Previous Article | Next Article 
Infection and Immunity, February 2001, p. 657-664, Vol. 69, No. 2
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.2.657-664.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Study of Staphylococcus aureus
Pathogenic Genes by Transfer and Expression in the Less Virulent
Organism Streptococcus gordonii
P.
Stutzmann Meier,1
J. M.
Entenza,1
P.
Vaudaux,2
P.
Francioli,1
M. P.
Glauser,1 and
P.
Moreillon1,*
Division of Infectious Diseases, Department
of Internal Medicine Centre Hospitalier Universitaire Vaudois, 1011 Lausanne,1 and Division of Infectious
Diseases, Department of Internal Medicine, Centre Hospitalier
Universitaire de Genève, 1211 Geneva,2
Switzerland
Received 25 May 2000/Returned for modification 9 August
2000/Accepted 1 November 2000
 |
ABSTRACT |
Because Staphylococcus aureus strains contain multiple
virulence factors, studying their pathogenic role by single-gene
inactivation generated equivocal results. To circumvent this problem,
we have expressed specific S. aureus genes in the less
virulent organism Streptococcus gordonii and tested the
recombinants for a gain of function both in vitro and in vivo. Clumping
factor A (ClfA) and coagulase were investigated. Both gene products
were expressed functionally and with similar kinetics during growth by
streptococci and staphylococci. ClfA-positive S. gordonii
was more adherent to platelet-fibrin clots mimicking cardiac
vegetations in vitro and more infective in rats with experimental
endocarditis (P < 0.05). Moreover, deleting
clfA from clfA-positive streptococcal transformants restored both the low in vitro adherence and the low in
vivo infectivity of the parent. Coagulase-positive transformants, on
the other hand, were neither more adherent nor more infective than the
parent. Furthermore, coagulase did not increase the pathogenicity of
clfA-positive streptococci when both clfA and
coa genes were simultaneously expressed in an artificial
minioperon in streptococci. These results definitively attribute a role
for ClfA, but not coagulase, in S. aureus endovascular
infections. This gain-of-function strategy might help solve the role of
individual factors in the complex the S. aureus-host relationship.
 |
INTRODUCTION |
Staphylococcus aureus is
extremely well equipped in both surface adhesins and secreted factors
that mediate tissue colonization and infection (26). The
expression of these factors is orchestrated by the global regulators
agr (accessory gene regulator) (23), sar (staphylococcal accessory regulator), and maybe other
determinants such as sigB (10, 24). Together,
sar and agr promote the expression of adhesins
during exponential growth and the secretion of soluble factors in the
post-exponential growth phase in vitro (8). Moreover, they
were shown to be critical for infectivity in experimental endocarditis
and other models in vivo (5, 7, 18, 36). Thus, S. aureus pathogenesis depends not only on the intrinsic role of each
individual factor but also on their regulated interplay in the
host-parasite relationship.
In such an intricate context, it appeared difficult to analyze
the pathogenic role of individual gene products by classical gene inactivation experiments. For instance, experiments with adhesin-defective mutants suggested that clumping factor A (ClfA) had
only a marginal role in experimental endocarditis (33), whereas coagulase and fibronectin-binding proteins (FnBPs) A and B had
no effect (1, 17, 33). This was in marked contrast with
the visible coagulase activity in vitro and the fact that ClfA and
FnBPs conferred powerful bacterial adherence to host proteins present
in endovascular lesions (19, 31). Another puzzling
observation was made with alpha-hemolysin (encoded by hla)
(3). On the one hand, hla-defective mutants
were less infectious than the parent in experimental endocarditis; on
the other hand, hla overexpression on a multicopy plasmid
also decreased infectivity (3). This indicated that the
hla product could be detrimental either for the host or for
the bacterium, depending on its level of expression. This further
underlined the need for complementary strategies to better understand
the complex S. aureus-host interaction.
Recent developments with the green fluorescence protein reporter system
have helped determine the expression of sar by S. aureus in cardiac vegetations (9). Other strategies
including in vivo expression technology (25, 29) and
signature-tagged mutagenesis (21, 32, 42) became
instrumental for detecting genes that were either overexpressed during
infection or essential for bacterial survival at the infected site.
However, although they should provide information on the dynamic of in
situ gene expression and help reveal new targets for antistaphylococcal compounds, neither of these techniques directly addresses the pathophysiological role of specific determinants in infection.
Here we describe a method of gene transfer that might help to answer
this question. S. aureus pathogenic genes were transferred and expressed in a less virulent surrogate bacterium, and the recombinants were tested for a gain of function. The recipient did not
have the staphylococcal background yet could anchor surface proteins in
a similar way (15, 34). This report presents the successful transfer and expression of the S. aureus clumping
factor A (clfA) and coagulase (coa) genes, either
alone or in tandem, in the recipient Streptococcus gordonii
Challis. The impact of these two determinants on the ability of the
surrogate bacterium to adhere to platelet fibrin clots mimicking
cardiac vegetations in vitro and to produce experimental endocarditis
in rats is analyzed.
 |
MATERIALS AND METHODS |
Microorganisms, plasmids, and reagents.
Bacteria and
plasmids used are listed in Table 1. All
organisms were grown at 37°C. Stocks were kept at
70°C in
nutrient broth supplemented with 10% (vol/vol) glycerol. S. gordonii Challis (39) was grown in brain heart
infusion (BHI; Difco Laboratories, Detroit, Mich. or on BHI
supplemented with 3% blood; S. aureus Newman
(12) was grown in tryptic soy broth (TSB; Difco) or on TSB-agar; and Escherichia coli was grown in Luria-Bertani
(LB) broth or on LB-agar. Erythromycin was used at 5 mg/liter for
streptococci and 500 mg/liter for E. coli; streptomycin was
used at 200 mg/liter; and tetracycline was used at 2 mg/liter.
Antibiotics and human fibrinogen (Sigma Chemical Co., St. Louis, Mo.),
rabbit plasma (bioMérieux, Marcy l'Etoile, France), thrombin
from (Diagnotec, Liestal, Switzerland), and DNA-modifying enzymes from
(Gibco Life Technologies, Gaithersburg, Md.) were used according to the
manufacturer's instructions.
DNA preparation and genetic strategies.
