of each isolate were inoculated into BSK-H, grown to
stationary phase, and frozen at
80°C following addition of glycerol
to a final concentration of 15%. PCR amplification was performed using
5 µl of the frozen cultures as the source of template DNA and primers F4120 (5'AGTAGTACGACGGGGAAACCAGA) and R4066
(5'GAGTCTGCAGTTCGCAAAGT) (31). These primers
hybridize, respectively, within the invariant 5' and 3' segments of
vlsE, to sequences that are located 28 bases upstream and 6 bases downstream from the 17-bp repeats that confine the
vlsE cassette region in the B31 clone 5A3 (31).
Amplification was carried out for 35 cycles with initial template
denaturation at 95°C for 2 min, and then denaturation at 94°C for
45 s, primer template annealing at 52°C for 45 s, and
primer extension at 72°C for 1 min. PCR was also performed using a
second set of specific primers (4598, 5' TTC TGA TGG CAC TGA GCA AAC CA
3', and 4599, 5' AAC CCT TTA CAC TTT CTT CGA TTG CGC T 3')
corresponding to a region within the BBF01 (erpD) gene of
lp28-1 (19). The resulting PCR products were analyzed by
electrophoresis on 1% agarose gels and stained with ethidium bromide
following standard procedure (23). Identity of amplicons
was confirmed by Southern hybridization with a vlsE-specific
probe (corresponding to the insert sequence of DNA clone pJRZ53
(31) and processed for chemiluminescent detection using
the Gene Images CDP-Star kit as described by the manufacturer
(Amersham, Arlington Heights, Ill.). PCR products were prepared for
sequencing using the PCR Kleen-up kit (Bio-Rad, Hercules, Calif.) and
then concentrated and desalted in a Microcon-100 filter unit
(Millipore, Bedford, Mass.). Sequencing was performed at the University
of Texas Microbiology and Molecular Genetics Core Facility using an ABI
377 automatic DNA sequencer.
Antibodies
Rabbit antibody to the invariable
region (IR) 6 of VlsE from the IP90 strain of B. garinii
was obtained as described previously (12). On Western
blots, this antibody reacts with the VlsE from spirochetes of the
B. burgdorferi sensu stricto (including B31), B.
garinii, and B. afzelii genospecies
(14). Fluorescein-labeled goat antibody against rabbit
immunoglobulin was obtained from Sigma and used in indirect fluorescent
antibody labeling (IFA) experiments. Fluorescein-labeled anti-B.
burgdorferi antibody was purchased from Kirkegaard & Perry
Laboratories (Gaithersburg, Md.) and used in direct fluorescent
antibody (DFA) labeling experiments.
Immunofluorescence.
Expression of VlsE in ticks was assessed
in B31-infected I. scapularis nymphs that were either unfed
or allowed to feed on mice for 48 or 96 h or to repletion. Ticks
were crushed and prepared for immunofluorescence either immediately
(48- and 96-h samples) or 4 days after repletion. The contents of each
tick were equally distributed on three microscope slides. The tick
smears were air dried on the slides, acetone fixed, and stored at
20°C until the slides were used. One of the three slides was used
to confirm the presence of spirochetes within the tick by DFA tests
with the anti-B. burgdorferi antibody. A second slide served
as a negative control for IFA binding and was incubated with preimmune
serum from the rabbit that was immunized with IR6. The third slide was incubated with rabbit anti-IR6 antiserum to assess expression of VlsE.
Slides were incubated with 40 µl of a 1:10 dilution of the
anti-B. burgdorferi antibody or a 1:50 dilution of rabbit preimmune or rabbit anti-IR6 serum for 30 min at 37°C. Following washes in phosphate-buffered saline (PBS), the IFA slides were incubated with the fluorescein-labeled anti-rabbit antibody at 1:150
for 30 min at 37°C. Slides were washed in PBS, dried, and examined
under the fluorescence microscope. As a positive control for detection
of VlsE by IFA testing with the anti-IR6 serum, spirochetes cultured in
vitro were used. Spirochetes of the B31 strain were grown in BSK-H
medium to stationary phase (108 cells/ml). A
0.5-ml volume of this culture was collected and centrifuged at
10,000 × g for 5 min at 4°C. The cell pellet was washed twice with PBS and resuspended in 0.5 ml of the same buffer. An
8-µl volume of this suspension was transferred to a glass microscope slide, allowed to air dry, fixed with acetone, and stored at
20°C until the slides were used. IFA binding was performed on these slides
as described above.
Analysis of VlsE expression in vitro.
