Previous Article | Next Article 
Infection and Immunity, February 2001, p. 773-778, Vol. 69, No. 2
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.2.773-778.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Antibodies to Loop 6 of the P2 Porin Protein of
Nontypeable Haemophilus influenzae Are Bactericidal against
Multiple Strains
John M.
Neary,1
Kyungcheol
Yi,1
Richard J.
Karalus,1 and
Timothy F.
Murphy1,2,3,*
Department of
Microbiology1 and Division of Infectious
Diseases, Department of Medicine,2 State
University of New York at Buffalo, and Veterans Affairs Western
New York Healthcare System,3 Buffalo, New York
14215
Received 22 May 2000/Returned for modification 5 July 2000/Accepted 11 November 2000
 |
ABSTRACT |
The P2 porin protein is the most abundant protein in the outer
membrane of nontypeable Haemophilus influenzae (NTHI).
Analysis of sequences of P2 from different strains reveals the presence of both heterogeneous and conserved surface-exposed loops of the P2
molecule among strains. The present study was undertaken to test the
hypothesis that antibodies to a conserved surface-exposed loop are
bactericidal for multiple strains of NTHI and could thus form the basis
of vaccines to prevent infection due to NTHI. Polyclonal antiserum to a
peptide corresponding to loop 6 was raised and was immunopurified over
a loop 6 peptide column. Analysis of the antibodies to whole organisms
and peptides corresponding to each of the eight loops of P2 by
immunoassays revealed that the antibodies were highly specific for loop
6 of P2. The immunopurified antibodies bound to P2 of 14 of 15 strains
in immunoblot assays. These antibodies to loop 6 demonstrated
complement-mediated bactericidal killing of 8 of 15 strains. These
results support the concept of using conserved regions of the P2
protein as a vaccine antigen.
 |
INTRODUCTION |
Nontypeable Haemophilus
influenzae (NTHI) is a small, gram-negative bacillus which causes
otitis media in children and lower respiratory infections in adults
with chronic obstructive pulmonary disease (COPD). In both otitis media
and COPD, patients routinely suffer recurrent episodes of disease
(15, 21). Factors such as health care costs, pain and
suffering, and lost work time underscore the need for a vaccine against
NTHI (10, 14, 22).
The ability of NTHI to cause recurrent infections is in part
attributable to antigenic variability in several surface-exposed loops
of major outer membrane protein P2 (2, 5, 26). The P2
protein is a homotrimeric porin which constitutes approximately one-half of the total outer membrane protein of the organism. The loop
5 region is highly heterogeneous among strains and contains almost all
of the epitopes to which an antibody response is mounted when animals
are immunized with the whole organism (30). Adults with
COPD make new antibodies to strain-specific epitopes on P2 following
infection by NTHI (31). Thus, immunity against NTHI is
most often strain specific, leaving the patient vulnerable to
reinfection by other strains.
One approach to vaccine development for NTHI has been to study
antigenically conserved outer membrane proteins as potential vaccine
antigens. In view of the abundant expression of P2 on the bacterial
surface, identification of a conserved region on the P2 molecule to
which immune responses could be directed would be a significant step
towards developing a vaccine against NTHI.
In this study, antibodies to a conserved loop of the P2 molecule of
NTHI (loop 6) were raised and studied for their ability to recognize
the P2 molecules of heterologous strains. Since bactericidal antibody
is associated with protection from otitis media due to NTHI (8,
25), antibodies to loop 6 were also assessed for their ability
to direct killing of heterologous strains.
 |
MATERIALS AND METHODS |
Bacterial strains.
The 15 strains of NTHI used in this study
were recovered from the sputum of adults with chronic bronchitis in
Buffalo, N.Y. The identities of strains were confirmed by growth
requirements for hemin and NAD. Strains were cultured on chocolate agar
at 35°C in 5% CO2. For bactericidal assays, bacteria
were grown in brain heart infusion broth supplemented with 10 µg of
hemin and 20 µg of NAD/ml at 35°C either in 5% CO2 or
with vigorous shaking.
Immunization of animals.
A 20-mer multiple antigenic peptide
(MAP) corresponding to the loop 6 sequence of the P2 molecule of NTHI
strain 5657 was ordered from QCB (Hopkinton, Mass.). The sequence of
the peptide was DSGYAKTKNYKDKHEKSYFV. A rabbit was immunized
as follows: 50 µg of loop 6 MAP in complete Freund's adjuvant was
administered subcutaneously on day 0, and 50 µg of loop 6 MAP in
incomplete Freund's adjuvant was administered subcutaneously on days
14 and 28. Blood was obtained on day 35.
Comparison of P2 sequences.
The sequences of P2 from 15 strains of NTHI were obtained from GenBank (2, 5, 6, 26).