DNA was prepared by
published methods (30, 39). Plasmids were purified using a
Qiagen plasmid midi kit (Qiagen GmbH, Hilden, Germany). Genetic
transformation of S. gordonii Challis was performed as
described elsewhere (39). PCR amplification was carried
out with a GeneAmp PCR system 9700 (Perkin-Elmer, Norwalk, Conn.). The
following S. gordonii recombinants were constructed.
(i) Construction of ClfA-positive S. gordonii.
The S. aureus clfA gene (GenBank accession number Z18852)
(31) was inserted into the streptococcal chromosome by
insertion duplication, using the suicide vector pJDC9 (6)
(Fig. 1A). A copy of clfA lacking its own promoter but
carrying its ribosome-binding site (RBS) was amplified from S. aureus Newman using the forward primer P1 (nucleotides 284 to 306;
CGGAATTCTTAAAAAGAGGGAATAAAATGAA), containing an
EcoRI site (underlined), and the reverse primer P2
(nucleotides 3079 to 3103;
CGCGGATCCTTATTTCTTATCTTTATTTTCTTTT), containing
a BamHI site (underlined). The amplicon was ligated at the
EcoRI/BamHI sites of the suicide vector pJDC9
(pSMI 1 [Table 1]) downstream of random streptococcal DNA fragments
from an EcoRI chromosomal digest. The constructs were
integrated by insertion-duplication into the streptococcal recipient
(Fig. 1A). The transformants were selected for erythromycin resistance
(Emr) and screened both for clfA acquisition by
PCR and for clfA expression by the ability to clump in the
presence of plasma. One Emr and ClfA-positive transformant
was selected for further studies and called SMI 5 (Table 1).
(ii) Deletion of the clfA gene from SMI 5.
To
inactivate the clfA gene in SMI 5 (Fig. 1B), a 5'-end
clfA fragment (nucleotides 284 to 477) was produced using
the forward primer P1 and the reverse primer P3 (nucleotides 457 to
477; CGCGGATCCGAATCATTACTTTTGCTTTCG) containing
a BamHI site (underlined). The fragment was ligated into
pJDC9, generating pSMI 2 (Table 1). pSMI 2 was transformed into SMI 5 and used to delete a large clfA segment by double-crossover recombination as described elsewhere (36) (Fig. 1B).
Clumping-defective mutants were enriched by treating the transformed
cultures with fibrinogen (10 mg/ml) followed by low-speed (400 rpm for
2 min) centrifugation. Nonaggregating bacteria remained in the
supernatant. The loss of clfA was assessed both by PCR and
by Southern blotting. One mutant, called SMI 14, contained a 2-kb
deletion encompassing the two-thirds of the 3' end of the gene.
(iii) Construction of coagulase-positive S. gordonii.
To express coa under the same promoter
as clfA, the suicide vector pSMI 2 was modified to generate
pSMI 7 (Fig. 5A and Table 1). In pSMI 7, the 5'-end clfA
fragment (nucleotides 284 to 477) was followed by a promoterless copy
of coa, carrying its RBS. The coa gene (GenBank
accession number X17679) (37) was amplified from the
S. aureus Newman chromosome, using the forward primer P5
(nucleotides 96 to 118;
CGCGGATCCTGGAGGAATTAAAAAATTATAA), containing a
BamHI site (underlined), and the reverse primer P6
(nucleotides 2004 to 2024);
CGCGGATCCTTATTTTGTTACTCTAGGCCC), also containing a
BamHI site. The BamHI site was used for
appropriate ligation into pSMI 2. pSMI 7 was used to target
coa into the clfA open reading frame (ORF) of a
tetracycline-resistant (Tcr) version of SMI 5 (SMI 17; see
below and Table 1). Insertion-duplication resulted in a
clfA-coa transcriptional fusion as well as a silent promoterless remnant copy of clfA (Fig. 5A). One mutant,
called SMI 24 (Table 1), was further studied.
To perform this experiment, we first changed the SMI 5 ermB
to tetM. This allowed the utilization of a new
Emr marker for further constructs. Allelic replacement of
ermB by tetM was achieved by micro-homology PCR
targeting (2). tetM was amplified from the
transposon Tn916 (GenBank accession number U09422). The
forward primer P7 (nucleotides 11801 to 11822 of Tn916;
TTCT CAAAACTTTTTAACGAGTGAAAAAGTACTCAACCAAAATTGGAGAT TCCTTTACAA)
encompassed nucleotides 133 to 172 of the ermB 5' end
(GenBank accession number M20334); underlined). The reverse primer P8
(nucleotides 14022 to 14042 of Tn916;
CGTGTAACTTTCCAAATTTACAAAAGCGACTCATAGAATCTAAGTTATTTTATTGAACAT) encompassed nucleotides 343 to 379 of the
ermB 3' end (GenBank accession number M20335). The PCR
fragment (2318 bp) was used to transform competent cells of SMI 5, generating SMI 17 (Table 1). PCR was used to confirm that all
constructs had the expected structures.
(iv) Construction of a ClfA and coagulase-positive S. gordonii.
To create a minioperon containing both
clfA and coa in streptococci, the coa
gene was targeted downstream of the far 3' end of clfA (Fig.
5B). A 3'-end fragment of clfA (nucleotides 2861 to 30103)
was produced by using the forward primer P4 (nucleotides 2861 to 2881;
CGGAATTCGACTCAGAAAGTGATTCAAAT) containing an
EcoRI site and as the reverse primer P2 (see above). The
fragment was subcloned at the EcoRI/BamHI site of
the suicide vector pVA891 (27). A coa copy in
the right (5'-3') orientation was then ligated downstream of the
clfA fragment, at the BamHI site, generating pSMI
10 (Table 1). pSMI 10 was used to transform SMI 17 (see above and Table
1). Insertion-duplication resulted in a clfA-coa transcriptional fusion. Since both ORFs were intact, they were both
expressed. In addition, the transformants also contained an additional
silent 3'-end replicate of clfA (Fig. 5B). One mutant, called SMI 28 (Table 1), was further studied.
PCR was used to confirm that all constructs had the expected structures.
Clumping activity, coagulase activity, and adherence to
platelet-fibrin clots.
Ten-microliter aliquots of 50 mM sodium
phosphate buffer (PBS) containing 1010 to 1011
CFU/ml from an overnight culture were mixed with equal volumes of
rabbit plasma or fibrinogen (1 mg/ml). Clumping was assessed either
visually, by the formation of instantaneous clumps when bacteria were
suspended in plasma, or quantitatively as described elsewhere
(20). Surface-bound ClfA was also determined by
fluorescence-activated cell sorter (FACS) analysis, using purified
F(ab')2 fragments from anti-ClfA rabbit polyclonal
immunoglobulin G (kindly provided by T. Foster, Dublin, Ireland).
