Previous Article | Next Article 
Infection and Immunity, March 2001, p. 1581-1586, Vol. 69, No. 3
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.3.1581-1586.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Staphylococcus aureus and Salmonella
enterica Serovar Dublin Induce Tumor Necrosis
Factor-Related Apoptosis-Inducing Ligand Expression by Normal Mouse
and Human Osteoblasts
Emily H.
Alexander,
Jennifer
L.
Bento,
Francis M.
Hughes Jr.,
Ian
Marriott,
Michael C.
Hudson,* and
Kenneth L.
Bost
Department of Biology, University of North
Carolina at Charlotte, Charlotte, North Carolina 28223
Received 21 August 2000/Returned for modification 10 November
2000/Accepted 1 December 2000
 |
ABSTRACT |
Staphylococcus aureus and Salmonella
enterica serovar Dublin invade osteoblasts and are causative
agents of human bone disease. In the present study, we examined the
ability of S. aureus and Salmonella
serovar Dublin to induce the production of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) by normal osteoblasts. Normal mouse and human osteoblasts were cocultured with S.
aureus or Salmonella serovar Dublin at different
multiplicities of infection. Following initial incubation and
examination of TRAIL expression, extracellular bacteria were killed by
the addition of media containing the antibiotic gentamicin. Lysates and
conditioned media from osteoblast cultures were then collected at
various times following invasion and analyzed. The results demonstrated
that S. aureus and Salmonella serovar
Dublin are potent inducers of TRAIL expression by osteoblasts. Mouse
and human TRAIL mRNA expression was induced by bacterial infection and
demonstrated a dose-dependent response. Analysis of kinetics suggested
that TRAIL mRNA was induced within 30 min after exposure to bacteria
and that its level of expression remained relatively constant
over the time period examined. mRNA molecules encoding TRAIL receptors
were constitutively expressed by osteoblasts. Furthermore, TRAIL
protein was detected as early as 45 min and up to 24 h following
infection. The quantity of TRAIL protein produced also increased in a
dose-dependent manner. Collectively, these findings suggest a mechanism
whereby bacterial pathogens mediate bone destruction via osteoblast apoptosis.
 |
INTRODUCTION |
Staphylococcus aureus is a
common cause of bone and joint infections in humans. Infections can be
a complication of septicemia or can follow local trauma to the
implicated tissue. The pathogenesis of staphylococcal bone and joint
infection is currently poorly understood but is likely to be
multifactorial. Bacterial virulence determinants are important in
infection, as are host factors, such as immune status and the presence
of underlying disease.
S. aureus is a capable bone pathogen in part because it
possesses several cell surface adhesion molecules that facilitate its
binding to the bone matrix. Binding involves a family of adhesins that
interact with extracellular matrix components, and these adhesins have
been termed microbial surface components recognizing adhesive
matrix molecules (MSCRAMMs) (26). Specific MSCRAMMs are responsible for the localization of S. aureus to bone
tissue (14). Once the bacteria adhere to and colonize the
bone matrix, they elaborate several virulence factors, such as
proteases, which can break down matrix components. The resultant bone
destruction facilitates bacterial invasiveness.
S. aureus is generally not considered a significant
intracellular pathogen compared to species of genera such as
Listeria and Shigella; however, there is growing
evidence that S. aureus has the ability to invade epithelial
and endothelial cells (1, 2, 3, 22, 34). Regarding
infection of bone, S. aureus has the ability to invade mouse
and human osteoblast cell lines (7, 16). Experiments with
these cell lines indicated that actin microfilaments, microtubules, and
receptor-mediated endocytosis are used in the internalization of
S. aureus into osteoblasts; however, microfilaments
seem to play the most significant role in the invasion process.
S. aureus also has the ability to invade normal human
osteoblasts. Human osteoblasts infected with S. aureus express high levels of interleukin 6 (IL-6) and IL-12 p75, as indicated
by complementary investigations demonstrating S. aureus-induced up-regulation of IL-6, IL-12 p40 mRNA expression,
and IL-6 and IL-12 p75 secretion by these cells (6). In
addition, a quantitative bioassay demonstrated that IL-12 p75 secreted
following infection was biologically active (6). These
studies were the first to demonstrate induced IL-12 p75 expression by
osteoblasts and suggest a previously unrecognized role for osteoblasts
in initiating immune responses following S. aureus infection.
