Previous Article | Next Article 
Infection and Immunity, February 2001, p. 730-736, Vol. 69, No. 2
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.2.730-736.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Vacuolating Cytotoxin of Helicobacter
pylori Plays a Role during Colonization in a Mouse Model of
Infection
Nina R.
Salama,1,*
Glen
Otto,2
Lucy
Tompkins,1 and
Stanley
Falkow1
Department of Microbiology and
Immunology1 and Department of
Comparative Medicine,2 Stanford University
School of Medicine, Stanford, California 94305
Received 23 August 2000/Returned for modification 18 October
2000/Accepted 8 November 2000
 |
ABSTRACT |
Helicobacter pylori, the causative agent of gastritis
and ulcer disease in humans, secretes a toxin called VacA (vacuolating cytotoxin) into culture supernatants. VacA was initially characterized and purified on the basis of its ability to induce the formation of
intracellular vacuoles in tissue culture cells. H. pylori
strains possessing different alleles of vacA differ in
their ability to express active toxin. Those strains expressing higher
toxin levels are correlated with more severe gastric disease. However,
the specific role(s) played by VacA during the course of infection and
disease is not clear. We have used a mouse model of H. pylori infection to begin to address this role. A null mutation
of vacA compromises H. pylori in its ability to
initially establish infection. If an infection by a vacA
mutant is established, the bacterial load and degree of inflammation
are similar to those associated with an isogenic wild-type strain.
Thus, in this infection model, vacA plays a role in the
initial colonization of the host, suggesting that strains of H. pylori expressing active alleles of vacA may be
better adapted for host-to-host transmission.
 |
INTRODUCTION |
Helicobacter pylori
infection of the human stomach can result in a broad spectrum of
disease outcomes ranging from mild gastritis to severe ulcers
(8). Additionally, H. pylori is associated with
two types of cancer: gastric lymphoid tissue-associated B-cell lymphoma
(32, 34) and gastric adenocarcinoma (25). The
disease outcome in each infected individual appears to be determined by a combination of host and bacterial factors. The genotypes of H. pylori clinical isolates vary in many genetic loci, including the
presence or absence of a pathogenicity island (1, 5) and
allelic variation of the vacuolating cytotoxin gene (vacA) (2) and genes encoding adhesion molecules such as BabA2,
which binds the Lewisb fucosylated moiety found on human
gastric tissue (16). Epidemiological studies suggest that
strains expressing the pathogenicity island, those expressing high
levels of VacA, and those expressing functional BabA2 correlate with
more severe disease (8, 13).
VacA enters eukaryotic cells and exerts its action in the cytoplasm
(9, 12). VacA recently was shown to form
chloride-conducting channels in both artificial and cellular lipid
bilayers (30). Additionally, cells exposed to VacA
accumulate vesicles containing rab7, a cellular marker of the late
endosome, and lgp110, a marker of lysosomes (21, 24). This
VacA-induced alteration of intracellular membranes has been shown to
disrupt normal lysosomal degradation of surface receptors in epithelial
cells (28) and to interrupt antigen processing in immune
cells (22). Comparison of vacA gene sequences
among clinical isolates has revealed variability both in the coding
region of the signal sequence and in the middle region of the
functional protein. Certain alleles of the signal sequence correlate
both with higher expression of active toxin and with more severe
disease (2). Alleles of the middle region probably act in
targeting and internalization of the toxin but do not affect toxin
activity once it enters the host cell cytoplasm (23).
The mechanisms by which VacA contributes to infection and disease have
remained elusive. Vacuolization of cells in human biopsy samples has
been observed (4, 11), and oral administration of
partially purified toxin to mice was shown to cause measurable epithelial damage (14). However, isogenic vacA
mutants not only colonize but also cause indistinguishable degrees of
gastritis in both gnotobiotic piglets (10) and Mongolian
gerbils (33). These results, suggesting that
vacA is not a virulence factor, contradict the human
epidemiology data. This may reflect differences in the animal models
relative to the human host or may indicate that VacA is not essential
for the establishment or persistence of H. pylori infection.
The latter conclusion is particularly unsatisfying since the presence
of vacA seems to distinguish H. pylori from
Helicobacter species that do not infect humans or interact
intimately with the gastric epithelium in their natural hosts
(19).
We decided to reexamine the role of VacA in an established mouse model
of infection using H. pylori strain SS1 in C57BL/6NTac mice
(20). In this model system, we found that isogenic
vacA null mutants are severely defective in the ability to
establish initial colonization of the host, which profoundly attenuates the virulence potential of these strains.
 |
MATERIALS AND METHODS |
Bacterial and cell culture.
The mouse-adapted H. pylori strain SS1 was used for these studies (20).
H. pylori was grown on solid media on horse blood agar (HB)
plates, containing 4% Columbia agar base (Oxoid), 5% defibrinated
horse blood (HemoStat Labs), 0.2%
-cyclodextrin (Sigma), 10 µg of
vancomycin (Sigma) per ml, 5 µg of cefsulodin (Sigma) per ml, 2.5 U
of polymyxin B (Sigma) per ml, 50 µg of cycloheximide (Sigma) per ml,
5 µg of trimethoprim (Sigma) per ml, and 8 µg of amphotericin B
(Sigma) per ml, under microaerobic conditions at 37°C. A microaerobic
atmosphere was generated either by using a CampyGen sachet (Oxoid) in a
gas pack jar or by incubating the culture in an incubator equilibrated
with 10% CO2 and 90% air. For liquid culture, H. pylori was grown in brucella broth (Difco) containing 10% fetal
bovine serum (Gibco/BRL) (BB10) with shaking in a microaerobic
atmosphere. Escherichia coli growth and manipulations were
performed as specified by standard laboratory protocols
(3). AGS cells were grown in Dulbecco modified Eagle medium with high glucose, L-glutamine, sodium pyruvate, and
pyridoxine hydrochloride (Gibco/BRL) supplemented with 10% fetal
bovine serum.
Construction of vacA and cagA mutant
strains and restored derivatives.
The
vacA::aphA3 (
V) derivative of SS1 was
made by transforming SS1 with 2 µg of genomic DNA prepared from
strain 342s
V (provided by Marta Marchetti), using natural
transformation (http://www.metazoa.com/UPL3244). 342s
V contains the
Campylobacter coli aphA3 gene, conferring kanamycin
resistance, inserted at nucleotide 1392 (amino acid 296) of the
vacA coding sequence (31).
Kanamycin-resistant colonies were isolated on HB plates
containing kanamycin (25 µg/ml). The
cagA::aphA3 derivative of SS1 was made by
transforming SS1 with 5 µg of pCagKan as described above. pCagKan was
made by subcloning the C. coli aphA3 gene from pILL550
(17) into the NdeI site at position 1053 of the
cagA gene in pBSCagA (7).