B.
burgdorferi B31 spirochetes (passage 5) were grown in BSK-H medium
to a density of approximately 107 cells per ml,
diluted with BSK-H medium to 5 × 105 cells
per ml, and then incubated at 24°C for 1 week. These 24°C-adapted cultures were then used as a source to inoculate cultures adjusted to
various temperatures and/or pH, as follows: (i) BSK-H at normal pH
(7.5) and 24°C, (ii) BSK-H at pH 7.0 and 34°C, (iii) BSK-H at pH
8.0 and 34°C. The pH of the medium was adjusted either with HCl or
NaOH solutions, and cultures were inoculated at an initial density of
5 × 105 cells per ml in 10-ml tubes filled
up to the top and tightly capped. Upon reaching stationary phase, cells
were harvested by centrifugation and the pellets were washed with HEPES
wash buffer (20 mM HEPES, 10 mM NaCl [pH 7.5]) and resuspended in 100 µl of wash buffer. Samples were normalized for cell mass as described previously (22), and Western blots were prepared also as
described before (1, 9). Two Western blots were prepared,
each with extracts from cells cultured under each of the three culture
conditions. One of the blots was incubated with the antiflagellin
monoclonal antibody H9724 (purchased from the University of Texas
Health Sciences Center, San Antonio), and the other was incubated with the rabbit anti-IR6 serum at appropriate dilutions. The blots were then
developed with the ABC Vectastain kit as per the manufacturer's instructions (Vector Laboratories, Burlingame, Calif.) with appropriate secondary antibodies. Densitometric quantification of bands was performed as described previously (22).
Nucleotide sequence accession numbers.
The VlsE
cassette region amino acid sequences of clonal isolates 2441 to 2445 (as shown in Fig. 4B) have been deposited with GenBank under accession
numbers AAL06259 to AAL06263, respectively. The corresponding
nucleotide sequences are provided under accession numbers AY043397 to
AY043401. The sequences depicted in Fig. 4A are identical to those of
B. burgdorferi B31-5A3 (GenBank accession no. U76405)
and thus were not submitted to GenBank.
 |
RESULTS |
Expression of VlsE in the tick.
Ticks infected at the larval
stage by feeding on a B. burgdorferi B31-infected mouse were
allowed to molt to the nymphal stage. VlsE expression was assessed by
immunofluorescence in the following: unfed nymphs, nymphs that had fed
(on uninfected CD-1 mice) for either 48 or 96 h, and nymphs at 4 days postrepletion. Specimens from the midguts of four to eight ticks
were examined separately at each time point. Changes in outer surface
protein C (OspC) and OspA expression by B. burgdorferi in
feeding nymphs have been reported to occur early, during the first
36 h of feeding (17). Hence, at the time points
chosen to investigate VlsE expression, changes in lipoprotein
expression are occurring apace. This time interval encompasses the
periods of preferential expression of both OspC-type (48-h feeding) and
OspA-type proteins (4 days postrepletion) (17).
Spirochetes expressed VlsE when cultivated in vitro, as manifested by
the ability of acetone-fixed cultured organisms to bind rabbit anti-IR6
antibody but not immunoglobulin from preimmune serum of this same
rabbit (Fig. 1A and B, respectively). In
flat ticks, VlsE was clearly detected with the anti-IR6 rabbit
antiserum but not with the corresponding preimmune serum (Fig. 1D and
E, respectively). After feeding commenced, VlsE was faintly detectable in spirochetes attached to tissue fragments of the tick, probably the
midgut, in ticks that had fed for 48 h (Fig. 1F). In contrast, while spirochetes still could be faintly visualized with the anti-IR6 antibody at 96 h after initiation of feeding and at 4 days
postrepletion, the organisms were no longer attached to midgut tissue
(not shown). Spirochetes could be visualized in the ticks at all time
points by DFA with the fluorescein-labeled anti-B.
burgdorferi antibody (Fig. 1C, showing spirochetes in unfed
ticks). Preimmune rabbit serum did not bind to tick-borne spirochetes
at any time point.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 1.
VlsE expression in vitro and in the tick. B.
burgdorferi B31 spirochetes cultured in vitro (A and B) or
present in a tick squash (C, D, E, and F) were incubated with rabbit
anti-IR6 antiserum and fluorescein-labeled anti-rabbit immunoglobulin
antibody (A, D, and F), with a preimmune bleed of the same rabbit (B
and E) or with a fluorescein-labeled anti-B. burgdorferi
antibody (C). Tick squashes were either from unfed ticks (C, D, and E)
or from ticks that had fed for 48 h (F). All preparations were
acetone fixed.
|
|
Changes in VlsE expression in vitro in response to changes in pH
and/or temperature.
Expression of VlsE in vitro was sensitive to
an increase in the pH of the medium. When spirochetes cultivated in
normal BSK-H medium (pH 7.5) were grown at 24°C they expressed the
VlsE protein at a level comparable to that of spirochetes cultivated at
34°C and pH 7.0. Thus, a decrease in the pH of the medium accompanied by an increase in temperature did not appear to influence VlsE expression. This can be seen in Fig. 2A,
where a Western blot in which the same number of spirochetes was loaded
in each lane shows similar intensities of the VlsE band, as visualized
by the rabbit anti-IR6 antiserum. In contrast, VlsE expression was
diminished fourfold, as estimated by densitometry, in spirochetes
cultured at 34°C and pH 8.0 (Fig. 2A). Flagellin expression remained
unaltered (Fig. 2B). This experiment was performed twice, with the same results.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Effects of temperature and/or pH on VlsE expression in
vitro. Spirochetes (B31) were cultured in BSK-H medium at 24°C and pH
7.5 (24, 7.5), 34°C and pH 7.0 (34, 7), or 34°C and pH 8.0 (34, 8).