Bacteria were washed, suspended in PBS containing 10% fetal calf
serum-antibody solution (with 10 mg of antibody/liter), and incubated
for 2 h on ice. The cells were then washed twice with PBS,
suspended in PBS-10% fetal calf serum-antibody solution containing
F(ab')2 fragments of a fluorescein isothiocyanate-labeled
goat anti-rabbit antibody (TAGO, Inc., Burlingame, Calif.), and
incubated for 1 h on ice before washing and FACS analysis.
Coagulase activity was assessed either in whole bacterial cultures (for
qualitative tests) or in culture supernatants (for quantitative tests).
Coagulase activity resulted in the formation of a firm plasma clot and
thus was easy to distinguish from the ClfA activity, which induced
macroscopic bacterial clumping at the bottom of the tubes without clot
formation. For qualitative assessment, equal volumes (150 µl) of
overnight cultures and rabbit plasma were mixed and incubated at
37°C. Coagulation was determined visually after 2, 4, and 24 h.
For quantitative titration, the cultures were centrifuged three
consecutive times (at 12,000 × g for 5 min) to remove
the bacterial cells. The supernatants were then serially diluted with
PBS, and equal volumes of rabbit plasma were added to the tubes. The
reaction was allowed to proceed as above, and the coagulation titer was
expressed as the reciprocal of the highest supernatant dilution
triggering coagulation. Finally, cell-bound coagulase activity
(4) was tested by washing the cells three times in 50 mM
PBS, by centrifugation, before they were resuspended in the same buffer
and tested for qualitatively coagulase activity as above.
Adherence to human platelet-fibrin clots was measured as described
elsewhere (33).
Experimental endocarditis.
Sterile aortic vegetations were
produced in rats as previously described (22). The ability
of bacteria to produce endocarditis was determined in parallel for the
test organisms by inoculating groups of animals with increasing inocula
(103 to 105 CFU) from cultures in the
exponential phase of growth. The rats were killed 12 h after
bacterial challenge. The vegetations were dissected, weighed, and
plated for quantitative cultures. Bacteria containing an antibiotic
resistance marker were plated on both drug-containing and drug-free
agar. Bacterial densities in the vegetations were expressed as mean
log10 CFU per gram of tissue ± standard deviation
(SD). The detection limit was
2 log10 CFU/g of vegetation.
Statistical evaluation.
The frequencies of valve infections
were compared by the
2 test with Yates correction. Mean
vegetation bacterial densities and in vitro adherence ratios were
compared by one-way analysis of variance (ANOVA), and pairwise
differences between the means of groups were determined by t
test using the Bonferroni correction. Differences between groups were
considered significant when P was <0.05 using two-tailed
significance levels.
 |
RESULTS |
Chromosomal integration and functional expression of the S. aureus clfA gene in S. gordonii.
The aim of the
initial experiments was to achieve stable and functional expression of
the staphylococcal clfA gene in S. gordonii. To
ensure stability, the clfA gene was inserted into the
streptococcal chromosome using the suicide vector pJDC9
(Emr) (6), containing a copy of the
clfA gene as depicted in Fig. 1A. Transformants were selected for
Emr and screened for both integration and expression of
clfA by PCR and spontaneous clumping in plasma,
respectively.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 1.
Insertion and inactivation of clfA in the
S. gordonii chromosome. (A) For insertion, a promoterless
clfA copy (black boxes) containing both its RBS and its stop
codon was ligated into the suicide vector pJDC9 (6)
downstream of random pieces of S. gordonii chromosomal
fragments (gray boxes). The constructs were transformed into parent
streptococci and integrated by single-crossover homologous
recombination. Recombinants were selected for Emr and
screened for insertion and expression of clfA. (B) For
clfA deletion, a 5'-end fragment of the gene was ligated
into pJDC9, generating pSMI 2, and the construct used to transform the
clfA-positive recombinant SMI 5. Deletion was obtained by
double-crossover recombination as described elsewhere
(38). The mutant SMI 14 (Table 1) contain a 2-kb internal
deletion of clfA, as assessed both by PCR and by Southern
blot.
|
|
The rate of transformation to Emr was ca.
10
7. In a typical experiment, all of 13 Emr
transformants carried a copy of the clfA gene, and 5 (38%)
of them expressed ClfA to various degrees. Figure
2 indicates that bacterial clumping in
the presence of plasma correlated with ClfA surface expression as
determined by FACS analysis.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 2.
Macroscopic clumping and FACS analysis of S. aureus Newman and S. gordonii producing or not
producing ClfA. Macroscopic clumping was assessed by mixing bacteria
with 10 µl of rabbit plasma on a glass slide. FACS analysis was
performed with both irrelevant antibodies (gray area) or purified
anti-ClfA F(ab')2 fragments (white area) as described in
Materials and Methods. Clumping and FACS shifts were clearly observed
both in S. aureus and in the strong ClfA-producing
recombinant SMI 5. In contrast, no clumping or FACS shift was observed
in the S. gordonii parent, and only moderate clumping and
FACS shift were present in the low ClfA-producing recombinant SMI 3.
|
|
SMI 5 (Table 1) was selected for further experiments. In this organism,
integration of heterologous DNA did not alter the growth rate in vitro,
and both Emr and ClfA were stable for up to five
consecutive passages (ca. 35 generation times) in drug-free medium.
Table 2 and Fig.
3 indicate that expression of surface
ClfA was comparable between SMI 5 and S. aureus Newman, both
in terms of titer (Table 2) and as determined by FACS analysis (Fig.