To make an independent vacA mutant in SS1, we first
amplified the entire coding region of vacA from strain NCTC
11638 (accession number U07145) (26) using PCR with
primers VN (CGCTTTGATGGACACCCCACA) and VC
(GCGATCTGGCATGATAAG) in reaction mixtures containing 4 µM
(each) primers and 20 ng of NCTC 11638 genomic DNA. The
resulting reaction product was gel purified and cloned into the TopoXL
vector using the TopoXL kit (Invitrogen) as specified by the
manufacturer. Plasmids from two resulting clones, TV2 and TV7, that
contained the expected 4-kb inserts were sequenced to confirm they
contained the expected gene. DNA sequencing revealed that both clones
contained several mutations. However, the three mutations in pTV7 were
confined to a SspI fragment which contained no mutations in
the pTV2 clone. Therefore, the SspI fragment from pTV2 was
subcloned into pTV7. Sequencing revealed that the new clone, pTV2/7,
contained the entire vacA coding region with no mutations.
pVacKanSacB was made by subcloning an XhoI-SmaI
fragment from pKSFII (6) containing the aphA3
gene, conferring kanamycin resistance, and the sacB gene,
conferring sucrose sensitivity, into pTV2/7 that had been digested with
SspI, removing the DNA between positions 1332 and 2340 of
the coding sequence. SS1 was then transformed with 10 µg of
pVacKanSacB using natural transformation, and kanamycin-resistant clones were selected as described above. Several of the resulting colonies were screened for sucrose sensitivity (from the
sacB gene) by plating on HB plates containing 6% sucrose.
One kanamycin-resistant, sucrose-sensitive clone VS3 was further
analyzed. PCR amplification with primers flanking the SspI
sites (VS4 [GATAAACACTTCAAAAGT] and VS5
[TTAGCTGTATGAGCATCC]) and within the aphA3 gene
(Aph3out [GGCGTATAACATAGTAGCTAC]) were used to confirm
that a single double crossover event had occurred.
The
vacA locus was then restored to the wild-type sequence
by transforming VS3 with pTV2/7 and selecting sucrose-resistant
colonies. Clone 3.1 was additionally found to be kanamycin sensitive,
suggesting a double crossover, and again PCR was used to confirm
the
double crossover as described
above.
Immunoblot detection of VacA.
The presence of the VacA
protein in bacterial extracts was determined by resuspending half of a
blue inoculating loop (Nunc) full of plate-grown bacteria in 2× sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample
buffer (3). This sample was fractionated by SDS-PAGE (10%
polyacrylamide), and the proteins were transferred to a Hybond-P
membrane (Amersham). The resulting blot was incubated with rabbit
anti-VacA polyclonal serum (1:10,000) (provided by Antonello Covacci
[31] in TBS-T (50 mM Tris [pH 7.4], 150 mM NaCl,
0.05% Tween 20) followed by a secondary anti-rabbit immunoglobulin G
antibody conjugated to horseradish peroxidase (Amersham) at the same
dilution. The immunoreactive bands were visualized using the ECL-Plus
detection system as specified by the manufacturer (Amersham).
Mouse infections.
Bacteria were inoculated from frozen
stocks onto HB plates. After 2 to 5 days of growth, bacteria harvested
from the plates were used to inoculate liquid cultures. Cultures were
grown with shaking under microaerobic conditions overnight to an
optical density at 600 nm (OD600) between 0.3 and 1. Cultures were assessed by light microscopy for potential contamination,
spiral morphology, and motility. Bacteria were diluted to 1 × 108 to 9 × 108 bacteria per ml, assuming
3 × 108 bacteria/OD600 unit, in BB10
unless otherwise indicated. Female C57BL/6NTac mice (6 to 8 weeks old)
were infected by oral gavage with 1 ml of bacterial suspension. The
mice were housed in an Association for the Assessment and Accreditation
of Laboratory Animal Care-accredited facility in microisolator caging
and provided with standard chow and water ad libitum. All manipulations
were approved by the institutional Animal Care and Use Committee. Mice were euthanized at the indicated intervals by inhalation of
CO2. The glandular stomach was removed, separated from the
forestomach, and cut along the lesser curvature. Any ingested food in
the stomach was removed with forceps, and the stomach was bisected with
a clean scalpel blade by cutting along the greater curvature. One half
of the stomach was transferred to an Eppendorf tube containing 0.5 ml
of BB10, weighed, and homogenized with a tissue homogenizer pestle
(VWR). Serial dilutions of the homogenate were plated onto HB plates to
determine the numbers of both wild-type bacteria and mutant bacteria or
onto HB plates supplemented with 25 µg of kanamycin per ml to
detect vacA mutant bacteria only. The percentage of
wild-type bacteria was determined using the following equation: percent
wild type = 100
[(CFU Kanr/CFU
plain) × 100]. The remaining half of the stomach was
fixed in 10% neutral buffered formalin (Fisher Scientific) and
processed using standard methods. Tissue sections to be examined by
light microscopy were stained with hematoxylin and eosin or with a
silver stain (Warthin-Starry method).
Determination of ID50.
To determine the 50%
infective dose (ID50), mice were infected with serial
dilutions of bacteria as described above. The inoculum was diluted and
plated to determine the actual bacterial dose. After 1 month the mice
were sacrificed and the stomachs were cultured as above to determine
the number of animals infected at each dose. The Reed-Muench
calculation was then used to determine the ID50 (27).
Mixed infection in vitro.
Bacteria were resuspended in BB10
after 1 day of growth on plates, and the OD600 was
determined. A mixture containing approximately 3 × 107 of both VS3
(vacA::apha3:sacB) and 3.1 (vacA) bacteria were inoculated into 5 ml of BB10 for the
0.5-day time point. A parallel 5-ml culture was made by diluting this
culture 10-fold for the 1-day time point. For subsequent time points,
3 × 106 bacteria from that day's culture were
diluted into 5 ml of fresh BB10 and grown for 24 h. All cultures
were grown with shaking in a microaerobic atmosphere. At 0, 0.5, 1, 2, 3, 4, and 5 days, the cultures were plated on both plain plates and
plates supplemented with kanamycin to distinguish VS3
(Kanr) from 3.1 (Kans). The percentage of
wild-type bacteria was determined using the above equation.
 |
RESULTS |
Wild-type H. pylori outcompete vacA mutant
bacteria in the mouse stomach.
To assess the role of VacA in
colonization, we made a vacA mutant derivative (
V)
of the mouse-adapted H. pylori strain, SS1 (20), by natural transformation with genomic DNA
from H. pylori strain 342s
V, which contained the
aphA3 gene from C. coli, conferring kanamycin
resistance, inserted into the vacA coding region and selection of a kanamycin-resistant clone. First we tested the infecting
potential of a high dose (9 × 108 CFU) of wild-type
and mutant bacteria alone and in a coinfection experiment with a 50:50
mixture of the two strains. In the mixed infection, we could
distinguish mutant bacteria from wild-type bacteria on the basis of the
kanamycin resistance gene used to generate the vacA
mutation. Each strain could infect mice, and the infections resulted in
a similar bacterial load after 1 month (Table
1). In the mixed infection, however, only
wild-type bacteria were recovered. We repeated this experiment using
both 50:50 and 90:10 ratios of mutant to wild-type bacteria. In both
cases, we could recover only wild-type bacteria from infected animals
(Table 2).