Material solubilized from equal numbers of spirochetes was applied to
each lane, electrophoresed, and blotted as described in Materials and
Methods. Blots were developed either with a rabbit anti-IR6 antiserum
(A) or with monoclonal antibody H9725 antiflagellin (B).
|
|
vlsE recombination in tick-borne spirochetes.
To assess whether vlsE recombination occurs in the arthropod
environment, ticks were inoculated by capillary feeding with B. burgdorferi clone B31-5A3 cultured in vitro. This approach permitted the infection of ticks with borreliae that were of a single
vlsE genotype, as vlsE variation has not been
detected in organisms of this strain cultured in vitro
(33). A flowchart depicting the relevant aspects of the
experimental design is presented in Fig.
3. Ticks inoculated by capillary feeding
either were cultured for spirochetes 4 weeks thereafter (Group I) or,
10 days after capillary feeding, were allowed to feed to repletion on
an uninfected mouse and held for an additional 4 weeks prior to culture
(Group II) (Fig. 3). Frozen stocks of spirochetes isolated by
cultivation from the five ticks of Group I and the four ticks of Group
II were grown in BSK-H medium and allowed to reach stationary phase. Three isolates of Group I and all of the isolates of Group II were
amplified by PCR using primers F4120 and R4066 (see Materials and
Methods). An amplicon of the predicted size (660 bp) was obtained from
each isolate and was confirmed to be derived from the vlsE gene by Southern hybridization with a vlsE-specific probe
(data not shown). Spirochetes of each of these isolates were subsurface plated, and 10 separate clones per isolate were obtained, expanded, and
frozen. Clones from two isolates (1 and 5) of Group I and of all four
of the isolates of Group II were assessed further.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3.
Flowchart of experiments performed to assess
vlsE recombination in ticks and in mice infected via
tick bite.
|
|
PCR products obtained from two clones of each of the two selected
isolates of Group I (clones 2341 and 2342 from isolate 1 and 2351 and
2352 from isolate 5) and two clones from each of the four isolates of
Group II (clones 2367 and 2370 from isolate 1, 2371 and 2372 from
isolate 2, 2383 and 2390 from isolate 3, and 2399 and 2400 from isolate
4) were sequenced as described in Materials and Methods. A comparison
of the nucleotide sequence of each of the clones with that of the
parent clonal isolate B31-5A3 revealed that vlsE
recombination was not detectable in tick-borne spirochetes regardless
of whether spirochetes were isolated from ticks before or after a blood
meal. For brevity, only the aligned deduced amino acid sequences
corresponding to the PCR-amplified vlsE regions are depicted
in Fig. 4A. The amino acid (and
nucleotide) sequences of the amplified fragments were identical to that
of the parent strain, B31-5A3.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 4.
(A) Absence of predicted amino acid sequence differences
in VlsE resulting from complete absence of vlsE
recombination in ticks. (B) Predicted amino acid sequence differences
in VlsE resulting from recombination following tick inoculation of a
mouse with B. burgdorferi. The mouse was inoculated
using ticks infected with B. burgdorferi B31-5A3 through
capillary feeding, as outlined in Fig. 3. Alignment of the cassette
region sequence of B31-5A3 VlsE (vls1) with those of
five B. burgdorferi clones cultured from the mouse 3 weeks postinfection are shown. Dashes indicate sequence identity,
whereas letters indicate conservative (lower case) and nonconservative
(upper case) amino acid differences. Gaps are shown as periods.
Probable recombinations are designated by the silent cassette sequences
involved; lines indicate the predicted minimal range of the
recombinations. In some cases, multiple silent cassettes could account
for the recombination in a given region. Asterisks correspond to single
nucleotide differences. These resulted in silent mutations
(SM).
|
|
To verify that absence of vlsE recombination was not the
consequence of failure of the spirochetes delivered by capillary feeding to actively divide in the blood-engorged ticks, three nymphs of
a group of eight that had been capillary fed with the same B31-5A3
clonal isolate and passage used in the previous experiment were placed
on a mouse and allowed to feed for 72 h. The five unfed and the
three blood-fed ticks were crushed and acetone fixed, and spirochetes
bound with the fluorescein-labeled anti-B. burgdorferi antibody were counted. Between 100 and 150 spirochetes were counted in
each squash preparation. The average number of spirochetes per field
prior to feeding was 0.51 ± 0.13 (mean ± standard error), whereas after a blood meal this number increased to 13.5 ± 3.3 spirochetes per field. This 26-fold expansion in the spirochetal density indicates that spirochetes within the capillary-infected ticks
were actively dividing in the ticks during feeding.
In marked contrast with the absence of vlsE recombination
found in tick-borne spirochetes, when spirochetes were isolated from
ear punch biopsy cultures of mice that had been infected by the bite of
B. burgdorferi B31-5A3-capillary-fed nymphs, the spirochetes
showed numerous vlsE sequence differences (Fig. 4B). The
clonal isolates were all different from each other as well as from the
parental strain. This result is consistent with the occurrence of
vlsE recombination in mice after tick-borne infection, as
was found previously following needle inoculation
(31-33).