The amino acid sequences in the loop 6 regions of these molecules were
compared using the MacVector program.
SDS-PAGE.
Samples were solubilized in sample buffer and
resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) on 12% gels as previously described (18). Gels
were stained with Coomassie blue or transferred to nitrocellulose for
immunoblot assays as previously described (17, 20).
Immunoblot assays.
Nitrocellulose membranes were blocked in
3% nonfat dry milk in Tris-buffered saline (TBS; 0.01 M Tris, 0.15 M
NaCl [pH 7.4]) for 1 h at room temperature. The membranes were
washed three times in TBS and incubated with a 1:500 dilution of
affinity-purified anti-loop 6 antibody in TBS at 4°C overnight.
Membranes were washed again as described above and incubated with a
1:3,000 dilution of peroxidase-labeled goat anti-rabbit immunoglobulin
G (Kirkegaard and Perry, Gaithersburg, Md.) in TBS. The membranes were
washed once again, and the bands were visualized by a brief incubation in horseradish peroxidase color development solution containing 0.15%
H2O2 (Bio-Rad Laboratories, Richmond, Calif.).
Recombinant fusion proteins.
Fusion proteins corresponding
to the exposed loops of the P2 molecule of NTHI 1479 were grown and
purified from previously constructed clones containing P2 gene
fragments in the pGEX-2T vector (13, 30).
Affinity purification of serum.
A loop 6 affinity column
with a bed volume of 1 ml was constructed using CNBr-Sepharose
(Pharmacia Biotech, Piscataway, N.J.) and loop 6 MAP according to the
manufacturer's instructions. Briefly, ~3 mg of loop 6 MAP dissolved
in 1.7 ml of coupling buffer (0.1 M NaHCO3, 0.5 M NaCl, pH
8.3) was incubated with 1 ml of CNBr-Sepharose (0.3 g of freeze-dried
beads reconstituted in 1 mM HCl) for 1 h at room temperature with
gentle agitation. The beads were washed in 8 ml of coupling buffer and
blocked in 0.2 M glycine, pH 8.0, for 2 h at room temperature. The
CNBr-Sepharose was subjected to three cycles of low-pH washes (0.1 M
CH3COOH, 0.5 M NaCl, pH 4.0) followed by high-pH washes
(0.2 M glycine, pH 8.0). Finally the beads were placed in a column and
washed with 5 ml of phosphate-buffered saline (PBS). A blank column was
constructed using the same method in the absence of MAP 6 peptide.
A 0.5-ml aliquot of rabbit anti-loop 6 serum was applied to the loop 6 affinity column, and the flowthrough was collected. Following a 15-ml
PBS wash, antibodies were eluted from the column with 2 ml of 0.1 M
glycine, pH 2.5. Eluate was collected in a 15-ml conical tube
containing 160 µl of 1 M Tris, pH 9.0, and the column was washed
again with 5 ml of PBS. The flowthrough was again applied to the column
and subjected to this procedure two more times. The eluates were
pooled. The pooled eluates were exchanged into PBS and concentrated to
0.5 ml using 10,000-Da-exclusion Centricon filters (Millipore, Bedford,
Mass.). To control for nonspecific binding of antibody to resin, this
same procedure was performed using a blank column.
Bactericidal assays.
Bacteria grown to mid-logarithmic phase
in broth were diluted to 5 × 104 CFU/ml in Gey's
balanced salt solution containing 10% (wt/vol) bovine serum albumin.
Reaction mixtures consisted of 25 µl of diluted bacteria, 22 µl of
complement, an appropriate volume of normal human serum (as a positive
control) or anti-loop 6 antibody, and 2.5% (vol/vol) fetal bovine
serum in Gey's balanced salt solution to bring the final volume to 250 µl. Normal human serum depleted of immunoglobulin G by adsorption
over a protein G column was used as a complement source. Normal human
serum was used as an antibody source in positive control assays. For
this purpose, the serum was heat inactivated at 56°C for 30 min. The
reaction mixtures were incubated at either 37°C with vigorous shaking
or at 35°C in 5% CO2. Duplicate 25-µl aliquots from
each reaction mixture were plated on chocolate agar at 0 and 60 min. In
some assays, additional samples were taken at 30 min. The plates were incubated at 35°C overnight, and the colonies were counted the next day.
Primer sequences.
Oligonucleotides used for the
amplification and sequencing of the loop 6-encoding region of the P2
gene were purchased from Sigma-Genosys (The Woodlands, Tex.). The
forward and reverse primers used in amplification, P2F1 (5'
ACGCGGATCCTGCTGTTGTTTATAACAACG) and P2R1 (5'
ATCAGGATCCTTAGAAGTAAACGCGTAAACCTAC), are complementary to regions
upstream and downstream of the P2 gene, respectively. Primers used for
sequencing were P2R1 and two oligonucleotides complementary to
sequences within the P2 gene, P2F2 (5' GGTGAAGTAAAACTTGGTC) and P2R2
(5' CAATAGACATTAGTATCTTCC).