Finally, S. aureus has been shown to invade normal chicken
osteoblasts both in vitro and in vivo (15, 29). S. aureus cells were found in approximately 14% of calvarial
osteoblasts after subcutaneous injection of chicken embryos and in 11%
of calvarial and tibial osteoblasts after intra-allantoic injection. As
in in vitro studies, most intracellular bacteria are eventually free in
the osteoblast cytoplasm in vivo. S. aureus cells in
calvariae and tibiae were also observed in the cytoplasm of
approximately 4% of the osteocytes in the mineralized bone matrix.
Therefore, osteoblasts containing internalized S. aureus
cells continue differentiating into osteocytes.
Observations that S. aureus invades osteoblasts, persists
intracellularly, and induces proinflammatory cytokine secretion indicate that the intracellular survival of the bacterium may be
involved in bone infection. Evidence that invasion occurs in vivo
further justifies this presumption. S. aureus sequestered from the host immune system in the osteoblast intracellular environment may provide a reservoir of bacteria for recurring osteomyelitis and may
be more relevant to chronic disease than bacteria associated with the
bone matrix.
It has been reported that S. aureus surface-associated
proteins are potent stimulators of bone resorption (24)
and that stimulation of osteoclast formation by the proteins plays a
role in bone destruction (21). Induction of the apoptotic
pathway in osteoblasts following internalization (31)
likely exacerbates the bone destruction characteristic of infection. In
the present study, we examined one potential mechanism of apoptosis
induction in normal mouse and human osteoblasts. We report that the
bone pathogens S. aureus and Salmonella enterica
serovar Dublin are surprisingly potent inducers of tumor necrosis
factor-related apoptosis-inducing ligand (TRAIL). These results
suggest a pathway for bacterium-induced osteoblast apoptosis which has
not previously been considered.
 |
MATERIALS AND METHODS |
Normal mouse osteoblast cell culture
Normal
osteoblast cell cultures were prepared from mouse neonates according to
a method previously described for chicken embryos (28).
Bone-forming cells were isolated from mouse neonate calvariae by
sequential collagenase and protease digestions. The periostea were
removed, the frontal bones were harvested free of the suture regions,
and the bones were incubated for 10 min at 37°C in 10 ml of digestion
medium, containing collagenase (375 U/ml, type VII; Sigma Chemical
Company, St. Louis, Mo.) and protease (7.5 U/ml; Sigma). The digestion
medium and released cells were removed and discarded. Ten milliliters
of fresh digestion medium was added, and incubation was continued for
20 min. Cells were harvested by centrifugation and rinsed three times
in 25 mM HEPES-buffered Hanks' balanced salt solution (pH 7.4; HBSS).
The digestion step was repeated twice, and the three cell isolates were
pooled in mouse osteoblast growth medium (OBGM), consisting of
Dulbecco's modified Eagle's medium containing 25 mM HEPES, 10% fetal
bovine serum (Sigma), 2 g of sodium bicarbonate per liter, 75 µg
of glycine/ml, 100 µg of ascorbic acid/ml, 40 ng of vitamin
B12/ml, 2 µg of p-aminobenzoic acid/ml,
200 ng of biotin/ml, and penicillin (100 U/ml)-streptomycin (100 µg/ml)-amphotericin B (Fungizone; 0.25 µg) (pH 7.4)
(27). Cells were seeded in six-well cluster plates and
incubated at 37°C in a 5% CO2 atmosphere until they
reached confluence (6 to 7 days).
Characterization of normal mouse osteoblasts.
Mouse
osteoblasts were grown on glass coverslips in 24-well plates until they
were confluent; they were then fixed and permeabilized using
CytoFix/CytoPerm according to the methods recommended by the
manufacturer (PharMingen, San Diego, Calif.). Rabbit antibodies specific for osteocalcin (1:100 dilution; Peninsula Laboratories, Belmont, Calif.), type I collagen (1:40 dilution; Chemicon, Temecula, Calif.), alkaline phosphatase (1:40 dilution; Sigma), or keyhole limpet
hemocyanin (1:40 dilution) were incubated on cell preparations for 45 min at 4°C. After unbound antibody was washed off, a
phycoerythrin-conjugated goat anti-rabbit immunoglobulin G antibody
(1:50 dilution; Sigma) was added for 45 min at 4°C. After the samples
were washed, at least 500 cells were scored for positive fluorescence
using an Olympus BX60 fluorescence microscope. Osteocalcin, type I
collagen, and alkaline phosphatase were selected for analysis, since
the expression of these proteins has been used to define osteoblasts as
such (9, 20, 30).
