TEXT

Top Abstract Text References

In several bacteria, various alternative sigma factors modulate gene expression in response to environmental and metabolic signals (12). Based on the information available for the Staphylococcus aureus genome, staphylococci appear to possess only one alternative sigma factor, ^B. Therefore, ^B is presumed to play a crucial role in global regulation. Expression of virulence factors in S. aureus has been shown to depend on ^B (17) and on at least two global regulatory systems: agr (accessory gene regulator) (20) and sar (staphylococcal accessory regulator) (4). Since sar is responsible for agr activation and ^B influences SarA expression (5), ^B represents the superior global regulator in the S. aureus regulatory network controlling exoprotein expression.

Staphylococcus epidermidis ranks among the most important nosocomial pathogens, mainly because of its ability to colonize indwelling medical devices by forming a biofilm (9, 10, 29). In addition, many antibiotics lose their effectiveness against S. epidermidis in the biofilm environment because of the impenetrable slime capsule (6, 28). A further factor contributing to the severe threat of S. epidermidis to public health is the occurrence of multiresistant and vancomycin-resistant strains (24). Virtually nothing is known about the regulation of virulence factors in S. epidermidis. An agr deletion mutant has recently been constructed and characterized by our group (30), but no other global regulator has been studied so far.

A region of the chromosome of S. epidermidis Tü3298 comprising four open reading frames with strong sequence similarities to the S. aureus sigB operon was sequenced by direct chromosomal sequencing (GenBank accession number AF359562), starting with primer S1 (CACGAAGATTTAGTTCAAGTTGGTATGGTGG), derived from the S. aureus sequence. The striking similarity in both sequence and overall genetic organization suggested that this region is the sigB operon of S. epidermidis (Fig. 1).

View larger version (28K): [in this window] [in a new window]   FIG. 1.   Physical map of the sigB operon of S. epidermidis and construction of a sigB deletion mutant using plasmid pBTsigB. Arrows depict open reading frames and indicate their orientation and size. The sigB gene was replaced with the spectinomycin resistance gene (spc) as shown in the lower part of the figure. The spc gene and two PCR-amplified regions flanking sigB were cloned into plasmid pBT2, yielding integration vector pBTsigB. The crosses indicate the sites of homologous recombination.

In order to analyze its function in S. epidermidis, sigB was replaced by a spectinomycin resistance gene (spc) from Tn554 (19) by homologous recombination (Fig. 1). Since the rsb genes are tightly clustered and rsbW and sigB overlap, we decided not to replace the first bases of sigB, leaving the anti-sigma factor rsbW intact. Fragments of about 870 bp upstream and downstream of sigB were amplified using primer pairs SigEcoRI and SigBamHI (GAT TAAAG TGAAT TCATG TAGGG TATAGG and CAGGTGATGGATCCCTAGCTGAT TTCGAC) for fragment 1 and SigSphI and SigHindIII (GCTGCATGCCAGTAAACGAGT TGTTAAC and GAGGAAAAGCTTAGTCCCTGATTAAAAACATC) for fragment 2. The fragments were cloned into the polylinker region of plasmid pBT2 (2), flanking the spectinomycin resistance gene. The resulting plasmid, pBTsigB, was introduced into S. epidermidis Tü3298 by electroporation (1). Allelic replacement of the wild-type sigB gene by spc was carried out as previously described (2). The correct insertion of the antibiotic resistance marker in the resulting strain, S. epidermidis TüsigB, was confirmed by Southern blot analysis and chromosomal sequencing.

To investigate the influence of ^B on protein expression, protein samples from stationary phase (16 h) cultures were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The protein profiles of the ^B mutant S. epidermidis TüsigB and the wild-type strain S. epidermidis Tü3298 were compared with the complemented mutant S. epidermidis TüsigB(pTXsigB) and S. epidermidis Tü(pTXsigB), which overexpresses sigB. To generate plasmid pTXsigB, the sigB gene of S. epidermidis Tü3298 was amplified by PCR with primers SigUBamHI (GATTAAGGATCCAAAAAAAGAGCAGGTGCG) and SigUMluI (CTCTGTTAACAACGCGTTTACTGTCTTGCAGC) and cloned in plasmid pTX15 (23, 31). S. epidermidis TüsigB(pTX16) and S. epidermidis Tü(pTX16) served as control strains to show that complementation and overexpression effects are not caused by the pTX plasmid. Plasmid pTX16 (23, 31) is used as a negative control in pTX15 expression studies, because cloning in vector pTX15 deletes a lipase gene which had also been deleted in pTX16.