Amplification of the loop 6-encoding region of the P2 gene.
Genomic DNA was isolated from strains of NTHI. Template DNA was
prepared from overnight cultures of NTHI grown on chocolate agar using
the Wizard genomic DNA prep kit according to the manufacturer's instructions (Promega, Madison, Wis.). The genomic DNA preparations were diluted 1:100, and 1 µl was added to reaction mixtures
containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2,
0.001% (wt/vol) gelatin, 200 µM (each) deoxynucleoside triphosphate
(dGTP, dATP, dTTP, and dCTP), 500 ng of each primer (P2F1 and P2R1),
and 1.25 U of AmpliTaq DNA polymerase in a 25-µl volume. Template DNA
was melted at 94°C for 3 min, followed by 35 amplification cycles of
30s at 94°C, 30s at 58°C, and 90 at 72°C. The amplicons were resolved on a 1% agarose gel and stained with ethidium bromide. Bands
were excised and purified with the Gene Clean kit (BIO 101, Vista,
Calif.). The products were diluted to a concentration of 10 to 20 ng/µl for sequencing.
DNA sequencing.
The DNA sequencing of the PCR products was
carried out by the Roswell Park Cancer Institute Biopolymer Facility
(Buffalo, N.Y.) using primers P2F2, P2R1, and P2R2.
 |
RESULTS |
Specificity of immunopurified antibodies to loop 6.
To assess
the specificity of antibodies immunopurified from the loop 6 affinity
column, a whole-cell preparation of NTHI 5657 (the homologous strain)
was subjected to SDS-PAGE and blotted onto nitrocellulose. Strips cut
from the blotted nitrocellulose membrane were probed with whole rabbit
anti-loop 6 serum (Fig. 1, lane a),
fall-through from a blank column (lane b), eluate from a blank column
(lane c), fall-through from a loop 6 affinity column (lane d), and
eluate from a loop 6 affinity column (lane e). A single band with the
mobility of the P2 molecule (~42 kDa) is seen in the strips probed
with whole rabbit anti-loop 6 serum and loop 6 affinity column eluate.
These data indicate that antibodies eluted from the loop 6 affinity
column are specific for P2 of NTHI 5657. The results from the blank
column exclude the possibility that antibodies in loop 6 antiserum
interact nonspecifically with CNBr-Sepharose beads.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 1.
Immunoblot assay with whole-bacterial-cell lysate of
NTHI strain 5657. The lysate was probed with fractions from aliquots of
rabbit anti-loop 6 antiserum subjected to affinity chromatography with
a loop 6 peptide column and a control blank column. Lanes: a, whole
rabbit anti-loop 6 antiserum; b, fall-through from control blank
column; c, sham eluate from blank column; d, fall-through from loop 6 affinity column; e, eluate from loop 6 affinity column. All serum
fractions were diluted 1:500. Arrow, location of P2.
|
|
To further evaluate the specificity of the antibodies recovered in the
loop 6 affinity column eluate, glutathione
S-transferase
(GST) fusion proteins corresponding to the eight loops of the
P2
protein of NTHI 1479 were expressed and purified using the
pGEX-2T
vector as previously described (
13). Loop 6 of NTHI
1479 differs from loop 6 of NTHI 5657 at a single residue (D to
A at
position 273; see Fig.
4). When subjected to immunoblot analysis,
immunopurified antibodies to loop 6 MAP bound exclusively to the
GST-loop 6 protein and purified P2 (Fig.
2). These data indicate
that antibodies
immunopurified from the loop 6 affinity column
are specific for loop 6 of the P2 molecule.

View larger version (120K):
[in this window]
[in a new window]
|
FIG. 2.
(Top) Coomassie blue-stained SDS gel. (Bottom)
Immunoblot assay with immunopurified anti-loop 6 peptide antiserum
(1:500 dilution). Lanes 1 through 8 (both panels), purified GST fusion
proteins corresponding to the eight loops of P2 of strain 1479; lanes
P2, purified P2 with some proteolytic degradation. Molecular mass
standards (kilodaltons) are on the left. The upper bands in lanes 6 likely represent dimerization of the fusion protein.
|
|
Bactericidal activity of anti-loop 6 antibodies for NTHI 5657.