3). Figure 3B indicates that the kinetics of ClfA expression were
similar in S. aureus Newman and the ClfA-positive
recombinant SMI 5. This was critical for the relevance of the model, as
ClfA production by S. gordonii should mimic that of
staphylococci.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Clumping and coagulase titers of S. aureus
Newman and S. gordonii expressing or not expressing ClfA and
coagulase
|
|

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
Bacterial growth (A), production of ClfA (B), and
production of coagulase titration (C) as a function of time for
S. aureus Newman (dotted lines), the ClfA-positive
recombinant S. gordonii SMI 5 (diamonds), and the
coagulase-positive recombinant SMI 24 (squares). (A) Bacterial growth
was followed by the optical density at 620 nm (OD620) of
the cultures. At various times, samples were removed and processed
either for FACS analysis (B) or for coagulase titration (C). FACS
analysis was performed with either anti-ClfA (open symbols) or
irrelevant (closed symbols) F(ab')2 fragments, using
bacterial samples containing 106 CFU/ml. Controls using
coagulase-positive (but ClfA-negative) S. gordonii were
negative by FACS and are not represented. Determination of coagulase
titers is indicated by the highest twofold dilution of the culture
supernatants triggering coagulation of rabbit plasma after 24 h of
incubation at 37°C. Coagulase activity was expressed as a function of
bacterial densities in the cultures by dividing the measured
coagulation titer by the number of CFU (106) in the
culture.
|
|
Finally, examination of parent and mutant cells by phase-contrast
microscopy indicates that the two organisms formed similar short chains
of 2 to 10 individuals. This was important for the preparation of
bacterial inocula in further experiments. Indeed, variations in
bacterial chaining may result in misinterpretation of viable counts
when assessed by CFU enumeration of agar plates.
In vitro adherence and in vivo infectivity of ClfA-negative and
ClfA-positive S. gordonii transformants.
The
clfA-positive SMI 5 recombinant was
5 times more adherent
than the ClfA-negative parent in vitro (P < 0.05,
compared by one-way ANOVA and by the t test using the
Bonferroni correction) (Fig. 4A).
Moreover, when the clfA determinant of SMI 5 was deleted (Fig. 1B), adherence of the
clfA construct SMI 14 (Table
1) had returned to that of the parent strain.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 4.
In vitro adherence (A) and in vivo infectivity (B) of
the ClfA-negative parent S. gordonii, the ClfA-positive
recombinant SMI 5, and its ClfA-negative ( clfA) mutant
SMI 14. In vitro adherence was performed as described elsewhere
(33). Data points indicate the mean ± SD adherence
ratios of 12 to 24 individual determinations for each isolates. The
adherence ratios of the ClfA-positive SMI 5 were significantly greater
than that of either the parent or the clfA mutant SMI 14 (P < 0.05, as determined by one-way ANOVA and pairwise
comparisons using the t test with Bonferroni correction).
For in vivo infection, each dot represents the vegetation bacterial
density in one rat killed 12 h after bacterial challenge.
Densities of less than 2 log10 CFU/g of vegetation were
below detection limit and are indicated below the columns. The SMI 5 transformant was significantly more infective than the two comparative
isolates (P < 0.05, as determined by the
2 test with Yates correction).
|
|
Parent and SMI 5 and
clfA SMI 14 mutant strains were
further tested for the ability to infect rats with catheter-induced aortic vegetations (14, 33). Groups of animals were
inoculated in parallel with similar numbers of CFU of each of the test
organisms. Figure 4B depicts the frequency and severity of valve
infection in rats challenged with 104 CFU, an inoculum that
reproducibly infected 20 to 30% of animals challenged with the parent
cells (33). In these experiments, the differences between
the ClfA-positive mutant SMI 5 and either the ClfA-negative parent or
the ClfA-negative mutant SMI 14 were statistically significant
(P < 0.05, compared by the
2 test with
Yates correction). All ClfA-positive streptococci recovered from the
valves had retained the Emr marker.
At a lower inoculum (103 CFU), none of nine animals
challenged with the parent became infected and only two (22%) of the
nine challenged with SMI 5 developed endocarditis (P > 0.05). At a higher inoculum (105 CFU), on the other
hand, both the parent and the SMI 5 recombinant infected all rats (five
of five and six of six, respectively). Thus, although ClfA production
clearly increased infectivity, the difference was confined to a
specific range of inoculum sizes.
Rats that developed endocarditis had similar vegetation bacterial
densities at the time of sacrifice (5.79 ± 0.71 [n = 8], 5.18 ± 1.53 [n = 20], and 5.72 ± 1.03 [n = 10] log10 CFU/g of tissue
[mean ± SD] for S. gordonii [ClfA
Coa
], SMI5 [ClfA+ Coa
], and
SMI 28 [ClfA+ Coa+], respectively),
irrespective of the infecting organisms. This suggested that once in
the vegetation milieu, parent and SMI 5 cells grew at similar rates.
Therefore, ClfA was likely to operate at an early step of infection,
e.g., during attachment and colonization of the damaged valves.
In vitro adherence and in vivo infectivity of coagulase-positive
S. gordonii recombinants.
A shuttle system was
developed to deliver the coa gene under the same promoter as
clfA (Fig. 5A). This was
important to avoid additional genetic alterations in the mutants. One
stable coagulase-positive and clfA-negative transformant
(SMI 24 [Tables 1 and 2]) was characterized. Production of coagulase
in the culture supernatant was similar to that of S. aureus
Newman in terms of both titers and kinetics (Table 2 and Fig. 3C).
Moreover, like S. aureus, SMI 24 produced both secreted and
surface-bound coagulase (4) (data not presented). However,
coagulase increased neither in vitro adherence nor in vivo infectivity
in rats killed at 12 h (Fig. 6).
Moreover, in one experiment testing the effect of coagulase on later
infection, i.e., in animals killed at 5 days, coagulase did not
increase vegetation bacterial density over that of the parent cells.
Paradoxically, it even tended to decrease it. At day 5, vegetation
bacterial titers (mean ± SD CFU/gram of vegetations) were
8.27 ± 2.05 in seven rats inoculated with the parent, compared to
6.58 ± 2.04 in eight rats infected with the coagulase-positive mutant SMI 24 (P = 0.03, compared by the Student
t test).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 5.
Strategies used to create clfA-coa
transcriptional fusion to express coa either alone (A) or
together with clfA in an artificial minioperon (B). The
ClfA-positive and Tcr mutant SMI 17 was used as a
recipient. (A) The pSMI 7 suicide vector carrying
clfA::coa fusion was transformed into
SMI 17. Transformants were selected for Emr-Tcr
double resistance and screened for both the acquisition of coagulase
activity and the loss of clumping ability. (B) To generate a
clfA-coa minioperon, the same promoterless coa
amplicon was inserted downstream of a short 3'-end clfA
stretch into the suicide vector pVA891 marker (27) (pSMI
10 [Table 1]). This allowed targeting the recombinant vector
downstream of the SMI 17 clfA ORF, positioning
coa just after the clfA stop codon. Transformants
were selected for Emr-Tcr and screened for the
coexpression of both clumping and coagulase activities.
|
|

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 6.