Changes in vlsE sequences appear to correspond to gene
conversion events in which segments of the vls silent
cassettes recombine into the vlsE cassette region
(31). These apparent recombination events were deduced by
alignment of the variant amino acid and nucleotide sequences (marked
2441 through 2445) with those of the B31-5A3 vlsE sequence
and the silent cassette sequences (data not shown). The minimal ranges
of the silent cassette sequences involved in the predicted
recombinations are indicated by lines in Fig. 4B. Most of these
assignments were unambiguous, but some changes could be due to a
recombination with one of several different silent cassettes (e.g.,
vls5, vls6, and vls9 in the VR-III
region of clone 2443). Several gene conversion events were evident in other clones. In clone 2442, the sequence differences were consistent with three separate recombinations with the silent cassette
vls3 (31). Each region matching vls3
was separated by a sequence that corresponded to the parental
B31-5A3 sequence; thus, the sequence changes did not result from a
single, large recombination event. In a few instances there were single
nucleotide changes or reversions within the region of a silent cassette
recombination; these are marked with asterisks and caused silent
mutations (Fig. 4B). In one case (nucleotide 552 of the vlsE
cassette sequence 2444, located in VR-VI), the nucleotide (C) did not
correspond to any of the nucleotides encoded in vlsE1 or the
vls silent cassettes. The surrounding region is consistent
with a vls4 silent cassette segmental recombination; the T
224 C transition is silent, i.e., it does not result in a change at the
amino acid level (both GGT and GGC encode glycine). This finding is
consistent with the occurrence of a point mutation rather than a
recombination at this location.
lp28-1 is not required for B. burgdorferi survival
in ticks.
In the course of characterizing the B. burgdorferi clones isolated from infected ticks, it was found that
many of these lacked lp28-1, the linear plasmid that contains the
vls locus. In cultures obtained from two Group I and four
Group II ticks, the numbers of lp28-1-positive clones ranged from 2 of
10 to 10 of 10, with the total being 32 of 60. A retrospective analysis
of the original B31-5A3 stock indicated that 20 of 20 clones contained
lp28-1, whereas the subsequent passage used for tick inoculation
yielded a detectable vlsE PCR product in only 17 of 20 clones. The presence or absence of lp28-1 was confirmed by Southern
blot hybridization using a vls sequence probe and also by
PCR amplification of a second region within the gene BBF01
(erpD) at the other end of the plasmid (19).
The results of each of these analyses corresponded exactly, indicating
that lp28-1 was indeed absent from a portion of the tick- and in vitro
culture-derived clones (data not shown). Thus, lp28-1 was apparently
lost from some clones during the two to three intervening in vitro
passages; rapid loss of lp28-1 and other B. burgdorferi
plasmids had been noted previously (21, 33). The fact that
many of the B. burgdorferi clones recovered from infected
ticks lacked lp28-1 indicates that this plasmid is not required for
survival of B. burgdorferi during the tick phase of its life
cycle. In contrast, all clones obtained from the mouse infected by the
Group II ticks contained lp28-1. This observation is consistent with
previous results indicating that this plasmid is required for optimal
survival and multiplication of B. burgdorferi in the
mammalian environment (10, 11, 16, 21, 33).
 |
DISCUSSION |
We have analyzed whether the VlsE protein is expressed by B. burgdorferi within I. scapularis nymphs. VlsE
expression was examined in the unfed nymph, the feeding nymph at
48 h after initiation of feeding, when spirochetal transmission is
occurring (20), at 96 h, the time of repletion, and 4 days postrepletion. VlsE expression, as evidenced by IFA labeling with
the anti-IR6 antibody, was detectable at all time points, albeit with
markedly different fluorescence intensities. Fluorescence was most
intense in spirochetes from unfed nymphs. At the 48 h time point,
spirochetes were found closely attached to portions of tissue. We
surmised this tissue to be part of the tick midgut. The fluorescence
intensity was low but still distinguishable from that of organisms
incubated with the preimmune rabbit serum. At the 96 h time point
and at 4-days postrepletion, spirochetes were no longer attached to
tissue fragments but the fluorescence intensity due to binding of
anti-IR6 antibody also was lower than in unfed ticks. Thus, it is
possible that the expression of VlsE is down-regulated at the
initiation of tick feeding, perhaps in a manner similar to that of OspA
(5, 7, 17, 24-26). In contrast with the OspA expression
pattern, however, the VlsE protein is expressed in vivo immediately
after infection (12, 13).