To determine if immunopurified anti-loop 6 antibodies are bactericidal
against NTHI, bactericidal assays were performed using NTHI 5657. Reaction mixtures containing 20% anti-loop 6 antibodies or 5% normal
human serum exhibited significant killing in the presence of complement
at the 60-min time point (Fig. 3). At the 30-min time point, there was consistently more killing in the normal
human serum control than in the anti-loop 6 reaction mixture. Interestingly, these kinetics are similar to results with
immunopurified antibodies to P6 used in bactericidal assays
(19). No bactericidal activity was apparent in a control
reaction mixture in which both complement and the anti-loop 6 antibody
were omitted. Other controls included reaction mixtures containing
complement without anti-loop 6 antibody and anti-loop 6 antibody
without complement, both of which consistently showed no killing (Fig.
3). These results demonstrate that immunopurified antibodies raised
against peptides corresponding to the amino acid sequence of loop 6 of
the P2 protein of NTHI strain 5657 are bactericidal against strain
5657.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Results of bactericidal assay with NTHI strain 5657. Legend: 20% eluate w/C', immunopurified loop 6 antibodies comprised
20% of the bactericidal assay mixture, and complement was present in
the reaction mixture; 20% eluate w/o C', same as above except no
complement (negative control); C' only, complement was present in the
reaction mixture in the absence of antibody; 5% NHS w/C', normal human
serum comprised 5% of the bactericidal assay mixture, and complement
was present in the reaction mixture (positive control); no ab, no C',
bactericidal reaction mixture consisted of bacteria and buffer alone
(negative control).
|
|
Sequence homology in the loop 6 region of P2.
The amino acid
sequences of loop 6 from 11 of the strains used in this study and 15 strains of NTHI found in GenBank were compared using the Mac Vector
program. The 24 sequences are 87.3% identical on average to the loop 6 sequence of NTHI 5657 (Fig. 4). When the
24 strains were grouped geographically, it was found that the 19 strains isolated in the United States are 94.8% identical to NTHI 5657 in the loop 6 region, while the 5 strains isolated outside the United
States are 57.4% identical to NTHI 5657 in the loop 6 region.
Reactivities of antibodies to loop 6 with heterologous
strains.
To determine the strain specificity of antibodies to loop
6 of NTHI 5657, whole-cell preparations of 15 clinical isolates were
subjected to immunoblot assays. Figure 5
shows the results with nine strains. The immunopurified loop 6 antibodies bound to a band corresponding to P2 in 14 of the 15 clinical
isolates of NTHI. These data indicate that antibodies to loop 6 of NTHI 5657 bind to P2 of multiple strains of NTHI.

View larger version (122K):
[in this window]
[in a new window]
|
FIG. 5.
Immunoblot assay with immunopurified rabbit anti-loop 6 antiserum (1:500 dilution). Lanes contain whole-bacterial-cell lysates
of the following strains of NTHI: 5657(a), 6P18H1(b), 11P6H1(c),
5P11H1(d), 56P34H1(e), 70P11H1(f), 1479(g), 74P15H1(h), and 13P24H1
(i). Molecular mass standards (kilodaltons) are on the left.
|
|
In order to test the hypothesis that immunopurified antibodies against
loop 6 of P2 are bactericidal against multiple strains,
bactericidal
assays with the 15 clinical isolates used in the
immunoblot assay were
performed. Immunopurified antibodies to
loop 6 of P2 of NTHI 5657 showed >50% kill against 8 of the 15
strains tested (Fig.
6). Not surprisingly, no killing of the
strain
which was nonreactive in the immunoblot (strain 11P6H; Fig.
5,
lane c) was observed. Sequence, bactericidal, and immunoblot data
are
summarized in Table
1. Interestingly,
sequence differences
are restricted to a small region corresponding to
amino acids
263 to 265 of the homologous strain (see Discussion).
Controls
included reaction mixtures in which complement, anti-loop 6 antibody,
or both complement and anti-loop 6 antibody were omitted. No
killing
was observed in any of these controls.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 6.
Results of bactericidal assays with immunopurified
anti-loop 6 antibodies for 15 clinical isolates of NTHI (percentages of
killing at 60 min). Strains of NTHI are as follows: 1, 5657; 2, 1479;
3, 5P11H1; 4, 13P24H1; 5, 3P16H1; 6, 6P18H1; 7, 11P6H1; 8, 56P34H1; 9, 74P15H1; 10, 70P11H1; 11, 54P24H1; 12, 6P5H; 13, 6P8H; 14, 14P8H1; 15, 37P5H1.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Summary of loop 6 amino acid sequences and results of
immunoblot and bactericidal assays of clinical isolates of NTHI
|
|
 |
DISCUSSION |
In this study we have demonstrated that antibodies from rabbits
vaccinated with loop 6 MAP can be recovered intact by affinity chromatography. The specificity of these antibodies for loop 6 of the
P2 molecule was established by probing immunoblots of NTHI 5657 whole-organism lysate and GST fusion proteins corresponding to the
loops of the P2 molecule. Comparison of the loop 6 sequences from the
P2 molecules of 24 strains of NTHI revealed an average identity of
87.3%, with higher identity in geographically related strains.