In vitro adherence (A) and in vivo infectivity (B) of
the coagulase-negative parent S. gordonii and its
coagulase-positive transformant SMI 24. The coagulase-positive SMI 24 transformant isolate was neither more adherent to platelet-fibrin
matrices (P < 0.05) nor more infective rats with
experimental endocarditis (P < 0.05) than the parent
S. gordonii. Details are as for Fig. 4.
|
|
Infectivity of ClfA and coagulase double-positive transformants of
S. gordonii.
The final objective of these experiments
was to test whether coexpression of ClfA and coagulase might affect
pathogenesis. An artificial clfA-coa operon was constructed
in S. gordonii as illustrated in Fig. 5B. Seven (50%) of
fourteen transformants carrying the appropriate antibiotic markers
(Emr-Tcr) expressed both clumping and coagulase
activity. One stable transformant was analyzed for quantitative results
(SMI 28 [Table 1]) and produced similar ClfA and coagulase titers
similar to those for S. aureus (Table 2). Figure
7 indicates that the mutant was also significantly more adherent and infective than the parent S. gordonii (P < 0.05 for both). However, it was not
more adherent or infective than SMI 5, expressing ClfA alone.
Therefore, coexpression of ClfA and Coa did not increase the
infectivity over that of single clfA-positive transformants.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 7.
In vitro adherence (A) and in vivo infectivity (B) of
the parent S. gordonii, its ClfA+ transformant
SMI 5, and its ClfA+ Coa+ derivative SMI 28 (Tables 1 and 2). Both SMI 5 and SMI 28 (Table 1 and 2) were
significantly more adherent (P < 0.05) and infective
(P < 0.05) than the parent strain but did not behave
differently from each other (P < 0.05 for both in
vitro adherence and in vivo infectivity), indicating that coagulase did
not add to the pathological effect of ClfA. Details are as for Fig.
4.
|
|
 |
DISCUSSION |
The goal of this work was to develop a model of adoptive
pathogenesis to study single or multiple staphylococcal pathogenic factors expressed in a surrogate bacterium lacking the whole S. aureus pathogenic background. The results indicated that both staphylococcal ClfA and coagulase could be functionally expressed by
S. gordonii. Moreover, they clearly confirmed a role for
ClfA, but not coagulase, in the pathogenesis of experimental S. aureus endocarditis in vivo (1, 33). Recombinant
streptococci expressing ClfA had a gain in adherence to platelet-fibrin
clots in vitro as well as in infectivity in vivo. Moreover, this
positive effect was lost when the clfA insert was deleted
from the streptococcal recombinants.
This was reminiscent of experiments with the
clfA-inactivated S. aureus Newman, where deletion
and complementation of the clfA gene resulted in marginal
differences in the infective doses in rats with experimental
endocarditis (33). In these experiments, the limited
impact of clfA deletion was attributed to the redundancy of
surface adhesins, including the recently described ClfB
(35), FnBPs (16), and other determinants that
might mediate adherence to endovascular lesions. Therefore, the
potential contribution of ClfA could not clearly be defined. The
present study on the other hand, provided a positive finding in this
regard, demonstrating that expression of clfA by a naive and
unrelated organism conferred a significant increase in both adherence
and infectivity to the surrogate bacterium. Thus, the results of these
two complementary approaches identify ClfA as one major staphylococcal
factor mediating endovascular attachment and infection.
A second determinant that might be an important S. aureus
pathogenic factor is coagulase (26, 37, 41). However, the exact role of coagulase in staphylococcal infection has not been established. Coagulase was shown to increase virulence in a murine model of mammary abscess (37) and pulmonary infection
(41), but to have no effect on experimental endocarditis
(1, 33). This lack of effect was further demonstrated in
the present study. Recombinant S. gordonii produced both
surface-bound and secreted coagulase at levels similar to those
produced by S. aureus Newman. It was surprising that the
impressive blood clotting triggered in vitro by either
coagulase-producing staphylococci or recombinant streptococci did not
result in some increased virulence in the vegetations. Moreover, in the
present study this was true for animals killed early (at 12 h) or
later (5 days) after inoculation, indicating that coagulase did not
influence late infection either. Therefore, the role of this second
determinant in endocarditis remains undetermined.
Finally, the concurrent expression of ClfA and coagulase in S. gordonii did not increase in vitro adherence and in vivo
infectivity over that of single ClfA-positive recombinants. This was
again reminiscent of the staphylococcal situation, where double
deletion of the ClfA and coagulase determinants did not decrease
infectivity more profoundly than in mutants carrying a single
clfA deletion alone. In this study ClfA and coagulase were
expressed in comparable amounts by S. aureus Newman and the
surrogate streptococci. Moreover, the kinetics of production during
bacterial growth indicated that the two factors were simultaneously
present on the cell surface. Therefore, the lack of synergism between
ClfA and coagulase in experimental endocarditis indicates that
molecular cooperation implicating these determinants was not a
pathogenic mechanism in the present model of infection.
In conclusion, the present study describes a genetic technique that may
help dissect the role of putative gram-positive virulence factors by
reconstituting them in a less pathogenic organism. In similar types of
experiments, Salmonella genes transferred into E. coli helped to identify factors involved in both adherence and
invasion of the host (11, 13). Thus, such an adoptive (gain-of-function) strategy may be an indispensable corollary of
classical knockout mutagenesis, which always carries the risk of
underestimating the effect of a given deletion on the expression of
other pathogenic determinants or on nonspecific bacterial fitness. The
present results indicate that individual and concurrent expression of
two proteins that were thought to be important virulence determinants in staphylococci could be achieved in S. gordonii.
The genetic techniques demonstrate the feasibility of the concept and
open the possibility for more sophistication. Expression of genes
integrated into the chromosome may be more stable and reliable than
determinants cloned in multicopy plasmids. On the other hand, the
development of expression vectors and in bacteria less pathogenic than
S. gordonii, such as lactococci (40), may allow
more flexibility in gene cloning and expression. Considering the
complexity of pathogenic gene regulation in S. aureus,
adoptive pathogenesis might become a standard complementary test to
identify the important factors.
 |
ACKNOWLEDGMENTS |
This work was supported by grants 3200-47099.96 and
3200-0458.95/2 from the Swiss National Funds for Scientific Research.