Recently, Yang et al. (30) found that a decrease in pH, in
conjunction with increases in temperature and cell density, acted interdependently on the up-regulation of ospC expression and
the down-regulation of ospA expression in vitro, in a manner
that modeled the tick midgut environment during feeding
(30). Other genes also were found to be regulated in a
reciprocal fashion. Such genes were either ospC-like, e.g.,
ospF, mlp-8, and rpoS, or
ospA-like (lp6.6 and p22). From our
results, and borrowing from the nomenclature of Yang et al., it appears
that vlsE is neither ospA- nor
ospC-like. Since the VlsE lipoprotein was expressed in vitro
at 24°C, or at 34°C and pH 8.0, it is not OspC-like. The OspC
lipoprotein is not expressed at 23°C at any pH or at 37°C and pH
8.0, whereas it is expressed at the higher temperature at pH 6.8 and
7.5 (30). VlsE also is not OspA-like, in that OspA is
expressed at lower levels at 37°C and pH 6.8 and increases its
expression level as the pH rises to 7.5 and 8.0 (30),
whereas VlsE decreased its expression level at 34°C as the pH of the
medium changed from 7.0 to 8.0. VlsE also does not appear to be
P21-like, for this protein is expressed neither in the tick nor in
vitro but only in the mammalian host (6). In our hands
VlsE was expressed in vitro, in the tick, and in the mammalian host
(12, 13, 31). Its level of expression, however, appears to
be susceptible to environmental cues of the type found in the
spirochetal life cycle.
Other proteins involved in antigenic variation, such as the variant
surface glycoprotein (VSG) of African trypanosomes, cease to be
expressed when trypanosomes are taken up by the vector tsetse fly and
enter the so-called procyclic stage (8). Procyclic trypanosomes are not coated with VSG. Instead they express a new surface coat composed of the protein procyclin (8).
Expression of VSG is reinitiated only during differentiation to the
metacyclic stage in the salivary glands of the tsetse fly. Metacyclic
trypanosomes are infective to mammals. Their newly acquired VSG coat is
thought to be essential for parasite survival and proliferation
following infection (8). We did not specifically assess
expression of VlsE in the tick salivary glands, but considering that
this lipoprotein is expressed in the tick midgut and early after
infection of the mammalian host, it is likely that its expression is
not interrupted during the passage through the salivary glands. The
pattern of expression of VlsE by B. burgdorferi is similar
to that of Vmp, the antigenic variation protein of the relapsing-fever
spirochete Borrelia hermsii: as with VlsE, Vmp is expressed
both in the mammalian host and in the vector tick (25).
We found no evidence of vlsE recombination, either in flat
nymphs that were capillary fed with spirochetes and then allowed to
rest for 4 weeks or in capillary-infected, blood-fed ticks at 4 weeks
postrepletion. This result is in stark contrast with the
vlsE recombination we observed in mice at 3 weeks
postinfection. Since the same clonal isolate of B31 was used for both
experiments, our result indicates that recombination is either actively
inhibited by as yet unknown tick-derived factors or elicited by
vertebrate-host factors that are present neither in the unfed nor in
the blood-fed tick. B. burgdorferi antigenic variation had
been previously observed in mice that were experimentally infected via
needle inoculation (31, 33). Our result proves that this
phenomenon also occurs in mice that were inoculated with B. burgdorferi via tick bite and underscores the already paradigmatic
notion that antigenic variation of B. burgdorferi occurs in nature.
In a recent paper, Ohnishi et al. presented the results of an analysis
of vlsE recombination in ticks (17). Their
experimental design differed substantially from the one we employed
herein. They isolated DNA from B. burgdorferi-infected
nymphal ticks that were either unfed or fed on mice for 48 h. The
nymphs had been infected at the larval stage by allowing larvae to feed
on mice at 4 weeks after needle inoculation with a clonal isolate of
B. burgdorferi B31 (19). Four weeks is ample
time for vlsE recombination to occur in mice
(33). Hence, the larvae, and thereafter the nymphs, were
infected with spirochetes that must have borne vlsE genes of
diverse sequence. The cassette region of vlsE was PCR amplified using as template the DNA isolated from the unfed and fed
nymphs, and the vlsE amplicons were inserted into an
appropriate Escherichia coli plasmid vector
(17). After transformation, vlsE inserts of 30 E. coli clones derived from unfed-tick DNA and 24 clones
from 48-h-fed-tick DNA were analyzed by restriction fragment length
polymorphism. For this purpose the inserts were digested with the
restriction endonucleases AluI and MboI
(17). Only 2 of the 30 clones from unfed ticks had
patterns that differed from those of the parental strain. In contrast,
the 24 clones derived from feeding ticks had 13 different restriction
fragment length polymorphism patterns, all of which were different from that of the parental strain (17). The authors offer two
interpretations of this result. Their preferred one is that the
increased vlsE sequence diversity of the clones derived from
fed ticks is due to VlsE recombination that occurs
postfeeding. The alternative explanation they suggested is that, as the
spirochetal population was expanded in the feeding tick, spirochetal
subpopulations bearing preexisting variant vlsE became
preferentially more numerous (17). In view of our results,
we believe the latter to be the correct explanation.