Immunoblot analysis of whole-organism lysates of 15 clinical isolates
revealed that the anti-loop 6 antibody recognized P2 in 14 of the 15 isolates. In bactericidal assays, the immunopurified antibody was
bactericidal against the homologous isolate, as well as 7 of 14 heterologous clinical isolates.
Comparison of sequence, bactericidal, and immunoblot data reveals that
amino acids 263 to 265 (Tyr-Lys-Asp) of strain 5657 are important in
the recognition of the molecule by antibodies in immunoblot and
bactericidal assays. The sequence of loop 6 of strain 11P6H1 differs
exclusively in this region (Lys-Ala-Ala), accounting for negative
bactericidal and immunoblot assays with anti-loop 6 antibodies. On the
other hand, strains whose loop 6 sequence was identical to that of
strain 5657 all bound antibodies in both immunoblot and bactericidal
assays (Table 1). Table 1 shows strains with two sequences in which one
of the three amino acids is different (His-Lys-Asp and Tyr-Lys-Ala).
Anti-loop 6 antibodies bind these strains in immunoblot assays but show
variable results in bactericidal assays. For example, strains 6P8H and 6P18H1 have identical loop 6 sequences and are both reactive in an
immunoblot assay (Table 1). In spite of identical sequences, 6P8H is
sensitive to bactericidal antibodies while 6P18H1 resists bactericidal
killing. Based on the results summarized in Table 1, we conclude that
two different mechanisms account for differences in the
susceptibilities of strains to killing by anti-loop 6 antibodies. One
mechanism is differences in the sequences of amino acids 263 to 265 of
some strains (e.g., 5657 and 11P6H1). However, since strains with
identical amino acid sequences in this region show differences in
susceptibility to killing (e.g., 1479 and 54P24H1), other mechanisms
must be operative as well. We speculate that differences in surface
structures adjacent to P2 among NTHI strains affect the availability of
epitopes on loop 6 to antibodies or possibly affect the ability of
bound antibodies to fix complement.
Two attributes of the P2 protein of NTHI make antigenically conserved
regions of this molecule attractive as vaccine antigens. First, P2 is
abundantly expressed on the bacterial surface, comprising approximately
one-half of the total outer membrane protein of the organism.
Immunoelectron microscopy indicates that a panel of monoclonal
antibodies directed against surface-exposed regions of the P2 molecule
recognize abundantly expressed epitopes (12). These same
monoclonal antibodies were highly bactericidal against the homologous
strain in the presence of complement. Second, P2 is the only known
porin expressed by NTHI and P2-deficient mutants exhibit slow growth
(4). Thus, the immune response would target abundant
epitopes on a molecule whose expression is not likely to be down regulated.
Two observations concerning the P2 molecule of NTHI cast doubt on the
suitability of conserved regions of this molecule as vaccine antigens.
Work by van Alphen and colleagues has demonstrated that regions of the
P2 gene encoding surface-exposed loops undergo point mutations under
immune selective pressure (6, 7, 11, 28). This observation
raises the possibility that point mutations could occur in conserved
loops targeted as vaccine antigens and render a vaccine useless.
However, these point mutations were observed in two patients with COPD
persistently infected with a single strain of NTHI over the course of 5 and 6 months. Similar results were observed in strains maintained in
subcutaneous cages in rabbits for 15 months (29). Recent
work involving a prospective study of COPD has demonstrated that active
turnover of strains of NTHI occurs in adults with COPD
(23; our unpublished observations). Furthermore, Faden et
al. (9) showed that the mean duration of colonization by a
single strain of NTHI in the nasopharynges of children is 2 months.
These studies suggest that persistence of a strain of NTHI in the
respiratory tract may be the exception rather than the rule. Since
point mutations are a phenomenon associated with persistent
colonization, it remains to be determined how commonly point mutations
in the P2 molecule occur as a mechanism to evade the human immune response.
Another potential drawback to using conserved regions of the P2
molecule as vaccine antigens was raised by the work of Smith-Vaughn et
al. (27), who demonstrated horizontal transfer of P2 genes in four Aboriginal infants persistently colonized with multiple strains
of NTHI. The children of this community are colonized by NTHI by the
age of 3 weeks and have otitis media by the age of 6 weeks, and 50%
have perforated ear drums by the age of 6 months (16).