The vacA mutant has a 320-fold-higher ID50
than the wild-type strain dose.
We next tested both the wild-type
and vacA mutant (
V) strains to determine the precise
ID50. In this experiment, we infected mice with 10-fold
serially diluted bacteria and determined the number of animals
colonized at each dose. The Reed-Muench calculation was used to
determine the number of bacteria required to obtain colonization of
50% of the animals (27). Table
3 shows that the ID50 for the
wild-type strain was less than 5 × 105 bacteria while
the vacA mutant had an ID50 of 1.6 × 108. This is at least a 320-fold difference.
To rule out possible effects of the presence of the
aphA3
gene, which confers kanamycin resistance in the mutant strain, we
determined the ID
50 of another mutant, generated by
insertion
of the
aphA3 gene into its coding region, the
cagA gene, shown
previously to colonize animal models of
infection (
33). We also
observed good colonization of the
cagA mutant both alone and in
competition with wild-type
bacteria (data not shown). The ID
50 of the
cagA
mutant was 5.4 × 10
5, similar to that of the
wild-type bacteria. We also determined
the localization and density of
infection by staining histological
sections of infected animals with
the Warthin-Starry stain to
visualize the bacteria. In animals infected
with both the wild-type
and
vacA mutant bacteria both
strains were localized primarily
in the stomach antrum, with some
bacteria being found in the cardia
at the junction of the forestomach
and the stomach. The density
of infection observed by histological
examination appeared similar
for the two strains, consistent with the
culture results. Examination
of the stomachs with hematoxylin and eosin
staining revealed no
appreciable inflammation after 1 month of
infection with either
wild-type or mutant
bacteria.
Restoration of the mutant gene and the colonization phenotype.
The vacA mutant used in the above studies was generated by
transformation of chromosomal DNA from another H. pylori
strain that contained a kanamycin resistance cassette inserted in the vacA gene. This led to the formal possibility that the
phenotype we observed was not due to the insertion at the
vacA locus but was due to some other strain difference
acquired during the genetic transformation. To rule out this
possibility, we made an independent vacA mutant derivative
of SS1 by generating a plasmid containing the vacA gene with
a 1.1-kb internal deletion, into which was inserted a genetic cassette
carrying the aphA3 gene (kanamycin resistance) and the
sacB gene (sucrose sensitivity). This plasmid was used to
transform SS1. The resulting transformants were selected by resistance
to kanamycin, and all were sensitive to sucrose. The insertion of one
clone, VS3, was confirmed by PCR to result from a double crossover at
the vacA locus, and this clone was used for further studies.
VS3 was then restored to the wild-type sequence at the vacA
locus by transformation with a second plasmid containing the
full-length vacA gene. Of 30 sucrose-resistant sucrose
colonies, 29 were kanamycin sensitive, indicating that the mutated
allele had been replaced by the wild-type allele due to a double
crossover at the vacA locus. This was confirmed by PCR, and
one clone, 3.1, was used for further analysis. The full-length vacA gene had proved difficult to clone in E. coli, and many of the derivatives we isolated showed point
mutations or small deletions. Therefore, we used Western blotting of
whole-cell extracts of the wild type, a new mutant derivative, VS3, and
the reconstituted wild-type vacA strain, 3.1, to show that
both the starting strain and the restored strain expressed full length
(94-kDa) VacA protein while mutant strain VS3 had no expression of VacA
(Fig. 1).

View larger version (93K):
[in this window]
[in a new window]
|
FIG. 1.
Western blot of whole-cell extracts probed with
anti-VacA antibodies. WT, wild-type strain SS1; VS3,
vacA::aphA3:sacB; 3.1, restored vacA mutant. The positions of molecular mass
markers in kilodaltons are indicated on the left, and the position of
the 94-kDa VacA protein is shown by a diamond on the right.
|
|
We tested the infectious potential of VS3 and 3.1, both alone and in
competition, compared to wild-type bacteria. We could
distinguish the
vacA mutant, VS3, from the strain restored to
wild type,
3.1, because VS3 contains a kanamycin resistance cassette,
allowing
selection on kanamycin-containing plates. After 1 month
of infection,
both strains were able to infect mice. The bacterial
loads in the
stomachs of mice infected with each strain were similar
(VS3, 1.6 × 10
5 ± 2.7 × 10
5 CFU/g; 3.1, 6.9 × 10
5 ± 7.9 × 10
5 CFU/g).
However, as above, only the restored wild-type bacteria
could be
recovered from a mixed infection (Fig.
2). Thus, strain
3.1, containing a
reconstituted
vacA gene, was indistinguishable
from the wild
type in its capacity to colonize animals and to
outgrow a
vacA mutant strain.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 2.
Colonization of C57BL/6NTac mice 1 month after infection
of with 2 × 108 CFU of vacA mutant strain
(VS3), restored wild-type strain (3.1), or a 50:50 mixture of the two
strains. The number of restored wild-type (black bars) or
vacA mutant (gray bars) bacteria recovered from each animal
stomach is shown. Each bar represents one mouse. In the mixed
infection, no mutant bacteria could be recovered from any of the five
mice.
|
|
Kinetics of mixed infection.
To determine when the
vacA mutant bacteria were disappearing from the infection,
we infected 24 mice with a 50:50 mixture of vacA mutant
(VS3) and wild-type (3.1) bacteria. Four mice were sacrificed on each
of days 0, 1, 2, 7, 14, and 28, and the viable counts of both strains
were determined. The initial inoculum contained 2 × 108 bacteria of each strain. Immediately after infection,
approximately 106 total organisms could be recovered (Fig.
3A). After 1 day, bacteria could be
recovered from only one mouse, which had 1,600 CFU/g. On day 2, approximately 2 × 104 organisms were recovered from
all four animals. By day 7, the bacterial load reached approximately
5 × 105 CFU/g for all four animals and remained at
this level for the 14- and 28-day time points. We also determined the
percentage of wild-type and mutant bacteria in each of the animals
(Fig. 3B). At the time zero, approximately equal numbers of wild-type and mutant bacteria were recovered (the average percent wild type was
48%). The single infected animal at the 1-day time point had 70%
wild-type bacteria and only 30% mutant bacteria. By 2 days, three mice
were infected with 100% wild-type bacteria while one mouse had 9%
mutant bacteria and 91% wild-type bacteria. At the later time points,
all the mice were infected with only wild-type bacteria, except for one
mouse at the 14-day time point, in which 33% of the bacteria recovered
carried the vacA mutation.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 3.