The recombination mechanism underlying VlsE antigenic variation, as
well as the expression of this protein, seems sensitive to
environmental conditions. When spirochetes are cultured in vitro or are
present in the tick, VlsE is expressed but no vlsE recombination occurs (31). In the mammalian host both
recombination and expression take place (33). If, as we
posited in the introduction, an array of anti-VlsE antibodies coexists
with tick-borne spirochetes during the life cycle of B. burgdorferi in the wild, its possible deleterious effect upon the
spirochete is not offset by absence of VlsE expression or presence of
vlsE recombination within the tick. Perhaps the initial
antigenic diversity of the spirochetal population in the unfed tick is
sufficient to allow transmission of selected variants to occur, despite
the presence of anti-VlsE antibodies in the mammalian host.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH-NCRR grant RR00164 (M.T.P.),
NIH-NIAID grant AI37277 (S.J.N.) and Texas Advanced Technology Program
grant 011618-0236-1999 (S.J.N.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Tulane Regional
Primate Research Center, Tulane University Health Sciences Center, 18703 Three Rivers Rd., Covington, LA 70433. Phone: (504) 871-6221. Fax: (504) 871-6390. E-mail: philipp{at}tpc.tulane.edu.
Present address: ASI Services, Vicksburg, MS 39182.
Editor:
V. J. DiRita
 |
REFERENCES |
| 1.
|
Aydintug, M. K.,
Y. Gu, and M. T. Philipp.
1994.
Borrelia burgdorferi antigens that are targeted by antibody-dependent, complement-mediated killing in the rhesus monkey.
Infect. Immun.
62:4929-4937[Abstract/Free Full Text].
|
| 2.
|
Barstad, P. A.,
J. E. Coligan,
M. G. Raum, and A. G. Barbour.
1985.
Variable major proteins of Borrelia hermsii, epitope mapping and partial sequence analysis of CNBr peptides.
J. Exp. Med.
161:1302-1314[Abstract/Free Full Text].
|
| 3.
|
Borst, P.
1991.
Molecular genetics of antigenic variation.
Immunol. Today
12:A29-A33[CrossRef][Medline].
|
| 4.
|
Brunet, L. R.,
C. Sellitto,
A. Spielman, and S. R. Telford, III.
1995.
Antibody response of the mouse reservoir of Borrelia burgdorferi in nature.
Infect. Immun.
63:3030-3036[Abstract].
|
| 5.
|
Coleman, J. L.,
J. A. Gebbia,
J. Piesman,
J. L. Degen,
T. H. Bugge, and J. L. Benach.
1997.
Plasminogen is required for efficient dissemination of B. burgdorferi in ticks and for enhancement of spirochetemia in mice.
Cell
89:1111-1119[CrossRef][Medline].
|
| 6.
|
Das, S.,
S. W. Barthold,
S. S. Giles,
R. R. Montgomery,
S. R. Telford III, and E. Fikrig.
1997.
Temporal pattern of Borrelia burgdorferi p21 expression in ticks and the mammalian host.
J. Clin. Investig.
99:987-995[Medline].
|
| 7.
|
Fingerle, V.,
G. Liegl,
U. Munderloh, and B. Wilske.
1998.
Expression of outer surface proteins A and C of Borrelia burgdorferi in Ixodes ricinus ticks removed from humans.
Med. Microbiol. Immunol.
187:121-126[CrossRef][Medline].
|
| 8.
|
Graham, S. V.,
B. Wymer, and J. D. Barry.
1998.
Activity of a trypanosome metacyclic variant surface glycoprotein gene promoter is dependent upon life cycle stage and chromosomal context.
Mol. Cell. Biol.
18:1137-1146[Abstract/Free Full Text].
|
| 9.
|
Indest, K. J.,
R. Ramamoorthy,
M. Sole,
R. D. Gilmore,
B. J. Johnson, and M. T. Philipp.
1997.
Cell-density-dependent expression of Borrelia burgdorferi lipoproteins in vitro.
Infect. Immun.
65:1165-1171[Abstract].
|
| 10.
|
Iyer, R.,
J. M. Hardham,
G. P. Wormser,
I. Schwartz, and S. J. Norris.
2000.
Conservation and heterogeneity of vlsE among human and tick isolates of Borrelia burgdorferi.
Infect. Immun.
68:1714-1718[Abstract/Free Full Text].
|
| 11.
|
Labandeira-Rey, M., and J. T. Skare.
2001.
Decreased infectivity in Borrelia burgdorferi strain B31 is associated with loss of linear plasmid 25 or 28-1.
Infect. Immun.
69:446-455[Abstract/Free Full Text].
|
| 12.
|
Liang, F. T.,
A. L. Alvarez,
Y. Gu,
J. M. Nowling,
R. Ramamoorthy, and M. T. Philipp.
1999.
An immunodominant conserved region within the variable domain of VlsE, the variable surface antigen of Borrelia burgdorferi.
J. Immunol.
163:5566-5573[Abstract/Free Full Text].
|
| 13.
|
Liang, F. T.,
A. C. Steere,
A. R. Marques,
B. J. B. Johnson,
J. M. Miller, and M. T. Philipp.
1999.
Sensitive and specific serodiagnosis of Lyme disease by enzyme-linked immunosorbent assay with a peptide based on an immunodominant conserved region of Borrelia burgdorferi VlsE.
J. Clin. Microbiol.
37:3990-3996[Abstract/Free Full Text].
|
| 14.
|
Liang, F. T.,
L. C. Bowers, and M. T. Philipp.
2001.
The C-terminal invariable domain of VlsE is immunodominant but its antigenicity is scarcely conserved among strains of Lyme disease spirochetes.