Each child carries an average of four strains of NTHI at a time. It is
possible that horizontal transfer of a P2 gene encoding P2 with highly
heterogeneous surface-exposed regions would function as a mechanism to
evade a protective immune response. However, the chronic and severe
nature of the disease in this select population may be unique. Similar
studies of infants and children in Buffalo, N.Y., have demonstrated
that children are colonized with a single strain of NTHI at a time
(3) and are colonized for shorter periods of time
(9). Studies from Sweden show colonization rates which are
similar to those from the Buffalo study (1, 24). Future
studies are needed to address the question of whether horizontal
transfer of the P2 gene is an important mechanism of immune system evasion.
Although loop 6 generally shows sequence conservation among strains,
some isolates have loop 6 sequences that are remarkably different. For
example, strains 12049 (a blood isolate from a child in Pakistan) and
d1 and t1 (sputum isolates from persistently infected adults in The
Netherlands) all show little similarity to other strains after the
first seven residues of loop 6. However, it is difficult to link these
differences to geography alone, since other isolates from the same
areas had loop 6 sequences which were similar or identical to that of
our homologous strain (e.g., strains 12085 and A930010). Indeed Duim et
al. (5) have observed that in Dutch isolates, sequence
heterogeneity in loop 6 is observed exclusively in strains which have
persisted in the respiratory tracts of adults with chronic lung
disease. Middle-ear isolates and isolates which colonize the adult
respiratory tract for shorter periods demonstrate a high degree of
sequence conservation among strains in the loop 6 region of P2
(5). A speculation that might explain this phenomenon is
that a progenitor of these three strains somehow acquired an insertion
in the loop 6 region. Increased loop size as the result of an insertion
would make epitopes contained on the distal portion of the loop more
accessible to the immune system, subjecting the organism to selective
pressure. Point mutations which allow the organism to escape a specific immune response would be selected for, resulting in sequence
heterogeneity. The portions of the loop more proximal to the outer
membrane would be affected the least by selective pressure from the
immune system and would remain unchanged. This hypothesis would account
for the homology among the first seven and last six amino acids in loop
6 of these three strains.
In view of the association of bactericidal antibodies with protection
from infection (8, 25), the results presented here support
the feasibility of inducing a protective immune response to loop 6 of
the P2 molecule of NTHI. Further work may focus on identifying other
conserved, surface-exposed loops of P2. Utilizing more than one loop
will contribute to overcoming potential antigenic heterogeneity and
point mutations as mechanisms of immune system evasion since multiple
mutations would be required to evade antibodies to multiple loops.
 |
ACKNOWLEDGMENTS |
This work was supported by grant AI19641 from the National
Institute of Allergy and Infectious Diseases and the Department of
Veterans Affairs.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: VA Western New
York Healthcare System, Medical Research 151, 3495 Bailey Ave.,
Buffalo, NY 14215. Phone: (716) 862-7874. Fax: (716) 862-6526. E-mail: murphyt{at}acsu.buffalo.edu.
Editor:
D. L. Burns
 |
REFERENCES |
| 1.
|
Aniansson, G.,
B. Alm,
B. Andersson,
P. Larsson,
O. Nylen,
H. Peterson,
P. Rigner,
M. Svanborg, and C. Svanborg.
1992.
Nasopharyngeal colonization during the first year of life.
J. Infect. Dis.
165(Suppl. 1):S38-S42.
|
| 2.
|
Bell, J.,
S. Grass,
D. Jeanteur, and R. S. Munson, Jr.
1994.
Diversity of the P2 protein among nontypeable Haemophilus influenzae isolates.
Infect. Immun.
62:2639-2643[Abstract/Free Full Text].
|
| 3.
|
Bernstein, J. M.,
D. Dryja,
N. Yuskiw, and T. F. Murphy.
1997.
Analysis of isolates recovered from multiple sites of the nasopharynx of children colonized by nontypeable Haemophilus influenzae.
Eur. J. Clin. Microbiol. Infect. Dis.
16:750-753[CrossRef][Medline].
|
| 4.
|
Cope, L. D.,
S. E. Pelzel,
J. L. Latimer, and E. J. Hansen.
1990.
Characterization of a mutant of Haemophilus influenzae type b lacking the P2 major outer membrane protein.
Infect. Immun.
58:3312-3318[Abstract/Free Full Text].
|
| 5.
|
Duim, B.,
J. Dankert,
H. M. Jansen, and L. van Alphen.
1993.
Genetic analysis of the diversity in outer membrane protein P2 of non-encapsulated Haemophilus influenzae.
Microb. Pathog.
14:451-462[CrossRef][Medline].
|
| 6.
|
Duim, B.,
L. van Alphen,
P. Eijk,
H. M. Jansen, and J. Dankert.
1994.
Antigenic drift of non-encapsulated Haemophilus influenzae major outer membrane protein P2 in patients with chronic bronchitis is caused by point mutations.