Kinetics of mixed infection with a 50:50 mixture (2 × 108 CFU each) of vacA mutant (VS3) and
restored wild-type (3.1) strains in vivo and in vitro. (A) Total number
of bacteria recovered from the stomachs of each of four mice on days 0, 1, 2, 7, 14, and 28 after infection. (B) Percentage of wild-type
bacteria recovered at each time point during infection of mice
(diamonds) or during growth in vitro (squares).
|
|
In a parallel experiment, we checked the growth of a similar mixed
culture in vitro at 0, 0.5, 1, 2, 3, 4 and 5 days. At all
time points,
the culture consisted of approximately 50% wild-type
and 50% mutant
bacteria (Fig.
3B). This is in stark contrast to
the in vivo
experiment, where the mutant bacteria represented
only 30% of the
population after 1 day and were essentially absent
after 2 days. Thus,
the
vacA mutation seems to confer a specific
disadvantage
for colonization rather than
growth.
 |
DISCUSSION |
In contrast to previous studies (10, 33), we have
shown that two independent mutations in the vacA gene of
H. pylori strain SS1 resulted in bacteria that could not
survive in mice in the presence of competing wild-type bacteria. The
fact that a biological effect could be revealed only in a competition
experiment might suggest a subtle virulence phenotype for this gene.
However, the vacA mutant had an ID50 fully 2 log
units higher than that of the wild-type bacteria. The reasons why no
role for vacA could be demonstrated in previous studies may
reflect differences in the animal models used. Alternatively, the lack
of phenotype may have resulted from the general practice of using very
high inocula for animal infections, usually several log units above the
ID50, and multiple rounds of infection. Interestingly, by
using a competition experiment, we were able to see a phenotype, even
at a dose above the ID50 for the mutant strain. This
should provide an improved protocol for testing new potential virulence genes.
We were able to localize the defect of the vacA mutant to a
role in colonization by determining the kinetics of infection during
coinfection with the wild-type bacteria. After an initial inoculation
of an equal mixture of 2 × 108 mutant and wild-type
organisms, the challenged animals cleared most of the bacteria. On day
1, few viable or cultivatable organisms could be detected. However, by
day 2, significant numbers of bacteria were detected, and this number
increased on day 7, after which the bacterial load remained relatively
constant over 1 month of observation. Examination of the genotype of
the bacteria recovered from the mouse stomach revealed that a
significant proportion of the mutant bacteria were present only
immediately after inoculation. By day 2 postinfection, generally only
wild-type bacteria could be recovered from the stomach. That 2 of 16 mice showed a small percentage of mutant bacteria may reflect the
residual ability of this mutant to establish infection on its own or,
since VacA is a secreted protein, trans-complementation from
nearby wild-type bacteria.
The mechanism by which VacA facilitates colonization is not known;
however, VacA host cell toxicity has been well documented. This
toxicity may stimulate host cell turnover, presenting a new cell type
to which H. pylori can adhere. We examined the ability of
the vacA mutant to adhere to a gastric epithelial cell line but found no obvious differences (data not shown). Further studies with
primary gastric epithelial cells may shed more light on this hypothesis. Alternatively, VacA may cause tissue damage that alters the
local environment by releasing nutrients or altering the local pH,
allowing H. pylori to survive. Local or global
hypochlorhydria in the stomach has been postulated to have a
significant impact on H. pylori colonization and to play a
role in the expression of disease. Prolonged H. pylori
infection can induce the host to produce autoantibodies against the
Lewisx antigen found on parietal cells, resulting in loss
of this acid-secreting cell type (15, 29). In the mouse
model, inhibitors of acid secretion can change the distribution of
H. pylori from a localized infection of the antrum to
colonization of the entire stomach (18). It is possible
that VacA plays a role in the local inhibition of acid secretion due to
cell damage, which then facilitates the ability of H. pylori
to establish infection.
VacA may increase the ability of H. pylori to be transmitted
from host to host. There is considerable sequence variation in the
vacA gene in different clinical isolates. These different alleles vary in VacA expression levels. Epidemiological studies show
that strains expressing high levels of the vacA correlate more highly with ulcer disease. This could result from direct effects
of the toxin or could occur because VacA promotes higher levels of
sustained colonization in the stomach, possibly in a precise anatomic
region of the stomach. The presence of low-expressing alleles could
reflect a delicate balance between high levels of the toxin allowing
successful transmission but also causing too much damage to the host.
The mouse model of H. pylori infection appears to reflect
primarily the capacity to colonize animals and does not accurately reflect the inflammatory response seen during natural human infection. Hence, we may be assessing only one aspect of the contribution of VacA
to H. pylori virulence. Nevertheless, our findings do present an interesting and unexpected facet of the effect of VacA on
the biology of H. pylori infection and disease.
 |
ACKNOWLEDGMENTS |
We thank Antonello Covacci, Marta Marchetti, and Rino Rappuoli
for strains, plasmids, antibodies, advice, and helpful discussions; Denise Monack for help with statistical analysis; and Denise Monack and Lalita Ramakrishnan for critical review of the manuscript.
This work was supported by a postdoctoral fellowship from the Jane
Coffin Childs memorial fund for medical research to N.S. and by NIH
grant AI38459.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department
of Microbiology and Immunology, Sherman Fairchild Science
Building, D031, 299 Campus Dr., Stanford, CA 94305-5124. Phone:
(650)723-2671. Fax: (650)723-1837. E-mail:
nsalama{at}leland.stanford.edu
Editor:
D. L. Burns
 |
REFERENCES |
| 1.
|
Akopyants, N. S.,
S. W. Clifton,
D. Kersulyte,
J. Crabtree,
B. E. Youree,
C. A. Reece,
N. O. Bukanov,
E. S. Drazek,
B. A. Roe, and D. E. Berg.
1998.
Analyses of the cag pathogenicity island of Helicobacter pylori.
Mol. Microbiol.
28:37-53[CrossRef][Medline].
|
| 2.
|
Atherton, J. C.,
P. Cao,
R. M. Peek, Jr.,
M. K. Tummuru,
M. J. Blaser, and T. L. Cover.
1995.
Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration.
J. Biol. Chem.
270:17771-17777[Abstract/Free Full Text].
|
| 3.
|
Ausubel, F.,
R. Brent,
R. Kingston,
D. Moore,
J. Seidman,
J. Smith, and K. Struhl (ed.).
1997.
Short protocols in molecular biology, 3rd ed.
John Wiley & Sons, Inc., New York, N.Y.
|
| 4.
|
Bertram, T. A.,
P. D. Murray,
D. R. Morgan,
G. Jerdak,
P. Yang, and S. Czinn.
1991.
Gastritis associated with infection by Helicobacter pylori in humans: geographical differences.