Normal human osteoblast cultures.
Normal human osteoblasts
(Clonetics, San Diego, Calif.) were propagated according to the
guidelines provided by the vendor. Cells were seeded in
25-cm2 flasks and incubated at 37°C in a 5%
CO2 atmosphere in medium supplied by the
manufacturer; this medium contains 10% fetal bovine serum, ascorbic
acid, and gentamicin. After the cells reached approximately 80%
confluence (5 to 9 days), they were removed from flasks with 0.025%
trypsin-0.01% EDTA, washed in medium, and seeded into six-well
plates. Cells were used as described below once they reached
approximately 80% confluence (6 to 7 days). These commercially
available cells have been extensively characterized as osteoblasts
(9, 13).
Bacterial strains and growth conditions
S. aureus strain UAMS-1 (ATCC 49230) (osteomyelitis
clinical isolate) and Salmonella serovar Dublin strain
1363 were grown separately overnight in 5 ml of tryptic soy broth at
37°C with aeration. Bacteria were harvested by centrifugation for 10 min at 4,300 × g and 4°C and washed in 5 ml of
HBSS. Bacteria were then resuspended in either mouse or human OBGM.
Infection and invasion assay
Following
resuspension of bacteria in OBGM, bacterial cell density was determined
via spectrophotometric analysis. Cells were then diluted in OBGM to
obtain the desired multiplicity of infection (MOI). Osteoblasts were
infected with S. aureus at an MOI of 25:1, 75:1, or
250:1 or with Salmonella serovar Dublin at an MOI of 1:1, 3:1, or 10:1. The highest MOIs used for each organism
resulted in approximately one internalized bacterium per osteoblast in cultures (data not shown). Following either 30 or 45 min of infection, osteoblasts were either lysed by the addition of 0.1% Triton X-100 with incubation for 5 min at 37°C or washed three times with HBSS and
incubated in medium containing 25 µg of gentamicin per ml to kill
extracellular bacteria. At various times following bacterial invasion, osteoblasts were lysed, and osteoblast RNA or protein was
isolated for further analysis.
RNA isolation, RT, and semiquantitative PCR.
At 30 min as
well as 6 h following bacterial infection, RNA was extracted from
either normal mouse or normal human osteoblasts, reverse transcribed,
and subjected to semiquantitative reverse transcription (RT)-PCR as
previously described (4, 5). Briefly, total RNA was
isolated using TRIZOL reagent (Gibco-BRL, Gaithersburg, Md.),
and 2 µg of total RNA was reverse transcribed in the presence of
random hexamers using 200 U of RNase H-negative Moloney murine leukemia virus reverse transcriptase (Superscript II; Gibco-BRL) in the
buffer supplied by the manufacturer. PCR was performed on 5% of the
total cDNA to quantify the expression of the mRNAs encoding TRAIL,
TRAIL receptors, and glyceraldehyde-3-phosphate dehydrogenase (G3PDH).
Cycles consisted of 95°C denaturation, 60°C annealing, and 72°C
extension (Robocycler 40; Stratagene, La Jolla, Calif.), with the first
3 of 27 total cycles having extended denaturation and annealing times.
PCR primers were derived from published sequences and were
designed for optimal amplifications using Oligo 4.0 primer analysis software (National Biosciences, Inc., Plymouth, Minn.). Primers were
also selected based on their utility for the amplification of a minimum
of 250 bp from the cDNA, their identity with different exons of the
genomic sequence for each gene, and the lack of significant homology
with other sequences. Positive- and negative-strand primers were as
follows: G3PDH, GGAGCCAAACGGGTCATCATCTC and
ATGCCTGCTTCACCACCTTCTTG; mouse TRAIL,
CAAAGACGGATGAGGATTTCTGGGACT and TGAATGCCCTTTCCGAGAGGACTCC; mouse TRAIL receptor, GGTTCCAGTAGTGCTGCTGATTGGA and
CGACCATTCGGATTTGATTGTCTG; human TRAIL,
CCAATGACGAAGAGAGTATGAACAGCC and GTTGCTCAGGAATGAATGCCCACTC; human TRAIL receptor 1 (R1), GGGATGGTCAAGGTCAAGGATTGTAC
and CTGCTCAGAGACGAAAGTGGACAGC; and human TRAIL
receptor 2 (R2), TATAGCACTCACTGGAATGACCTCCTTT and ACCACCACCTGAGCAGATGCCTTTC.