We thank Marlyse Giddey, Jacques Vouillamoz, and Patrice François
for outstanding technical support.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Infectious Diseases, CHUV-BH19, 1011 Lausanne, Switzerland. Phone:
41-21-314.10.25. Fax: 41-21-314.10.36. E-mail:
Philippe.Moreillon{at}chuv.hospvd.ch.
Editor:
V. J. DiRita
 |
REFERENCES |
| 1.
|
Baddour, L. M.,
M. M. Tayidi, and T. J. Foster.
1994.
Virulence of coagulase-deficient mutants of Staphylococcus aureus in experimental endocarditis.
J. Med. Microbiol.
41:259-263[Abstract].
|
| 2.
|
Baudin, A.,
O. Ozier-Kalogeropoulos,
A. Denouel,
F. Lacroute, and C. Cullin.
1993.
A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae.
Nucleic Acids Res.
21:3329-3330[Free Full Text].
|
| 3.
|
Bayer, A. S.,
M. D. Ramos,
B. E. Menzies,
M. R. Yeaman,
A. J. Shen, and A. L. Cheung.
1997.
Hyperproduction of alpha-toxin by Staphylococcus aureus results in paradoxically reduced virulence in experimental endocarditis: a host defense role for platelet microbicidal proteins.
Infect. Immun.
65:4652-4660[Abstract].
|
| 4.
|
Boden, M. K., and J. I. Flock.
1989.
Fibrinogen-binding protein/clumping factor from Staphylococcus aureus.
Infect. Immun.
57:2358-2363[Abstract/Free Full Text].
|
| 5.
|
Booth, M. C.,
R. V. Atkuri,
S. K. Nanda,
J. J. Iandolo, and M. S. Gilmore.
1995.
Accessory gene regulator controls Staphylococcus aureus virulence in endophthalmitis.
Investig. Ophthalmol. Visual Sci.
36:1828-1836[Abstract/Free Full Text].
|
| 6.
|
Chen, J. D., and D. A. Morrison.
1988.
Construction and properties of a new insertion vector, pJDC9, that is protected by transcriptional terminators and useful for cloning of DNA from Streptococcus pneumoniae.
Gene
64:155-164[CrossRef][Medline].
|
| 7.
|
Cheung, A. L.,
K. J. Eberhardt,
E. Chung,
M. R. Yeaman,
P. M. Sullam,
M. Ramos, and A. S. Bayer.
1994.
Diminished virulence of a sar lagr mutant of Staphylococcus aureus in the rabbit model of endocarditis.
J. Clin. Investig.
94:1815-1822.
|
| 8.
|
Cheung, A. L.,
J. M. Koomey,
C. A. Butler,
S. J. Projan, and V. A. Fischetti.
1992.
Regulation of exoprotein expression in Staphylococcus aureus by a locus (sar) distinct from agr.
Proc. Natl. Acad. Sci. USA
89:6462-6466[Abstract/Free Full Text].
|
| 9.
|
Cheung, A. L.,
C. C. Nast, and A. S. Bayer.
1998.
Selective activation of sar promoters with the use of green fluorescent protein transcriptional fusions as the detection system in the rabbit endocarditis model.
Infect. Immun.
66:5988-5993[Abstract/Free Full Text].
|
| 10.
|
Cheung, A. L., and S. J. Projan.
1994.
Cloning and sequencing of sarA of Staphylococcus aureus, a gene required for the expression of agr.
J. Bacteriol.
176:4168-4172[Abstract/Free Full Text].
|
| 11.
|
Crago, A. M., and V. Koronakis.
1999.
Binding of extracellular matrix laminin to Escherichia coli expressing the Salmonella outer membrane proteins Rck and PagC.
FEMS Microbiol. Lett.
176:495-501[CrossRef][Medline].
|
| 12.
|
Duthie, E. S., and L. L. Lorenz.
1952.
Staphylococcal coagulase: mode of action and antigenicity.
J. Gen. Microbiol.
6:95-107[Medline].
|
| 13.
|
Elsinghorst, E. A.,
L. S. Baron, and D. J. Kopecko.
1989.
Penetration of human intestinal epithelial cells by Salmonella: molecular cloning and expression of Salmonella typhi invasion determinants in Escherichia coli.
Proc. Natl. Acad. Sci. USA
86:5173-5177[Abstract/Free Full Text].
|
| 14.
|
Entenza, J. M.,
I. Caldelari,
M. P. Glauser,
P. Francioli, and P. Moreillon.
1997.
Importance of genotypic and phenotypic tolerance in the treatment of experimental endocarditis due to Streptococcus gordonii.
J. Infect. Dis.
175:70-76[Medline].
|
| 15.
|
Fischetti, V. A.,
V. Pancholi, and O. Schneewind.
1990.
Conservation of a hexapeptide sequence in the anchor region of surface proteins from gram-positive cocci.
Mol. Microbiol.
4:1603-1605[Medline].
|
| 16.
|
Flock, J. I.,
G. Froman,
K. Jonsson,
B. Guss,
C. Signas,
B. Nilsson,
G. Raucci,
M. Hook,
T. Wadstrom, and M. Lindberg.
1987.
Cloning and expression of the gene for a fibronectin-binding protein from Staphylococcus aureus.
EMBO J.
6:2351-2357[Medline].
|
| 17.
|
Flock, J. I.,
S. A. Hienz,
A. Heimdahl, and T. Schennings.
1996.
Reconsideration of the role of fibronectin binding in endocarditis caused by Staphylococcus aureus.
Infect. Immun.
64:1876-1878[Abstract].
|
| 18.
|
Gillaspy, A. F.,
S. G. Hickmon,
R. A. Skinner,
J. R. Thomas,
C. L. Nelson, and M. S. Smeltzer.
1995.
Role of the accessory gene regulator (agr) in pathogenesis of staphylococcal osteomyelitis.
Infect. Immun.
63:3373-3380[Abstract].
|
| 19.
|
Greene, C.,
D. McDevitt,
P. Francois,
P. E. Vaudaux,
D. P. Lew, and T. J. Foster.
1995.
Adhesion properties of mutants of Staphylococcus aureus defective in fibronectin-binding proteins and studies on the expression of fnb genes.
Mol. Microbiol.
17:1143-1152[CrossRef][Medline].
|
| 20.
|
Hawiger, J.,
D. K. Hammond,
S. Timmons, and A. Z. Budzynski.
1978.