Scand. J. Gastroenterol. Suppl.
181:1-8[Medline].
|
| 5.
|
Censini, S.,
C. Lange,
Z. Xiang,
J. E. Crabtee,
P. Ghiara,
M. Borodovsky,
R. Rappuoli, and A. Covacci.
1996.
cag, a pathogenicity island of Helicobacter pylori, encodes type 1-specific and disease-associated virulence factors.
Proc. Natl. Acad. Sci. USA
93:14648-14653[Abstract/Free Full Text].
|
| 6.
|
Copass, M.,
G. Grandi, and R. Rappuoli.
1997.
Introduction of unmarked mutations in the Helicobacter pylori vacA gene with a sucrose sensitivity marker.
Infect. Immun.
65:1949-1952[Abstract].
|
| 7.
|
Covacci, A.,
S. Censini,
M. Bugnoli,
R. Petracca,
D. Burroni,
G. Macchia,
A. Massone,
E. Papini,
Z. Xiang,
N. Figura, and R. Rappuoli.
1993.
Molecular characterization of the 128-kDa immunodominant antigen of Helicobacter pylori associated with cytotoxicity and duodenal ulcer.
Proc. Natl. Acad. Sci. USA
90:5791-5795[Abstract/Free Full Text].
|
| 8.
|
Covacci, A.,
J. L. Telford,
G. Del Giudice,
J. Parsonnet, and R. Rappuoli.
1999.
Helicobacter pylori virulence and genetic geography.
Science
284:1328-1333[Abstract/Free Full Text].
|
| 9.
|
deBernard, M.,
B. Arico,
E. Papini,
R. Rizzuto,
G. Grandi,
R. Rappuoli, and C. Montecucco.
1997.
Helicobacter pylori toxin VacA induces vacuole formation by acting in the cell cytosol.
Mol. Microbiol.
26:665-674[CrossRef][Medline].
|
| 10.
|
Eaton, K. A.,
T. L. Cover,
M. K. R. Tummutu,
M. J. Blaser, and S. Krakowka.
1997.
Role of vacoulating cytotoxin in gastritis due to Helicobacter pylori in gnotobiotic piglets.
Infect. Immun.
65:3462-3464[Abstract].
|
| 11.
|
El-Shoura, S. M.
1995.
Helicobacter pylori. I. Ultrastructural sequences of adherence, attachment, and penetration into the gastric mucosa.
Ultrastruct. Pathol.
19:323-333[Medline].
|
| 12.
|
Garner, J. A., and T. L. Cover.
1996.
Binding and internalization of the Helicobacter pylori vacuolating cytotoxin by epithelial cells.
Infect. Immun.
64:4197-4203[Abstract].
|
| 13.
|
Gerhard, M.,
N. Lehn,
N. Neumayer,
T. Boren,
R. Rad,
W. Schepp,
S. Miehlke,
M. Classen, and C. Prinz.
1999.
Clinical relevance of the Helicobacter pylori gene for blood-group antigen-binding adhesin.
Proc. Natl. Acad. Sci. USA
96:12778-12783[Abstract/Free Full Text].
|
| 14.
|
Ghiara, P.,
M. Marchetti,
M. J. Blaser,
M. K. Tummuru,
T. L. Cover,
E. D. Segal,
L. S. Tompkins, and R. Rappuoli.
1995.
Role of the Helicobacter pylori virulence factors vacuolating cytotoxin, CagA, and urease in a mouse model of disease.
Infect. Immun.
63:4154-4160[Abstract].
|
| 15.
|
Guruge, J. L.,
P. G. Falk,
R. G. Lorenz,
M. Dans,
H.-P. Wirth,
M. J. Blaser,
D. E. Berg, and J. I. Gordon.
1998.
Epithelial attachment alters the outcome of Helicobacter pylori infection.
Proc. Natl. Acad. Sci. USA
95:3925-3930[Abstract/Free Full Text].
|
| 16.
|
Ilver, D.,
A. Arnqvist,
J. Ogren,
I. M. Frick,
D. Kersulyte,
E. T. Incecik,
D. E. Berg,
A. Covacci,
L. Engstrand, and T. Borén.
1998.
Helicobacter pylori adhesin binding fucosylated histo-blood group antigens revealed by retagging.
Science
279:373-377[Abstract/Free Full Text].
|
| 17.
|
Labigne-Roussel, A.,
J. Harel, and L. Tompkins.
1987.
Gene transfer from Escherichia coli to Campylobacter species: development of shuttle vectors for genetic analysis of Campylobacter jejuni.
J. Bacteriol.
169:5320-5323[Abstract/Free Full Text].
|
| 18.
|
Lee, A.,
M. F. Dixon,
S. J. Danon,
E. Kuipers,
F. Megraud,
H. Larsson, and B. Mellgard.
1995.
Local acid production and Helicobacter pylori: a unifying hypothesis of gastroduodenal disease.
Eur. J. Gastroenterol. Hepatol.
7:461-465[Medline].
|
| 19.
|
Lee, A., and J. O'Rourke.
1993.
Gastric bacteria other than Helicobacter pylori.
Gastroenterol. Clin. North Am.
22:21-42[Medline].
|
| 20.
|
Lee, A.,
J. O'Rourke,
M. C. De Ungria,
B. Robertson,
G. Daskalopoulos, and M. F. Dixon.
1997.
A standardized mouse model of Helicobacter pylori infection: Introducing the Sydney strain.
Gastroenterology
112:1386-1397[CrossRef][Medline].
|
| 21.
|
Molinari, M.,
C. Galli,
N. Norais,
J. L. Telford,
R. Rappuoli,
J. P. Luzio, and C. Monticucco.
1997.
Vacuoles induced by Helicobacter pylori toxin contain both late endosomal and lysosomal markers.
J. Biol. Chem.
272:25339-25344[Abstract/Free Full Text].
|
| 22.
|
Molinari, M.,
M. Salio,
C. Galli,
N. Norais,
R. Rappuoli,
A. Lanzavecchia, and C. Monticucco.
1998.
Selective inhibition of Ii-dependent antigen presentation by Helicobacter pylori toxin VacA.
J. Exp. Med.
187:135-140[Abstract/Free Full Text].
|
| 23.
|
Pagliaccia, C.,
M. deBernard,
P. Lupetti,
X. Ji,
D. Burroni,
T. L. Cover,
E. Papini,
R. Rappuoli,
J. L. Telford, and J.-M. Reyrat.
1998.
The m2 form of the Helicobacter pylori cytotoxin has cell type-specific vacuolating activity.
Proc. Natl. Acad. Sci. USA
95:10212-10217[Abstract/Free Full Text].
|
| 24.
|
Papini, E.,
M. D. Bernard,
E. Milia,
M. Bugnoli,
M. Zerial,
R. Rappuoli, and C. Montecucco.
1994.