Strains were cultivated in B-medium (1% peptone [Difco], 0.5% yeast extract [Gibco-BRL], 0.5% NaCl, 0.1% K₂HPO₄, 0.1% glucose). Vectors pTX15 and pTX16 allow xylose-inducible and glucose-repressible gene expression (23, 31), and therefore strains containing these plasmids were grown in modified B-medium containing 0.5% xylose and lacking glucose. Cultures were adjusted to the same cell density and grown for 16 h. Exoprotein samples were precipitated with 1/9 volume of trichloracetic acid, and cytoplasmic and membrane fractions were prepared as described previously (22). The growth rates of all the strains tested were the same.

Deletion of sigB in S. epidermidis resulted in a pleiotropic alteration of the protein pattern of exoproteins (Fig. 2) and cytoplasmic proteins (Fig. 3), while the composition of membrane proteins was not altered significantly (data not shown). The most striking differences in the ^B -mutant samples containing exoproteins were the absence of an approximately 27-kDa protein and clearly more pronounced 44-kDa and 38-kDa proteins. The profiles of cytoplasmic proteins showed a distinct change in the pattern, especially in the range from about 25 to 30 kDa. Most remarkable in this respect is a protein of about 27 kDa, which is present in significantly higher amounts in the mutant strain. Comparison of protein profiles show that the ^B -minus phenotype was complemented by plasmid pTXsigB; in contrast, the wild-type strain bearing the same plasmid did not show a protein pattern different from that of the wild type. Our studies suggest a crucial role for ^B in S. epidermidis gene regulation. Since the most striking differences in the protein patterns were seen in the exoprotein fractions, we decided to analyze exoprotein expression in more detail.

View larger version (87K): [in this window] [in a new window]   FIG. 2.   Influence of S. epidermidis B on production of exoproteins. Protein profiles of 16-h cultures of the following strains are shown: S. epidermidis sigB deletion mutant S. epidermidis Tü3298sigB (lane 1), S. epidermidis wild-type Tü3298 (lane 2), the complemented mutant S. epidermidis TüsigB(pTXsigB) (lane 3), the control strain S. epidermidis TüsigB(pTX16) (lane 4), the B-overexpressing strain S. epidermidis Tü(pTXsigB) (lane 5), and its corresponding control strain S. epidermidis Tü(pTX16) (lane 6). The proteins were separated on SDS-10% polyacrylamide gels and stained with Coomassie brilliant blue G250. The arrows mark the positions of 27-kDa, 38-kDa, and 44-kDa proteins present or absent in the different strains. The molecular masses (in kilodaltons) of size standard proteins are shown on the left.

View larger version (84K): [in this window] [in a new window]   FIG. 3.   Influence of S. epidermidis B on production of cytoplasmic proteins. Protein profiles of 16-h cultures of the following strains are shown: S. epidermidis sigB deletion mutant S. epidermidis Tü3298sigB (lane 1), S. epidermidis wild-type Tü3298 (lane 2), the complemented mutant S. epidermidis TüsigB(pTXsigB) (lane 3), the control strain S. epidermidis TüsigB(pTX16) (lane 4), the B-overexpressing strain S. epidermidis Tü(pTXsigB) (lane 5), and its corresponding control strain S. epidermidis Tü(pTX16) (lane 6). The proteins were separated on SDS-10% polyacrylamide gels and stained with Coomassie brilliant blue G250. The arrow indicates the position of a 27-kDa protein present or absent in the different strains. The molecular masses (in kilodaltons) of size standard proteins are shown on the left.

Lipases and proteases are known to be virulence factors in S. aureus (8, 11) and may also contribute to the pathogenicity of S. epidermidis. Therefore, lipase and protease activity in the supernatant of the S. epidermidis wild-type and sigB mutant strains was analyzed by zymography (Fig. 4). Exoprotein samples were separated on nondenaturing SDS-polyacrylamide gels and incubated on agarose test plates containing 1% Tween (for lipase detection) or 1% casein according to the method of Hammersten (Amersham Pharmacia Biotech, Freiburg, Germany) for protease detection as described previously (30). Staphylococcal lipases are organized as preproenzymes and are secreted in the prolipase form (11, 27). Lipase test plates revealed a single lipolytic band at about 50 kDa in the exoprotein sample from the S. epidermidis wild-type strain, which was less pronounced in samples from the ^B mutant strain. A second lipolytic band of about 100 kDa was also present in samples from the mutant strain; the size corresponds to that of the proform of staphylococcal lipase (11, 27). Thus, the processing of this lipase shows pronounced ^B dependence. In contrast, lipase production was enhanced in three different S. aureus ^B mutants compared to their isogenic wild-type strains (17). These data indicate that the involvement of ^B in lipase gene expression may vary among staphylococcal species. Protease test plates of the ^B mutant strain showed a distinct proteolytic band at about 25 kDa which was not detectable in the wild-type strain. For strain S. epidermidis Tü3298, an extracellular protease with a corresponding molecular mass has not been reported so far. The results indicate that the expression or secretion of this novel protease is repressed by ^B.