Interaction of human fibrinogen with staphylococci: presence of a binding region on normal and abnormal fibrinogen variants and fibrinogen derivatives.
Blood
51:799-812[Free Full Text].
|
| 21.
|
Hensel, M.,
J. E. Shea,
C. Gleeson,
M. D. Jones,
E. Dalton, and D. W. Holden.
1995.
Simultaneous identification of bacterial virulence genes by negative selection.
Science
269:400-403[Abstract/Free Full Text].
|
| 22.
|
Heraief, E.,
M. P. Glauser, and L. R. Freedman.
1982.
Natural history of aortic-valve endocarditis in rats.
Infect. Immun.
37:127-131[Abstract/Free Full Text].
|
| 23.
|
Kornblum, J.,
B. N. Kreiswirth,
S. J. Projan,
H. Ross, and R. P. Novick.
1990.
Agr: a polycistronic locus regulating exoprotein synthesis in Staphylococcus aureus, p. 373-402.
In
R. P. Novick (ed.), Molecular biology of the staphylococci. VCH, New York, N.Y.
|
| 24.
|
Kullik, I., and P. Giachino.
1997.
The alternative sigma factor sigmaB in Staphylococcus aureus: regulation of the sigB operon in response to growth phase and heat shock.
Arch. Microbiol.
167:151-159[CrossRef][Medline].
|
| 25.
|
Lowe, A. M.,
D. T. Beattie, and R. L. Deresiewicz.
1998.
Identification of novel staphylococcal virulence genes by in vivo expression technology.
Mol. Microbiol.
27:967-976[CrossRef][Medline].
|
| 26.
|
Lowy, F. D.
1998.
Staphylococcus aureus infections.
N. Engl. J. Med.
339:520-532[Free Full Text].
|
| 27.
|
Macrina, F. L.,
R. P. Evans,
J. A. Tobian,
D. L. Hartley,
D. B. Clewell, and K. R. Jones.
1983.
Novel shuttle plasmid vehicles for Escherichia-Streptococcus transgeneric cloning.
Gene
25:145-150[CrossRef][Medline].
|
| 28.
|
Macrina, F. L.,
P. H. Wood, and K. R. Jones.
1980.
Genetic transformation of Streptococcus sanguis (Challis) with cryptic plasmids from Streptococcus ferus.
Infect. Immun.
28:692-699[Abstract/Free Full Text].
|
| 29.
|
Mahan, M. J.,
J. M. Slauch, and J. J. Mekalanos.
1993.
Selection of bacterial virulence genes that are specifically induced in host tissues.
Science
259:686-688[Abstract].
|
| 30.
|
Marmur, J.
1961.
A procedure for isolation of desoxyribonucleic acid from microorganisms.
J. Mol. Biol.
3:208-218.
|
| 31.
|
McDevitt, D.,
P. François,
P. Vaudaux, and T. J. Foster.
1994.
Molecular characterization of the clumping factor (fibrinogen receptor) of Staphylococcus aureus.
Mol. Microbiol.
11:237-248[Medline].
|
| 32.
|
Mei, J. M.,
F. Nourbakhsh,
C. W. Ford, and D. W. Holden.
1997.
Identification of Staphylococcus aureus virulence genes in a murine model of bacteraemia using signature-tagged mutagenesis.
Mol. Microbiol.
26:399-407[CrossRef][Medline].
|
| 33.
|
Moreillon, P.,
J. M. Entenza,
P. Francioli,
D. McDevitt,
T. J. Foster,
P. François, and P. Vaudaux.
1995.
Role of Staphylococcus aureus coagulase and clumping factor in the pathogenesis of experimental endocarditis.
Infect. Immun.
63:4738-4743[Abstract].
|
| 34.
|
Navarre, W. W., and O. Schneewind.
1999.
Surface proteins of gram-positive bacteria and mechanisms of their targeting to the cell wall envelope.
Microbiol. Mol. Biol. Rev.
63:174-229[Abstract/Free Full Text].
|
| 35.
|
Ni, E. D.,
S. Perkins,
P. Francois,
P. Vaudaux,
M. Hook, and T. J. Foster.
1998.
Clumping factor B (ClfB), a new surface-located fibrinogen-binding adhesin of Staphylococcus aureus.
Mol. Microbiol.
30:245-257[CrossRef][Medline].
|
| 36.
|
Nilsson, I. M.,
T. Bremell,
C. Ryden,
A. L. Cheung, and A. Tarkowski.
1996.
Role of the staphylococcal accessory gene regulator (sar) in septic arthritis.
Infect. Immun.
64:4438-4443[Abstract].
|
| 37.
|
Phonimdaeng, P.,
M. O'Reilly,
P. Nowlan,
A. J. Bramley, and T. J. Foster.
1990.
The coagulase of Staphylococcus aureus 8325-4. Sequence analysis and virulence of site-specific coagulase-deficient mutants.
Mol. Microbiol.
4:393-404[Medline].
|
| 38.
|
Pozzi, G., and W. R. Guild.
1985.
Modes of integration of heterologous plasmid DNA into the chromosome of Streptococcus pneumoniae.
J. Bacteriol.
161:909-912[Abstract/Free Full Text].
|
| 39.
|
Pozzi, G.,
R. A. Musmanno,
P. M. Lievens,
M. R. Oggioni,
P. Plevani, and R. Manganelli.
1990.
Method and parameters for genetic transformation of Streptococcus sanguis Challis.
Res. Microbiol.
141:659-670[Medline].
|
| 40.
|
Que, Y.-A.,
J.-A. Haefliger,
P. Francioli, and P. Moreillon.
2000.
Expression of Staphylococcus aureus clumping factor A in Lactococcus lactis subsp. cremoris using a new shuttle vector.
Infect. Immun.
68:3516-3522[Abstract/Free Full Text].
|
| 41.
|
Sawai, T.,
K. Tomono,
K. Yanagihara,
Y. Yamamoto,
M. Kaku,
Y. Hirakata,
H. Koga,
T. Tashiro, and S. Kohno.
1997.
Role of coagulase in a murine model of hematogenous pulmonary infection induced by intravenous injection of Staphylococcus aureus enmeshed in agar beads.
Infect. Immun.