Mol. Microbiol.
11:1181-1189[CrossRef][Medline].
|
| 7.
|
Duim, B.,
L. Vogel,
W. Puijk,
H. M. Jansen,
R. H. Meloen,
J. Dankert, and L. van Alphen.
1996.
Fine mapping of outer membrane protein P2 antigenic sites which vary during persistent infection by Haemophilus influenzae.
Infect. Immun.
64:4673-4679[Abstract].
|
| 8.
|
Faden, H.,
J. Bernstein,
L. Brodsky,
J. Stanievich,
D. Krystoflk,
C. Shuff,
J. J. Hong, and P. L. Ogra.
1989.
Otitis media in children. I. The systemic immune response to nontypeable Haemophilus influenzae.
J. Infect. Dis.
160:999-1004[Medline].
|
| 9.
|
Faden, H.,
L. Duffy,
A. Williams,
Tonawanda/Williamsville Pediatrics,
D. A. Krystofik, and J. Wolf.
1995.
Epidemiology of nasopharyngeal colonization with nontypeable Haemophilus influenzae in the first 2 years of life.
J. Infect. Dis.
172:132-135[Medline].
|
| 10.
|
Foxwell, A. R.,
J. M. Kyd, and A. W. Cripps.
1998.
Nontypeable Haemophilus influenzae: pathogenesis and prevention.
Microbiol. Mol. Biol. Rev.
62:294-308[Abstract/Free Full Text].
|
| 11.
|
Groeneveld, K.,
L. van Alphen,
C. Voorter,
P. P. Eijk,
H. M. Jansen, and H. C. Zanen.
1989.
Antigenic drift of Haemophilus influenzae in patients with chronic obstructive pulmonary disease.
Infect. Immun.
57:3038-3044[Abstract/Free Full Text].
|
| 12.
|
Haase, E. M.,
A. A. Campagnari,
J. Sarwar,
M. Shero,
M. Wirth,
C. U. Cumming, and T. F. Murphy.
1991.
Strain-specific and immunodominant surface epitopes of the P2 porin protein of nontypeable Haemophilus influenzae.
Infect. Immun.
59:1278-1284[Abstract/Free Full Text].
|
| 13.
|
Haase, E. M.,
K. Yi,
G. D. Morse, and T. F. Murphy.
1994.
Mapping of bactericidal epitopes on the P2 porin protein of nontypeable Haemophilus influenzae.
Infect. Immun.
62:3712-3722[Abstract/Free Full Text].
|
| 14.
|
Kaplan, B.,
T. L. Wandstrat, and J. R. Cunningham.
1997.
Overall cost in the treatment of otitis media.
Pediatr. Infect. Dis. J.
16:S9-S11[CrossRef][Medline].
|
| 15.
|
Klein, J. O.
1994.
Otitis media.
Clin. Infect. Dis.
19:823-833[Medline].
|
| 16.
|
Leach, A. J.,
J. B. Boswell,
V. Asche,
T. G. Nienhuys, and J. D. Mathews.
1994.
Bacterial colonization of the nasopharynx predicts very early onset and persistence of otitis media in Australian Aboriginal infants.
Pediatr. Infect. Dis. J.
13:983-989[Medline].
|
| 17.
|
Murphy, T. F., and L. C. Bartos.
1988.
Purification and analysis with monoclonal antibodies of P2, the major outer membrane protein of nontypeable Haemophilus influenzae.
Infect. Immun.
56:1084-1089[Abstract/Free Full Text].
|
| 18.
|
Murphy, T. F.,
L. C. Bartos,
A. A. Campagnari,
M. B. Nelson, and M. A. Apicella.
1986.
Antigenic characterization of the P6 protein of nontypeable Haemophilus influenzae.
Infect. Immun.
54:774-779[Abstract/Free Full Text].
|
| 19.
|
Murphy, T. F.,
L. C. Bartos,
P. A. Rice,
M. B. Nelson,
K. C. Dudas, and M. A. Apicella.
1986.
Identification of a 16,600-dalton outer membrane protein on nontypeable Haemophilus influenzae as a target for human serum bactericidal antibody.
J. Clin. Investig.
78:1020-1027.
|
| 20.
|
Murphy, T. F.,
K. C. Dudas,
J. M. Mylotte, and M. A. Apicella.
1983.
A subtyping system for nontypeable Haemophilus influenzae based on outer-membrane proteins.
J. Infect. Dis.
147:838-846[Medline].
|
| 21.
|
Murphy, T. F., and S. Sethi.
1992.
Bacterial infection in chronic obstructive pulmonary disease.
Am. Rev. Respir. Dis.