Following PCR, 15% of each amplified sample was electrophoresed in
ethidium bromide-stained agarose gels and visualized by UV
illumination. PCR amplification of the housekeeping gene, the G3PDH
gene, was performed on cDNA from each sample to ensure equal input of
RNA and similar efficiencies of RT.
Protein isolation, SDS-PAGE, and Western immunoblot
analysis.
At 45 min as well as 6, 12, and 24 h
following infection, normal human osteoblasts were lysed using 2×
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
denaturing buffer; proteins were separated via electrophoresis as
described previously (18). Supernatants were also
collected from some infected osteoblast cultures and concentrated using
Centricon YM-30 centrifugal filter devices (Millipore Corporation,
Bedford, Mass.). The concentrated supernatant samples were mixed with
2× SDS-PAGE denaturing buffer; proteins were separated via
electrophoresis. S. aureus suspensions devoid of osteoblasts
and purified TRAIL protein (amino-terminal histidine-tagged recombinant
human TRAIL [21 kDa]; R & D Systems, Inc., Minneapolis, Minn.) were
also treated as described above, followed by electrophoresis. Proteins
were then electrotransferred to polyvinylidene difluoride membranes and
incubated with either anti-TRAIL polyclonal antibodies (StressGen,
Victoria, British Columbia, Canada) or anti-phosphorylated MKK3 or
MKK6 polyclonal antibodies (New England Biolabs, Inc., Beverly,
Mass.). A secondary, anti-rabbit horseradish
peroxidase-conjugated antibody (New England Biolabs) was used to
visualize reactive proteins. All antibodies were diluted prior to use
according to company recommendations.
 |
RESULTS |
TRAIL and TRAIL receptor mRNA expression.
The
mechanisms which function to induce apoptosis of osteoblasts during
bone infections have not been defined. For this reason, we began an
investigation to identify apoptosis-related genes expressed during
infection of osteoblasts with bacterial pathogens. Using RT-PCR
detection kits (CytoXpress multiplex human apoptosis sets 2 and 3;
BioSource International, Camarillo, Calif.), we first screened cultured
human osteoblasts for the expression of a variety of apoptosis-related
genes which were candidates for induction following infection. Results
from these studies (Fig. 1) suggested
that TRAIL and perhaps caspase 8 were induced following S. aureus infection of osteoblasts. A detailed analysis of TRAIL and
TRAIL receptor expression by infected osteoblasts was then undertaken.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 1.
RT-PCR analysis of apoptosis-related genes in normal
human osteoblasts infected with S. aureus at an MOI of
250:1 (S. aureus organisms to osteoblasts). PCR
amplification was performed as recommended by BioSource International.
Gene expression was monitored at 6 h following the addition of
viable bacteria. Bcl-xL, B-cell lymphoma gene × Long; Bcl-2, B-cell
lymphoma 2; Bax, Bcl-2-associated × protein; Fas, CD95; Fas-L, Fas
ligand.
|
|
Mouse osteoblasts were exposed to S. aureus at an MOI of
25:1, 75:1, or 250:1. Following a 30-min infection period, osteoblasts were either lysed or incubated in medium containing gentamicin to kill
extracellular bacteria prior to osteoblast lysis. At 30 min and at
6 h following bacterial infection, osteoblast RNA was isolated and
semiquantitative RT-PCR analysis was performed to detect the expression
of TRAIL, TRAIL receptor, or G3PDH mRNA. Surprisingly, the mRNA
encoding TRAIL was rapidly and dramatically up-regulated following
exposure of mouse osteoblasts to S. aureus (Fig.