View larger version (53K): [in this window] [in a new window]   FIG. 4.   Zymographic analysis of protease (A) and lipase (B) activity. Exoprotein samples of strains S. epidermidis Tü3298 (wild-type; sigB+) and S. epidermidis TüsigB (sigB deletion mutant; sigB) were separated on SDS-10% polyacrylamide gels. Zymographic analysis of the gels was carried out on protease or lipase agarose test plates. Arrows indicate the positions of proteolytic or lipolytic bands. The molecular masses (in kilodaltons) of size standard proteins are shown on the left (A) and right (B).

In S. aureus and Bacillus subtilis, ^B modulates expression of several stress and starvation proteins. We carried out heat shock (54°C, 10 min) and salt stress (2 M) studies in B-medium. The wild-type strain and the ^B mutant had similar growth patterns after stress exposure (data not shown). In B. subtilis, the regulatory factor RsbU is essential for full ^B activity under stress conditions but is not required for activation of ^B during the stationary phase (13). The occurrence of natural rsbU mutants of S. aureus harboring an 11-bp deletion has been reported (3, 16, 17), but based on sequence comparisons, rsbU appears to be intact in S. epidermidis Tü3298. Since the signal transduction pathway influencing RsbU expression in bacilli and in staphylococci is not known, we speculate that S. epidermidis Tü3298 might contain a mutation in this pathway, leading to the nonresponsiveness of ^B expression to environmental stress.

In S. epidermidis, biofilm formation and cell aggregation are dependent on the production of the polysaccharide intercellular adhesin (PIA) (18), which is synthesized by the gene products of the ica gene locus. Strain S. epidermidis Tü3298 used in this study lacks the ica genes. This was proven by PCR, Southern blot analysis, and direct chromosomal sequencing (data not shown). Plasmid pCN27 containing the S. epidermidis RP62A ica genes has been shown to lead to the formation of cell clusters and PIA expression in the heterologous host Staphylococcus carnosus (14).

To investigate the impact of ^B in biofilm formation, plasmid pCN27 was introduced into S. epidermidis Tü3298 and S. epidermidis TüsigB. Light microscopy analysis of 16-h cultures of the two strains showed formation of large cell clusters but did not reveal any significant differences in cell aggregation between the two strains. The same result was obtained with cultures that had been exposed to heat or salt stress before growth (data not shown). External stress has been demonstrated to induce biofilm formation in S. aureus (25) and S. epidermidis (26), and the response was shown to depend on functional RsbU (15). The nonresponsiveness of cell aggregation in strain S. epidermidis Tü3298 to the presence or absence of ^B might therefore be explained by a nonfunctional RsbU-mediated signal transduction pathway. Furthermore, as S. epidermidis Tü3298 lacks the ica genes, regulatory elements needed for the control of ica gene expression might also be missing.

To understand a putative regulatory cascade of global regulators in S. epidermidis, we elucidated the role of ^B in agr expression. Staphylococcal delta toxin is encoded within the gene coding for RNAIII, the effector molecule of the agr regulation system. Therefore, quantitative analysis of delta toxin allows the measurement of agr activity in different strains. The delta toxin concentration was directly detected by analytical high-pressure liquid chromatography is the supernatant of S. epidermidis Tü3298 and S. epidermidis Tü3298sigB, as described previously (21). Delta toxin production was measured in five independent stationary-phase cultures of each strain. The amount of delta toxin in the two strains was not significantly different (wild-type strain, 7.6 µg/ml; ^B deletion mutant, 7.0 µg/ml), indicating no direct influence of ^B on agr activity.

Given that ^B regulates sar activity, as has been shown for S. aureus, we cannot rule out that at least some of the alterations reported in this study are caused by reduced transcription of the sar regulatory locus. To understand the regulation of virulence genes in S. epidermidis, it will be important to distinguish the Sar and ^B target genes and to test the virulence of a ^B mutant in an animal model.