Cellular vacuoles induced by Helicobacter pylori originate from late endosomal compartments.
Proc. Natl. Acad. Sci. USA
91:9720-9724[Abstract/Free Full Text].
|
| 25.
|
Parsonnet, J.,
G. D. Friedman,
D. P. Vandersteen,
Y. Chang,
J. H. Vogelman,
N. Orentreich, and R. K. Sibley.
1991.
Helicobacter pylori infection and the risk of gastric carcinoma.
N. Engl. J. Med.
325:1127-1131[Abstract].
|
| 26.
|
Phadnis, S. H.,
D. Ilver,
L. Janzon,
S. Normark, and T. U. Westblom.
1994.
Pathological significance and molecular characterization of the vacuolating toxin gene of Helicobacter pylori.
Infect. Immun.
62:1557-1565[Abstract/Free Full Text].
|
| 27.
|
Reed, L. J., and H. Muench.
1938.
A simple method of estimating fifty per cent endpoints.
Am. J. Hyg.
27:493-497.
|
| 28.
|
Satin, B.,
N. Norais,
J. Telford,
R. Rappuoli,
M. Murgia,
C. Montecucco, and E. Papini.
1997.
Effect of Helicobacter pylori vacuolating toxin on maturation and extracellular release of procathepsin D and on epidermal growth factor degradation.
J. Biol. Chem.
272:25022-25028[Abstract/Free Full Text].
|
| 29.
|
Syder, A. J.,
J. L. Guruge,
Q. Li,
Y. Hu,
C. M. Oleksiewicz,
R. G. Lorenz,
S. M. Karam,
P. G. Falk, and J. I. Gordon.
1999.
Helicobacter pylori attaches to NeuAcalpha2,3Galbeta1,4 glycoconjugates produced in the stomach of transgenic mice lacking pariental cells.
Mol. Cell
3:263-274[CrossRef][Medline].
|
| 30.
|
Szabo, I.,
S. Brutsche,
F. Tombola,
M. Moschiono,
B. Satin,
J. L. Telford,
R. Rappuoli,
C. Montecucco,
E. Papini, and M. Zoratti.
1999.
Formation of anion-selective channels in the cell plasma membrane by the toxin VacA of Helicobacter pylori is required for its biological activity.
EMBO J.
18:5517-5527[CrossRef][Medline].
|
| 31.
|
Telford, J. L.,
P. Ghiara,
M. Dell'Orco,
M. Comanducci,
D. Burroni,
M. Bugnoli,
M. F. Tecce,
S. Censini,
A. Covacci,
Z. Xiang,
E. Papini,
C. Montecucco,
L. Parente, and R. Rappuoli.
1994.
Gene structure of Helicobacter pylori cytotoxin and evidence of its key role in gastric disease.
J. Exp. Med.
179:1653-1658[Abstract/Free Full Text].
|
| 32.
|
von Herbay, A.,
H. Schreiter, and J. Rudi.
1995.
Simultaneous gastric adenocarcinoma and MALT-type lymphoma in Helicobacter pylori infection.
Virchows Arch.
427:445-450[Medline].
|
| 33.
|
Wirth, H. P.,
M. H. Beins,
M. Yang,
K. T. Tham, and M. J. Blaser.
1998.
Experimental infection of Mongolian gerbils with wild-type and mutant Helicobacter pylori strains.
Infect. Immun.
66:4856-4866[Abstract/Free Full Text].
|
| 34.
|
Wotherspoon, A. C.,
C. Doglioni,
T. C. Diss,
L. Pan,
A. Moschini,
M. de Boni, and P. G. Isaacson.
1993.
Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacter pylori.
Lancet
342:575-577[CrossRef][Medline].
|
Infection and Immunity, February 2001, p. 730-736, Vol. 69, No. 2
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.2.730-736.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Talarico, S., Gold, B. D., Fero, J., Thompson, D. T., Guarner, J., Czinn, S., Salama, N. R.
(2009). Pediatric Helicobacter pylori Isolates Display Distinct Gene Coding Capacities and Virulence Gene Marker Profiles. J. Clin. Microbiol.
47: 1680-1688
[Abstract]
[Full Text]
-
Alamuri, P., Eaton, K. A., Himpsl, S. D., Smith, S. N., Mobley, H. L. T.
(2009). Vaccination with Proteus Toxic Agglutinin, a Hemolysin-Independent Cytotoxin In Vivo, Protects against Proteus mirabilis Urinary Tract Infection. Infect. Immun.
77: 632-641
[Abstract]
[Full Text]
-
Castillo, A. R., Woodruff, A. J., Connolly, L. E., Sause, W. E., Ottemann, K. M.
(2008). Recombination-Based In Vivo Expression Technology Identifies Helicobacter pylori Genes Important for Host Colonization. Infect. Immun.
76: 5632-5644
[Abstract]
[Full Text]
-
Peek, R. M. Jr
(2008). Helicobacter pylori infection and disease: from humans to animal models. DMM
1: 50-55
[Abstract]
[Full Text]
-
Ivie, S. E., McClain, M. S., Torres, V. J., Algood, H. M. S., Lacy, D. B., Yang, R., Blanke, S. R., Cover, T. L.
(2008). Helicobacter pylori VacA Subdomain Required for Intracellular Toxin Activity and Assembly of Functional Oligomeric Complexes. Infect. Immun.
76: 2843-2851
[Abstract]
[Full Text]
-
Ayala, G., Torres-Mena, J., Lopez-Carrillo, L.
(2008). Association between Helicobacter pylori VacA antigens and gastric cancer depends on the detection method used: immunoblot versus neutralization of the vacuolating activity of VacA. J Med Microbiol
57: 9-14
[Abstract]
[Full Text]
-
Brumell, J. H., Scidmore, M. A.
(2007). Manipulation of Rab GTPase Function by Intracellular Bacterial Pathogens. Microbiol. Mol. Biol. Rev.
71: 636-652
[Abstract]
[Full Text]
-
Carpenter, B. M., McDaniel, T. K., Whitmire, J. M., Gancz, H., Guidotti, S., Censini, S., Merrell, D. S.
(2007). Expanding the Helicobacter pylori Genetic Toolbox: Modification of an Endogenous Plasmid for Use as a Transcriptional Reporter and Complementation Vector. Appl. Environ. Microbiol.
73: 7506-7514
[Abstract]
[Full Text]
-
Williams, S. M., Chen, Y.-T., Andermann, T. M., Carter, J. E., McGee, D. J., Ottemann, K. M.
(2007). Helicobacter pylori Chemotaxis Modulates Inflammation and Bacterium-Gastric Epithelium Interactions in Infected Mice. Infect. Immun.
75: 3747-3757
[Abstract]
[Full Text]
-
Baldwin, D. N., Shepherd, B., Kraemer, P., Hall, M. K., Sycuro, L. K., Pinto-Santini, D. M., Salama, N. R.