2). This increase in TRAIL mRNA
expression occurred whether viable or UV-killed bacteria were used
(Fig. 2), suggesting that active S. aureus gene expression
was not required for induction. TRAIL mRNA expression was absent in
uninfected cultures and showed a dose-dependent response to S. aureus at 30 min following infection. In contrast to the
inducible nature of TRAIL mRNA, the message encoding the TRAIL
receptor was constitutively expressed (Fig. 2). Differences noted in
TRAIL mRNA expression could not be attributed to significant
differences in input RNA or efficiencies of RT between samples, as
indicated by amplification of the G3PDH housekeeping gene from the same
cDNA samples.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 2.
RT-RCR analysis of TRAIL and TRAIL receptor
(TRAIL/R) expression in normal mouse osteoblasts infected
with S. aureus or UV-killed S. aureus at
different MOIs (25:1, 75:1, or 250:1 [S. aureus
organisms to osteoblasts]). PCR amplification of G3PDH was performed
to ensure equal input of RNA and similar efficiencies of RT. Gene
expression was monitored at 0.5 and 6 h following the addition of
viable or UV-killed bacteria.
|
|
While S. aureus is the primary causative agent of
bacterially induced bone and joint diseases, Salmonella
species can also be responsible for such infections. We questioned
whether these two very different bacterial pathogens could induce
similar osteoblast responses. As shown in Fig.
3, the gram-negative bacterium
Salmonella serovar Dublin was also able to rapidly
up-regulate TRAIL mRNA expression in mouse osteoblasts. As with
S. aureus, UV-killed bacteria were capable inducers of TRAIL
mRNA expression. Taken together, the results presented in Fig. 2
and 3 demonstrate that both S. aureus and
Salmonella serovar Dublin can induce the rapid up-regulation
of TRAIL mRNA expression and that mouse osteoblasts constitutively
express mRNA encoding the single known TRAIL receptor.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 3.
RT-RCR analysis of TRAIL and TRAIL receptor
(TRAIL/R) expression in normal mouse osteoblasts infected
with Salmonella serovar Dublin or UV-killed
Salmonella serovar Dublin at different MOIs (10:1, 3:1,
or 1:1 [Salmonella serovar Dublin organisms to
osteoblasts]). PCR amplification of G3PDH was performed to ensure
equal input of RNA and similar efficiencies of RT. Gene expression was
monitored at 0.5 and 6 h following the addition of viable or
UV-killed bacteria.
|
|
To address whether the TRAIL induction response to infectious agents
was conserved in humans, RT-PCR analysis was also performed with normal
human osteoblast cultures following exposure to S. aureus or
Salmonella serovar Dublin. The results presented in Fig.
4 are qualitatively similar to those
obtained using cultured mouse osteoblasts. Specifically, TRAIL mRNA
expression was up-regulated in cultured human osteoblasts
exposed to viable S. aureus or Salmonella serovar
Dublin, whereas the mRNAs encoding TRAIL R1 and R2 were constitutively
expressed. Thus, the results from mRNA analyses were clear regarding
S. aureus- or Salmonella serovar Dublin-induced TRAIL expression by cultured mouse or human osteoblasts.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 4.
RT-RCR analysis of TRAIL, TRAIL R1, and TRAIL R2
expression in normal human osteoblasts infected with S.
aureus or Salmonella serovar Dublin at different
MOIs (25:1, 75:1, or 250:1 [S. aureus organisms to
osteoblasts]; 1:1, 3:1, or 10:1 [Salmonella
serovar Dublin organisms to osteoblasts]). PCR amplification of G3PDH
was performed to ensure equal input of RNA and similar efficiencies of
RT. Gene expression was monitored at 6 h following the addition of
viable bacteria.
|
|
TRAIL protein synthesis and secretion.
To complement the mRNA
analyses, Western blot analyses were performed to examine the
up-regulation of TRAIL following infection. These analyses were
limited to human osteoblasts, since the antibodies which are
commercially available recognize the human protein. An osteoblast
protein reacted with polyclonal anti-TRAIL antibody in S. aureus-infected cultures but was absent in uninfected osteoblasts and in preparations from S. aureus cultures devoid of
osteoblasts (Fig. 5). The reactive
protein present in infected cultures has a mass of approximately 33 kDa, which is the predicted size of at least one isoform of the human
TRAIL protein (19). A rabbit polyclonal antibody
preparation specific for human phosphorylated MKK3 or MKK6 did not
react with proteins from infected osteoblast cultures. This antibody
was used as a control, since we have recently demonstrated that
osteoblast MKK3 and MKK6 are not phosphorylated in response to S. aureus infection (J. K. Ellington, A. Elhofy, and M. C. Hudson, submitted for publication). Figure 5 demonstrates that
the polyclonal anti-TRAIL antibody reacts with recombinant human TRAIL
and therefore suggests that the reactive protein present in infected
osteoblast cultures is indeed TRAIL.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 5.