Infect. Immun.
69:3224-3231[Abstract/Free Full Text].
|
| 15.
|
Lindsay, L. R.,
I. K. Barker,
G. A. Surgeoner,
S. A. McEwen, and G. D. Campbell.
1997.
Duration of Borrelia burgdorferi infectivity in white-footed mice for the tick vector Ixodes scapularis under laboratory and field conditions in Ontario.
J. Wildl. Dis.
33:766-775[Abstract].
|
| 16.
|
McDowell, J. V.,
S. Y. Sung,
M. Labandeira-Rey,
J. T. Skare, and R. T. Marconi.
2001.
Analysis of mechanisms associated with loss of infectivity of clonal populations of Borrelia burgdorferi B31MI.
Infect. Immun.
69:3670-3677[Abstract/Free Full Text].
|
| 17.
|
Ohnishi, J.,
J. Piesman, and A. M. de Silva.
2001.
Antigenic and genetic heterogeneity of Borrelia burgdorferi populations transmitted by ticks.
Proc. Natl. Acad. Sci. USA
98:670-675[Abstract/Free Full Text].
|
| 18.
|
Palmer, G. H.,
W. C. Brown, and F. R. Rurangirwa.
2000.
Antigenic variation in the persistence and transmission of the ehrlichia Anaplasma marginale.
Microbes Infect.
2:167-176[CrossRef][Medline].
|
| 19.
|
Piesman, J.
1993.
Standard system for infecting ticks (Acari: Ixodidae) with the Lyme disease spirochete, Borrelia burgdorferi.
J. Med. Entomol.
30:199-203[Medline].
|
| 20.
|
Piesman, J.,
J. R. Oliver, and R. J. Sinsky.
1990.
Growth kinetics of the Lyme disease spirochete (Borrelia burgdorferi) in vector ticks (Ixodes dammini).
Am. J. Trop. Med. Hyg.
42:352-357.
|
| 21.
|
Purser, J. E., and S. J. Norris.
2000.
Correlation between plasmid content and infectivity in Borrelia burgdorferi.
Proc. Natl. Acad. Sci. USA
97:13865-13870[Abstract/Free Full Text].
|
| 22.
|
Ramamoorthy, R., and M. T. Philipp.
1998.
Differential expression of Borrelia burgdorferi proteins during growth in vitro.
Infect. Immun.
66:5119-5124[Abstract/Free Full Text].
|
| 23.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 24.
|
Schwan, T. G.,
J. Piesman,
W. T. Golde,
M. C. Dolan, and P. A. Rosa.
1995.
Induction of an outer surface protein on Borrelia burgdorferi during tick feeding.
Proc. Natl. Acad. Sci. USA
92:2909-2913[Abstract/Free Full Text].
|
| 25.
|
Schwan, T. G., and B. J. Hinnebusch.
1998.
Bloodstream- versus tick-associated variants of a relapsing fever bacterium.
Science
280:1938-1940[Abstract/Free Full Text].
|
| 26.
|
Schwan, T. G., and J. Piesman.
2000.
Temporal changes in outer surface proteins A and C of the Lyme disease-associated spirochete, Borrelia burgdorferi, during the chain of infection in ticks and mice.
J. Clin. Microbiol.
38:382-388[Abstract/Free Full Text].
|
| 27.
|
Solé, M.,
C. Bantar,
K. Indest,
Y. Gu,
R. Ramamoorthy,
R. Coughlin, and M. T. Philipp.
1998.
Borrelia burgdorferi escape mutants that survive in the presence of antiserum to the OspA vaccine are killed when complement is also present.
Infect. Immun.
66:2540-2546[Abstract/Free Full Text].
|
| 28.
|
Stoenner, H. G.,
T. Dodd, and C. Larsen.
1982.
Antigenic variation of Borrelia hermsii.
J. Exp. Med.
156:1297-1311[Abstract/Free Full Text].
|
| 29.
|
Van der Ploeg, L. H. T.,
K. Gottesdiener, and M. G. S. Lee.
1992.
Antigenic variation in African trypanosomes.
Trends Genet.
8:452-457[Medline].
|
| 30.
|
Yang, X.,
M. S. Goldberg,
T. G. Popova,
G. B. Schoeler,
S. K. Wikel,
K. E. Hagman, and M. V. Norgard.
2000.
Interdependence of environmental factors influencing reciprocal patterns of gene expression in virulent Borrelia burgdorferi.
Mol. Microbiol.
37:1470-1479[CrossRef][Medline].
|
| 31.
|
Zhang, J. R.,
J. M. Hardham,
A. G. Barbour, and S. J. Norris.
1997.
Antigenic variation in Lyme disease borreliae by promiscuous recombination of VMP-like sequence cassettes.
Cell
89:275-285[CrossRef][Medline].
|
| 32.
|
Zhang, J. R., and S. J. Norris.
1998.
Genetic variation of the Borrelia burgdorferi gene vlsE involves cassette-specific, segmental gene conversion.
Infect. Immun.
66:3698-3704[Abstract/Free Full Text].
|
| 33.
|
Zhang, J. R., and S. J. Norris.