(2007). Identification of Helicobacter pylori Genes That Contribute to Stomach Colonization. Infect. Immun.
75: 1005-1016
[Abstract]
[Full Text]
-
Algood, H. M. S., Torres, V. J., Unutmaz, D., Cover, T. L.
(2007). Resistance of Primary Murine CD4+ T Cells to Helicobacter pylori Vacuolating Cytotoxin. Infect. Immun.
75: 334-341
[Abstract]
[Full Text]
-
Kundu, P., Mukhopadhyay, A. K., Patra, R., Banerjee, A., Berg, D. E., Swarnakar, S.
(2006). Cag Pathogenicity Island-independent Up-regulation of Matrix Metalloproteinases-9 and -2 Secretion and Expression in Mice by Helicobacter pylori Infection. J. Biol. Chem.
281: 34651-34662
[Abstract]
[Full Text]
-
McClain, M. S., Czajkowsky, D. M., Torres, V. J., Szabo, G., Shao, Z., Cover, T. L.
(2006). Random Mutagenesis of Helicobacter pylori vacA To Identify Amino Acids Essential for Vacuolating Cytotoxic Activity. Infect. Immun.
74: 6188-6195
[Abstract]
[Full Text]
-
Osaki, T., Hanawa, T., Manzoku, T., Fukuda, M., Kawakami, H., Suzuki, H., Yamaguchi, H., Yan, X., Taguchi, H., Kurata, S., Kamiya, S.
(2006). Mutation of luxS affects motility and infectivity of Helicobacter pylori in gastric mucosa of a Mongolian gerbil model.. J Med Microbiol
55: 1477-1485
[Abstract]
[Full Text]
-
Kusters, J. G., van Vliet, A. H. M., Kuipers, E. J.
(2006). Pathogenesis of Helicobacter pylori Infection. Clin. Microbiol. Rev.
19: 449-490
[Abstract]
[Full Text]
-
Ruggiero, P., Tombola, F., Rossi, G., Pancotto, L., Lauretti, L., Del Giudice, G., Zoratti, M.
(2006). Polyphenols Reduce Gastritis Induced by Helicobacter pylori Infection or VacA Toxin Administration in Mice.. Antimicrob. Agents Chemother.
50: 2550-2552
[Abstract]
[Full Text]
-
Genisset, C., Galeotti, C. L., Lupetti, P., Mercati, D., Skibinski, D. A. G., Barone, S., Battistutta, R., de Bernard, M., Telford, J. L.
(2006). A Helicobacter pylori Vacuolating Toxin Mutant That Fails To Oligomerize Has a Dominant Negative Phenotype. Infect. Immun.
74: 1786-1794
[Abstract]
[Full Text]
-
Gancz, H., Censini, S., Merrell, D. S.
(2006). Iron and pH Homeostasis Intersect at the Level of Fur Regulation in the Gastric Pathogen Helicobacter pylori. Infect. Immun.
74: 602-614
[Abstract]
[Full Text]
-
Gauthier, N. C., Monzo, P., Kaddai, V., Doye, A., Ricci, V., Boquet, P.
(2005). Helicobacter pylori VacA Cytotoxin: A Probe for a Clathrin-independent and Cdc42-dependent Pinocytic Pathway Routed to Late Endosomes. Mol. Biol. Cell
16: 4852-4866
[Abstract]
[Full Text]
-
Pinto-Santini, D., Salama, N. R.
(2005). The Biology of Helicobacter pylori Infection, a Major Risk Factor for Gastric Adenocarcinoma. Cancer Epidemiol. Biomarkers Prev.
14: 1853-1858
[Abstract]
[Full Text]
-
Fitchen, N., Letley, D. P, O'Shea, P., Atherton, J. C, Williams, P., Hardie, K. R
(2005). All subtypes of the cytotoxin VacA adsorb to the surface of Helicobacter pylori post-secretion. J Med Microbiol
54: 621-630
[Abstract]
[Full Text]
-
Moore, J. M., Salama, N. R.
(2005). Mutational Analysis of Metronidazole Resistance in Helicobacter pylori. Antimicrob. Agents Chemother.
49: 1236-1237
[Abstract]
[Full Text]
-
McGee, D. J., Langford, M. L., Watson, E. L., Carter, J. E., Chen, Y.-T., Ottemann, K. M.
(2005). Colonization and Inflammation Deficiencies in Mongolian Gerbils Infected by Helicobacter pylori Chemotaxis Mutants. Infect. Immun.
73: 1820-1827
[Abstract]
[Full Text]
-
Terry, K., Williams, S. M., Connolly, L., Ottemann, K. M.
(2005). Chemotaxis Plays Multiple Roles during Helicobacter pylori Animal Infection. Infect. Immun.
73: 803-811
[Abstract]
[Full Text]
-
Suto, H., Zhang, M., Berg, D. E.
(2005). Age-Dependent Changes in Susceptibility of Suckling Mice to Individual Strains of Helicobacter pylori. Infect. Immun.
73: 1232-1234
[Abstract]
[Full Text]
-
Thompson, L. J., Danon, S. J., Wilson, J. E., O'Rourke, J. L., Salama, N. R., Falkow, S., Mitchell, H., Lee, A.
(2004). Chronic Helicobacter pylori Infection with Sydney Strain 1 and a Newly Identified Mouse-Adapted Strain (Sydney Strain 2000) in C57BL/6 and BALB/c Mice. Infect. Immun.
72: 4668-4679
[Abstract]
[Full Text]
-
Sundrud, M. S., Torres, V. J., Unutmaz, D., Cover, T. L.
(2004). Inhibition of primary human T cell proliferation by Helicobacter pylori vacuolating toxin (VacA) is independent of VacA effects on IL-2 secretion. Proc. Natl. Acad. Sci. USA
101: 7727-7732
[Abstract]
[Full Text]
-
Ladeira, M. S.P., Rodrigues, M. A.M., Salvadori, D. M.F., Queiroz, D. M.M., Freire-Maia, D. V.
(2004). DNA Damage in Patients Infected by Helicobacter pylori. Cancer Epidemiol. Biomarkers Prev.
13: 631-637
[Abstract]
[Full Text]
-
Li, Y., Wandinger-Ness, A., Goldenring, J. R., Cover, T. L.
(2004). Clustering and Redistribution of Late Endocytic Compartments in Response to Helicobacter pylori Vacuolating Toxin. Mol. Biol. Cell
15: 1946-1959
[Abstract]
[Full Text]
-
Gauthier, N. C., Ricci, V., Gounon, P., Doye, A., Tauc, M., Poujeol, P., Boquet, P.
(2004). Glycosylphosphatidylinositol-anchored Proteins and Actin Cytoskeleton Modulate Chloride Transport by Channels Formed by the Helicobacter pylori Vacuolating Cytotoxin VacA in HeLa Cells. J. Biol. Chem.