Western immunoblot analysis of cell-associated TRAIL
expression by normal human osteoblasts infected with S.
aureus. Lanes contained S. aureus devoid of
osteoblasts; uninfected osteoblasts 12 h after mock infection;
osteoblasts infected with S. aureus at an MOI of 75:1,
12 h after the addition of bacteria; and recombinant human TRAIL
(hTRAIL). The first four lanes were probed with polyclonal anti-TRAIL
antibody, and the fifth and sixth lanes were probed with polyclonal
anti-phosphorylated MKK3 or MKK6 antibody, prior to reaction with the
secondary antibody. Two micrograms of total protein was loaded for the
first three lanes and the fifth lane; 1 µg of recombinant hTRAIL was
loaded for the fourth and sixth lanes.
|
|
Cell-associated TRAIL protein was detected as early as 45 min and up to
24 h following infection of normal human osteoblasts with S. aureus (Fig. 6). In addition,
S. aureus-induced TRAIL expression increased in a
dose-dependent manner. Cell-associated TRAIL protein was also detected
in normal human osteoblasts within 45 min following exposure to
Salmonella serovar Dublin (Fig.
7). As with S. aureus
infection, the production of TRAIL by Salmonella serovar
Dublin-infected normal human osteoblasts also increased in a
dose-dependent manner and was sustained for at least 24 h. Consistent with the results of the RT-PCR analyses, uninfected human
osteoblasts did not express significant amounts of TRAIL protein.
Finally, UV-killed bacteria induced the expression of TRAIL protein at
levels similar to those induced by live bacteria (Fig. 6 and 7).

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 6.
Western immunoblot analysis of cell-associated TRAIL
expression by normal human osteoblasts infected with S.
aureus or UV-killed S. aureus at different MOIs
(25:1, 75:1, or 250:1 [S. aureus organisms to
osteoblasts]). TRAIL expression was monitored at 45 min following the
addition of viable or UV-killed bacteria and at 6, 12, and 24 h
following infection with viable S. aureus cells. Two
micrograms of total protein was loaded for each lane.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 7.
Western immunoblot analysis of cell-associated TRAIL
expression by normal human osteoblasts infected with
Salmonella serovar Dublin or UV-killed
Salmonella serovar Dublin at different MOIs (1:1, 3:1,
or 10:1 [Salmonella serovar Dublin organisms to
osteoblasts]). TRAIL expression was monitored at 45 min following the
addition of viable or UV-killed bacteria and at 6, 12, and 24 h
following infection with viable Salmonella serovar
Dublin cells. Two micrograms of total protein was loaded for each
lane.
|
|
Infected osteoblast cultures are also capable of secreting significant
quantities of TRAIL protein. Secreted TRAIL protein was detected as
early as 45 min and up to 24 h following infection of normal human
osteoblasts with S. aureus (Fig.
8). As with cell-associated TRAIL,
S. aureus-induced secretion of TRAIL increased in a
dose-dependent manner. Secreted TRAIL protein was also detected within
45 min following exposure to Salmonella serovar Dublin (Fig.
9). Secretion of TRAIL by
Salmonella serovar Dublin-infected normal human osteoblasts also increased in a dose-dependent manner and was sustained for at
least 24 h. Uninfected human osteoblasts did not secrete
significant amounts of TRAIL protein. Finally, UV-killed bacteria
induced the secretion of TRAIL protein at levels similar to those
induced by live bacteria (Fig. 8 and 9).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 8.