146:1067-1083[Medline].
|
| 22.
|
Murphy, T. F., and S. Sethi.
1997.
A national strategy for research in chronic obstructive pulmonary disease.
JAMA
277:1596[Abstract/Free Full Text].
|
| 23.
|
Murphy, T. F.,
S. Sethi,
K. L. Klingman,
A. B. Brueggemann, and G. V. Doern.
1999.
Simultaneous respiratory tract colonization by multiple strains of nontypeable Haemophilus influenzae in chronic obstructive pulmonary disease: implications for antibiotic therapy.
J. Infect. Dis.
180:404-409[CrossRef][Medline].
|
| 24.
|
Samuelson, A.,
A. Freijd,
J. Jonasson, and A. A. Lindberg.
1995.
Turnover of nonencapsulated Haemophilus influenzae in the nasopharynges of otitis-prone children.
J. Clin. Microbiol.
33:2027-2031[Abstract].
|
| 25.
|
Shurin, P. A.,
S. I. Pelton,
I. B. Tazer, and D. L. Kasper.
1980.
Bactericidal antibody and susceptibility to otitis media caused by nontypeable strains of Haemophilus influenzae.
J. Pediatr.
97:364-369[CrossRef][Medline].
|
| 26.
|
Sikkema, D. J., and T. F. Murphy.
1992.
Molecular analysis of the P2 porin protein of nontypeable Haemophilus influenzae.
Infect. Immun.
60:5204-5211[Abstract/Free Full Text].
|
| 27.
|
Smith-Vaughan, H. C.,
K. S. Sriprakash,
J. D. Mathews, and D. J. Kemp.
1997.
Nonencapsulated Haemophilus influenzae in aboriginal infants with otitis media: prolonged carriage of P2 porin variants and evidence for horizontal P2 gene transfer.
Infect. Immun.
65:1468-1474[Abstract].
|
| 28.
|
van Alphen, L.,
P. Eijk,
L. Geelen-van den Broek, and J. Dankert.
1991.
Immunochemical characterization of variable epitopes of outer membrane protein P2 of nontypeable Haemophilus influenzae.
Infect. Immun.
59:247-252[Abstract/Free Full Text].
|
| 29.
|
Vogel, L.,
B. Duim,
F. Geluk,
P. Eijk,
H. Jansen,
J. Dankert, and L. van Alphen.
1996.
Immune selection for antigenic drift of major outer membrane protein P2 of Haemophilus influenzae during persistence in subcutaneous tissue cages in rabbits.
Infect. Immun.
64:980-986[Abstract].
|
| 30.
|
Yi, K., and T. F. Murphy.
1997.
Importance of an immunodominant surface-exposed loop on outer membrane protein P2 of nontypeable Haemophilus influenzae.
Infect. Immun.
65:150-155[Abstract].
|
| 31.
|
Yi, K.,
S. Sethi, and T. F. Murphy.
1997.
Human immune response to nontypeable Haemophilus influenzae in chronic bronchitis.
J. Infect. Dis.
176:1247-1252[Medline].
|
Infection and Immunity, February 2001, p. 773-778, Vol. 69, No. 2
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.2.773-778.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pang, B., Winn, D., Johnson, R., Hong, W., West-Barnette, S., Kock, N., Swords, W. E.
(2008). Lipooligosaccharides Containing Phosphorylcholine Delay Pulmonary Clearance of Nontypeable Haemophilus influenzae. Infect. Immun.
76: 2037-2043
[Abstract]
[Full Text]
-
Prather, D. T., Bains, M., Hancock, R. E. W., Filiatrault, M. J., Campagnari, A. A.
(2004). Differential Expression of Porins OmpP2A and OmpP2B of Haemophilus ducreyi. Infect. Immun.
72: 6271-6278
[Abstract]
[Full Text]
-
Novotny, L. A., Bakaletz, L. O.
(2003). The Fourth Surface-Exposed Region of the Outer Membrane Protein P5-Homologous Adhesin of Nontypable Haemophilus influenzae Is an Immunodominant But Nonprotective Decoying Epitope. J. Immunol.
171: 1978-1983
[Abstract]
[Full Text]
-
Galdiero, S., Capasso, D., Vitiello, M., D'Isanto, M., Pedone, C., Galdiero, M.
(2003). Role of Surface-Exposed Loops of Haemophilus influenzae Protein P2 in the Mitogen-Activated Protein Kinase Cascade. Infect. Immun.
71: 2798-2809
[Abstract]
[Full Text]
-
Davies, R. L., MacCorquodale, R., Baillie, S., Caffrey, B.
(2003). Characterization and comparison of Pasteurella multocida strains associated with porcine pneumonia and atrophic rhinitis. J Med Microbiol
52: 59-67
[Abstract]
[Full Text]