279: 9481-9489
[Abstract]
[Full Text]
-
Dailidiene, D., Dailide, G., Ogura, K., Zhang, M., Mukhopadhyay, A. K., Eaton, K. A., Cattoli, G., Kusters, J. G., Berg, D. E.
(2004). Helicobacter acinonychis: Genetic and Rodent Infection Studies of a Helicobacter pylori-Like Gastric Pathogen of Cheetahs and Other Big Cats. J. Bacteriol.
186: 356-365
[Abstract]
[Full Text]
-
Willhite, D. C., Cover, T. L., Blanke, S. R.
(2003). Cellular Vacuolation and Mitochondrial Cytochrome c Release Are Independent Outcomes of Helicobacter pylori Vacuolating Cytotoxin Activity That Are Each Dependent on Membrane Channel Formation. J. Biol. Chem.
278: 48204-48209
[Abstract]
[Full Text]
-
Merrell, D. S., Thompson, L. J., Kim, C. C., Mitchell, H., Tompkins, L. S., Lee, A., Falkow, S.
(2003). Growth Phase-Dependent Response of Helicobacter pylori to Iron Starvation. Infect. Immun.
71: 6510-6525
[Abstract]
[Full Text]
-
Bury-Mone, S., Skouloubris, S., Dauga, C., Thiberge, J.-M., Dailidiene, D., Berg, D. E., Labigne, A., De Reuse, H.
(2003). Presence of Active Aliphatic Amidases in Helicobacter Species Able To Colonize the Stomach. Infect. Immun.
71: 5613-5622
[Abstract]
[Full Text]
-
Gebert, B., Fischer, W., Weiss, E., Hoffmann, R., Haas, R.
(2003). Helicobacter pylori Vacuolating Cytotoxin Inhibits T Lymphocyte Activation. Science
301: 1099-1102
[Abstract]
[Full Text]
-
Merrell, D. S., Goodrich, M. L., Otto, G., Tompkins, L. S., Falkow, S.
(2003). pH-Regulated Gene Expression of the Gastric Pathogen Helicobacter pylori. Infect. Immun.
71: 3529-3539
[Abstract]
[Full Text]
-
Ayraud, S., Janvier, B., Salaun, L., Fauchere, J.-L.
(2003). Modification in the ppk Gene of Helicobacterpylori during Single and Multiple Experimental Murine Infections. Infect. Immun.
71: 1733-1739
[Abstract]
[Full Text]
-
Dattelbaum, J. D., Lockatell, C. V., Johnson, D. E., Mobley, H. L. T.
(2003). UreR, the Transcriptional Activator of the Proteus mirabilis Urease Gene Cluster, Is Required for Urease Activity and Virulence in Experimental Urinary Tract Infections. Infect. Immun.
71: 1026-1030
[Abstract]
[Full Text]
-
Guillemin, K., Salama, N. R., Tompkins, L. S., Falkow, S.
(2002). Cag pathogenicity island-specific responses of gastric epithelial cells to Helicobacter pylori infection. Proc. Natl. Acad. Sci. USA
99: 15136-15141
[Abstract]
[Full Text]
-
Suerbaum, S., Michetti, P.
(2002). Helicobacter pylori Infection. NEJM
347: 1175-1186
[Full Text]
-
Andermann, T. M., Chen, Y.-T., Ottemann, K. M.
(2002). Two Predicted Chemoreceptors of Helicobacter pylori Promote Stomach Infection. Infect. Immun.
70: 5877-5881
[Abstract]
[Full Text]
-
Schraw, W., Li, Y., McClain, M. S., van der Goot, F. G., Cover, T. L.
(2002). Association of Helicobacter pylori Vacuolating Toxin (VacA) with Lipid Rafts. J. Biol. Chem.
277: 34642-34650
[Abstract]
[Full Text]
-
Ricci, V., Manzo, B. A., Tuccillo, C., Boquet, P., Ventura, U., Romano, M., Zarrilli, R.
(2002). NSAIDs counteract H. pylori VacA toxin-induced cell vacuolation in MKN 28 gastric mucosal cells. Am. J. Physiol. Gastrointest. Liver Physiol.
283: G511-G520
[Abstract]
[Full Text]
-
Patel, H. K., Willhite, D. C., Patel, R. M., Ye, D., Williams, C. L., Torres, E. M., Marty, K. B., MacDonald, R. A., Blanke, S. R.
(2002). Plasma Membrane Cholesterol Modulates Cellular Vacuolation Induced by the Helicobacter pylori Vacuolating Cytotoxin. Infect. Immun.
70: 4112-4123
[Abstract]
[Full Text]
-
Willhite, D. C., Ye, D., Blanke, S. R.
(2002). Fluorescence Resonance Energy Transfer Microscopy of the Helicobacter pylori Vacuolating Cytotoxin within Mammalian Cells. Infect. Immun.
70: 3824-3832
[Abstract]
[Full Text]
-
Guo, B. P., Mekalanos, J. J.
(2002). Rapid genetic analysis of Helicobacter pylori gastric mucosal colonization in suckling mice. Proc. Natl. Acad. Sci. USA
99: 8354-8359
[Abstract]
[Full Text]
-
Ottemann, K. M., Lowenthal, A. C.
(2002). Helicobacter pylori Uses Motility for Initial Colonization and To Attain Robust Infection. Infect. Immun.
70: 1984-1990
[Abstract]
[Full Text]
-
Supajatura, V., Ushio, H., Wada, A., Yahiro, K., Okumura, K., Ogawa, H., Hirayama, T., Ra, C.
(2002). Cutting Edge: VacA, a Vacuolating Cytotoxin of Helicobacter pylori, Directly Activates Mast Cells for Migration and Production of Proinflammatory Cytokines. J. Immunol.
168: 2603-2607
[Abstract]
[Full Text]
-
McClain, M. S., Cao, P., Iwamoto, H., Vinion-Dubiel, A. D., Szabo, G., Shao, Z., Cover, T. L.
(2001). A 12-Amino-Acid Segment, Present in Type s2 but Not Type s1 Helicobacter pylori VacA Proteins, Abolishes Cytotoxin Activity and Alters Membrane Channel Formation. J. Bacteriol.
183: 6499-6508
[Abstract]
[Full Text]
-
Fischer, W., Buhrdorf, R., Gerland, E., Haas, R.
(2001). Outer Membrane Targeting of Passenger Proteins by the Vacuolating Cytotoxin Autotransporter of Helicobacter pylori. Infect. Immun.
69: 6769-6775
[Abstract]
[Full Text]
-
Solnick, J. V., Hansen, L. M., Canfield, D. R., Parsonnet, J.
(2001). Determination of the Infectious Dose of Helicobacter pylori during Primary and Secondary Infection in Rhesus Monkeys (Macaca mulatta). Infect. Immun.
69: 6887-6892
[Abstract]
[Full Text]