Western immunoblot analysis of TRAIL secretion by normal
human osteoblasts infected with S. aureus or UV-killed
S. aureus at different MOIs. Lanes, from left to right,
contained protein reactive with anti-TRAIL antibody in culture
supernatants 45 min following infection with S. aureus
at an MOI of 0, 25:1, 75:1, or 250:1; protein reactive with anti-TRAIL
antibody in culture supernatants 45 min following the addition of
UV-killed S. aureus at an MOI of 75:1 or 250:1; and
protein reactive with anti-TRAIL antibody in culture supernatants at 6, 12, and 24 h following infection with S. aureus at
an MOI of 250:1. Ten micrograms of total protein from serum-containing
medium was loaded for each lane.
|
|

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 9.
Western immunoblot analysis of TRAIL secretion by normal
human osteoblasts infected with Salmonella serovar
Dublin or UV-killed Salmonella serovar Dublin at
different MOIs. Lanes, from left to right, contained protein reactive
with anti-TRAIL antibody in culture supernatants 45 min following
infection with Salmonella serovar Dublin at an MOI of 0, 1:1, 3:1, or 10:1; protein reactive with anti-TRAIL antibody in culture
supernatants 45 min following the addition of UV-killed
Salmonella serovar Dublin at an MOI of 3:1 or 10:1; and
protein reactive with anti-TRAIL antibody in culture supernatants at 6, 12, and 24 h following infection with Salmonella
serovar Dublin at an MOI of 10:1. Ten micrograms of total protein from
serum-containing medium was loaded for each lane.
|
|
 |
DISCUSSION |
TRAIL is believed to induce apoptosis in tumorigenic or
transformed cells but not in normal cells (35). mRNA
encoding TRAIL has been detected in many tissues, including spleen,
prostate, ovary, and colon, and in peripheral blood lymphocytes. The
expression of TRAIL in many tissues therefore has suggested that the
regulation of TRAIL-induced apoptosis is mediated through the
regulation of TRAIL receptor expression. A recent report was the first
to demonstrate the induction of TRAIL by an infectious agent
(32). Measles virus was shown to induce TRAIL production
by human dendritic cells, although the expression of TRAIL receptors
was not examined.
The current study demonstrates that bacterial bone pathogens strongly
induce TRAIL expression by both normal mouse and normal human
osteoblasts, while there is constitutive expression of TRAIL receptors
in the same cells. Surprisingly, qualitatively similar results were
obtained following interactions of gram-positive and gram-negative bone
pathogens with normal osteoblasts from two different mammalian species.
Viable and UV-killed S. aureus and Salmonella
serovar Dublin caused a rapid and sustained up-regulation of TRAIL mRNA
and TRAIL protein expression. This up-regulation of TRAIL mRNA by
normal mouse osteoblasts in response to bacterial infection is coupled
with the constitutive expression of the single known mouse TRAIL
receptor (Fig. 2 and 3). Several human TRAIL receptors are known,
including R1, R2, R3, R4, and osteoprotegerin (OPG) (8,
12); however, R1 and R2 are the only TRAIL receptors known to
contain complete death domains. Studies with human osteoblasts indicated that the up-regulation of TRAIL mRNA expression is coupled with the constitutive expression of R1 and R2 mRNAs (Fig. 4). The rapid
and dose-dependent nature of TRAIL induction in infected normal mouse
and human osteoblasts suggests that TRAIL may be a significant factor
in osteoblast apoptosis. The observation that UV-killed bacteria
induced TRAIL clearly indicates that active bacterial gene expression
is not required to induce the osteoblast response.
The present study, the first to demonstrate that bacterial pathogens
induce TRAIL expression in any normal cell, suggests that intracellular
bacteria mediate the response and that TRAIL likely initiates the
apoptosis observed following bacterial infection of osteoblasts
(31). TRAIL clearly mediates cell death in other tissues
through the activation of specific caspases (11). Caspase 8 activation is observed within minutes of TRAIL addition to human melanoma cells, suggesting that caspase 8 is one of the proximal components of the TRAIL-induced cell death pathway (10).
Other reports indicate that caspase 10 is the initial mediator in
TRAIL-induced apoptosis (25). Caspase 3 is a substrate for
both caspase 8 and caspase 10. The results presented in Fig. 1 suggest
that S. aureus infection of osteoblasts might actually
result in the up-regulation of caspase 8 expression, while caspase 3 expression remains unchanged. Wesson et al. have recently demonstrated
that S. aureus induces apoptosis in epithelial cells via a
mechanism involving caspase 8 and caspase 3 (33), although
the inducer of caspase activation was not reported. It is currently
unclear if TRAIL is the mediator of S. aureus-induced
caspase activation in epithelial cells or if TRAIL induces caspase 8 or
caspase 10 activation in infected osteoblasts.