1998.
Kinetics and in vivo induction of genetic variation of vlsE in Borrelia burgdorferi.
Infect. Immun.
66:3689-3697[Abstract/Free Full Text].
|
Infection and Immunity, November 2001, p. 7083-7090, Vol. 69, No. 11
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.11.7083-7090.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Liveris, D., Mulay, V., Sandigursky, S., Schwartz, I.
(2008). Borrelia burgdorferi vlsE Antigenic Variation Is Not Mediated by RecA. Infect. Immun.
76: 4009-4018
[Abstract]
[Full Text]
-
Embers, M. E., Alvarez, X., Ooms, T., Philipp, M. T.
(2008). The Failure of Immune Response Evasion by Linear Plasmid 28-1-Deficient Borrelia burgdorferi Is Attributable to Persistent Expression of an Outer Surface Protein. Infect. Immun.
76: 3984-3991
[Abstract]
[Full Text]
-
Stewart, P. E., Bestor, A., Cullen, J. N., Rosa, P. A.
(2008). A Tightly Regulated Surface Protein of Borrelia burgdorferi Is Not Essential to the Mouse-Tick Infectious Cycle. Infect. Immun.
76: 1970-1978
[Abstract]
[Full Text]
-
Bykowski, T., Babb, K., von Lackum, K., Riley, S. P., Norris, S. J., Stevenson, B.
(2006). Transcriptional Regulation of the Borrelia burgdorferi Antigenically Variable VlsE Surface Protein. J. Bacteriol.
188: 4879-4889
[Abstract]
[Full Text]
-
Jacobs, M. B., Norris, S. J., Phillippi-Falkenstein, K. M., Philipp, M. T.
(2006). Infectivity of the Highly Transformable BBE02- lp56- Mutant of Borrelia burgdorferi, the Lyme Disease Spirochete, via Ticks.. Infect. Immun.
74: 3678-3681
[Abstract]
[Full Text]
-
Strother, K. O., de Silva, A.
(2005). Role of Borrelia burgdorferi Linear Plasmid 25 in Infection of Ixodes scapularis Ticks. J. Bacteriol.
187: 5776-5781
[Abstract]
[Full Text]
-
Lawrenz, M. B., Wooten, R. M., Norris, S. J.
(2004). Effects of vlsE Complementation on the Infectivity of Borrelia burgdorferi Lacking the Linear Plasmid lp28-1. Infect. Immun.
72: 6577-6585
[Abstract]
[Full Text]
-
Grimm, D., Eggers, C. H., Caimano, M. J., Tilly, K., Stewart, P. E., Elias, A. F., Radolf, J. D., Rosa, P. A.
(2004). Experimental Assessment of the Roles of Linear Plasmids lp25 and lp28-1 of Borrelia burgdorferi throughout the Infectious Cycle. Infect. Immun.
72: 5938-5946
[Abstract]
[Full Text]
-
Ohnishi, J., Schneider, B., Messer, W. B., Piesman, J., de Silva, A. M.
(2003). Genetic Variation at the vlsE Locus of Borrelia burgdorferi within Ticks and Mice over the Course of a Single Transmission Cycle. J. Bacteriol.
185: 4432-4441
[Abstract]
[Full Text]
-
Crother, T. R., Champion, C. I., Wu, X.-Y., Blanco, D. R., Miller, J. N., Lovett, M. A.
(2003). Antigenic Composition of Borrelia burgdorferi during Infection of SCID Mice. Infect. Immun.
71: 3419-3428
[Abstract]
[Full Text]
-
Schulte-Spechtel, U., Lehnert, G., Liegl, G., Fingerle, V., Heimerl, C., Johnson, B. J. B., Wilske, B.
(2003). Significant Improvement of the Recombinant Borrelia-Specific Immunoglobulin G Immunoblot Test by Addition of VlsE and a DbpA Homologue Derived from Borrelia garinii for Diagnosis of Early Neuroborreliosis. J. Clin. Microbiol.
41: 1299-1303
[Abstract]
[Full Text]
-
Roberts, D. M., Caimano, M., McDowell, J., Theisen, M., Holm, A., Orff, E., Nelson, D., Wikel, S., Radolf, J., Marconi, R. T.
(2002). Environmental Regulation and Differential Production of Members of the Bdr Protein Family of Borrelia burgdorferi. Infect. Immun.
70: 7033-7041
[Abstract]
[Full Text]
-
McDowell, J. V., Sung, S.-Y., Hu, L. T., Marconi, R. T.
(2002). Evidence That the Variable Regions of the Central Domain of VlsE Are Antigenic during Infection with Lyme Disease Spirochetes. Infect. Immun.
70: 4196-4203
[Abstract]
[Full Text]
-
Eicken, C., Sharma, V., Klabunde, T., Lawrenz, M. B., Hardham, J. M., Norris, S. J., Sacchettini, J. C.
(2002). Crystal Structure of Lyme Disease Variable Surface Antigen VlsE of Borrelia burgdorferi. J. Biol. Chem.
277: 21691-21696
[Abstract]
[Full Text]