65:466-471[Abstract].
|
| 42.
|
Schwan, W. R.,
S. N. Coulter,
E. Y. Ng,
M. H. Langhorne,
H. D. Ritchie,
L. L. Brody,
S. Westbrock-Wadman,
A. S. Bayer,
K. R. Folger, and C. K. Stover.
1998.
Identification and characterization of the PutP proline permease that contributes to in vivo survival of Staphylococcus aureus in animal models.
Infect. Immun.
66:567-572[Abstract/Free Full Text].
|
Infection and Immunity, February 2001, p. 657-664, Vol. 69, No. 2
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.2.657-664.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Vankerckhoven, V., Moreillon, P., Piu, S., Giddey, M., Huys, G., Vancanneyt, M., Goossens, H., Entenza, J. M.
(2007). Infectivity of Lactobacillus rhamnosus and Lactobacillus paracasei isolates in a rat model of experimental endocarditis. J Med Microbiol
56: 1017-1024
[Abstract]
[Full Text]
-
Bizzini, A., Majcherczyk, P., Beggah-Moller, S., Soldo, B., Entenza, J. M., Gaillard, M., Moreillon, P., Lazarevic, V.
(2007). Effects of {alpha}-phosphoglucomutase deficiency on cell wall properties and fitness in Streptococcus gordonii. Microbiology
153: 490-498
[Abstract]
[Full Text]
-
Domanski, P. J., Patel, P. R., Bayer, A. S., Zhang, L., Hall, A. E., Syribeys, P. J., Gorovits, E. L., Bryant, D., Vernachio, J. H., Hutchins, J. T., Patti, J. M.
(2005). Characterization of a Humanized Monoclonal Antibody Recognizing Clumping Factor A Expressed by Staphylococcus aureus. Infect. Immun.
73: 5229-5232
[Abstract]
[Full Text]
-
Que, Y.-A., Haefliger, J.-A., Piroth, L., Francois, P., Widmer, E., Entenza, J. M., Sinha, B., Herrmann, M., Francioli, P., Vaudaux, P., Moreillon, P.
(2005). Fibrinogen and fibronectin binding cooperate for valve infection and invasion in Staphylococcus aureus experimental endocarditis. J. Exp. Med.
201: 1627-1635
[Abstract]
[Full Text]
-
Reilley, S., Wenzel, E., Reynolds, L., Bennett, B., Patti, J. M., Hetherington, S.
(2005). Open-Label, Dose Escalation Study of the Safety and Pharmacokinetic Profile of Tefibazumab in Healthy Volunteers. Antimicrob. Agents Chemother.
49: 959-962
[Abstract]
[Full Text]
-
Entenza, J.-M., Moreillon, P., Senn, M. M., Kormanec, J., Dunman, P. M., Berger-Bachi, B., Projan, S., Bischoff, M.
(2005). Role of {sigma}B in the Expression of Staphylococcus aureus Cell Wall Adhesins ClfA and FnbA and Contribution to Infectivity in a Rat Model of Experimental Endocarditis. Infect. Immun.
73: 990-998
[Abstract]
[Full Text]
-
Pietrocola, G., Schubert, A., Visai, L., Torti, M., Fitzgerald, J. R., Foster, T. J., Reinscheid, D. J., Speziale, P.
(2005). FbsA, a fibrinogen-binding protein from Streptococcus agalactiae, mediates platelet aggregation. Blood
105: 1052-1059
[Abstract]
[Full Text]
-
Hall, A. E., Domanski, P. J., Patel, P. R., Vernachio, J. H., Syribeys, P. J., Gorovits, E. L., Johnson, M. A., Ross, J. M., Hutchins, J. T., Patti, J. M.
(2003). Characterization of a Protective Monoclonal Antibody Recognizing Staphylococcus aureus MSCRAMM Protein Clumping Factor A. Infect. Immun.
71: 6864-6870
[Abstract]
[Full Text]
-
Vernachio, J., Bayer, A. S., Le, T., Chai, Y.-L., Prater, B., Schneider, A., Ames, B., Syribeys, P., Robbins, J., Patti, J. M.
(2003). Anti-Clumping Factor A Immunoglobulin Reduces the Duration of Methicillin-Resistant Staphylococcus aureus Bacteremia in an Experimental Model of Infective Endocarditis. Antimicrob. Agents Chemother.
47: 3400-3406
[Abstract]
[Full Text]
-
Clarke, S. R., Harris, L. G., Richards, R. G., Foster, S. J.
(2002). Analysis of Ebh, a 1.1-Megadalton Cell Wall-Associated Fibronectin-Binding Protein of Staphylococcus aureus. Infect. Immun.
70: 6680-6687
[Abstract]
[Full Text]
-
Massey, R. C., Dissanayeke, S. R., Cameron, B., Ferguson, D., Foster, T. J., Peacock, S. J.
(2002). Functional Blocking of Staphylococcus aureus Adhesins following Growth in Ex Vivo Media. Infect. Immun.
70: 5339-5345
[Abstract]
[Full Text]
-
Wolz, C., Goerke, C., Landmann, R., Zimmerli, W., Fluckiger, U.
(2002). Transcription of Clumping Factor A in Attached and Unattached Staphylococcus aureus In Vitro and during Device-Related Infection. Infect. Immun.
70: 2758-2762
[Abstract]
[Full Text]
-
Hussain, M., Becker, K., von Eiff, C., Schrenzel, J., Peters, G., Herrmann, M.
(2001). Identification and Characterization of a Novel 38.5-Kilodalton Cell Surface Protein of Staphylococcus aureus with Extended-Spectrum Binding Activity for Extracellular Matrix and Plasma Proteins. J. Bacteriol.
183: 6778-6786
[Abstract]
[Full Text]
-
Que, Y.-A., Francois, P., Haefliger, J.-A., Entenza, J.-M., Vaudaux, P., Moreillon, P.
(2001). Reassessing the Role of Staphylococcus aureus Clumping Factor and Fibronectin-Binding Protein by Expression in Lactococcus lactis. Infect. Immun.
69: 6296-6302
[Abstract]
[Full Text]
-
Davis, S. L., Gurusiddappa, S., McCrea, K. W., Perkins, S., Hook, M.
(2001). SdrG, a Fibrinogen-binding Bacterial Adhesin of the Microbial Surface Components Recognizing Adhesive Matrix Molecules Subfamily from Staphylococcus epidermidis, Targets the Thrombin Cleavage Site in the Bbeta Chain. J. Biol. Chem.
276: 27799-27805
[Abstract]
[Full Text]