Collectively, the findings reported here suggest a mechanism
whereby bone pathogens mediate bone destruction via the induction of osteoblast apoptosis. Extracts from Actinobacillus
actinomycetemcomitans have recently been demonstrated to induce
osteoblast apoptosis (23, 36), but intracellular bacteria
also appear to be capable of such destruction (31). The
presence of intracellular bacterial cells in osteoblast cultures is
most likely required for apoptosis induction by S. aureus
and Salmonella serovar Dublin. Normal osteoblasts are
evident in infected cultures even at 24 h after the addition of
gentamicin (data not shown), so induction of apoptosis by extracellular bacterial products is unlikely. In addition, the presence of gentamicin in the culture medium after 45 min of infection makes it unlikely that
any bacteria potentially released from osteoblasts after that time
would be responsible for inducing apoptosis. It is unclear if all
intracellularly infected osteoblasts express TRAIL or whether the
induction of expression is dependent on the numbers of bacteria present
inside individual cells.
In addition to potentially inducing osteoblast apoptosis, TRAIL
expression likely plays another role in bone pathology. TRAIL binding
to the soluble OPG receptor can derepress the OPG inhibition of
osteoclastogenesis, thereby increasing bone destruction
(8). The induction of TRAIL in osteoblasts following
bacterial infection could therefore have a positive osteoclastogenic
impact on the bone microenvironment. Further, the demonstration that
TRAIL is secreted by infected osteoblasts (Fig. 8 and 9) suggests that TRAIL could influence cells outside the environment of a localized bacterial infection.
In summary, the data indicate that S. aureus and
Salmonella serovar Dublin induce TRAIL expression in
infected normal osteoblasts. This result indicates that TRAIL-induced
cell death may exacerbate bone loss already attributed to the
osteoclast-mediated bone resorption characteristic of osteomyelitis.
Osteoblasts have been demonstrated to undergo apoptosis in vitro and in
vivo, and it has been suggested that the process can be modulated by
growth factors and cytokines produced in the bone microenvironment
(17). The mechanism of S. aureus and
Salmonella serovar Dublin-induced TRAIL expression is
currently unclear; however, the S. aureus agr locus
influences apoptosis induction in bovine mammary epithelial cells
(34). We are currently investigating whether such global
regulatory loci control the initiation of osteoblast apoptosis
following invasion of osteoblasts by S. aureus and
Salmonella species.
 |
ACKNOWLEDGMENTS |
This work was supported by grant AI32976 from the National
Institutes of Health (to K.L.B.), by the Foundation for the Carolinas (support given to M.C.H.), and by the UNC Charlotte Foundation (support given to M.C.H. and F.M.H.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biology, University of North Carolina at Charlotte, 9201 University
City Blvd., Charlotte, NC 28223. Phone: (704) 547-4048. Fax: (704) 547-3128. E-mail: mchudson{at}emailuncc.edu.
Editor:
R. N. Moore
 |
REFERENCES |
| 1.
|
Almeida, R. A.,
K. R. Matthews,
E. Cifrian,
A. J. Guidry, and S. P. Oliver.
1996.
Staphylococcus aureus invasion of bovine mammary epithelial cells.
J. Dairy Sci.
79:1021-1026[Abstract].
|
| 2.
|
Bayles, K. W.,
C. A. Wesson,
L. E. Liou,
L. K. Fox,
G. A. Bohach, and W. R. Trumble.
1998.
Intracellular Staphylococcus aureus escapes the endosome and induces apoptosis in epithelial cells.
Infect. Immun.
66:336-342[Abstract/Free Full Text].
|
| 3.
|
Beekhuizen, H.,
J. S. Van De Gevel,
B. Olsson,
I. J. Van Benten, and R. Van Furth.
1997.
Infection of human vascular endothelial cells with Staphylococcus aureus induces hyperadhesiveness for human monocytes and granulocytes.
J. Immunol.
158:774-782[Abstract].
|
| 4.
|
Bost, K. L., and J. D. Clements.
1995.
In vivo induction of interleukin-12 mRNA expression after oral immunization with Salmonella dublin or the B subunit of Escherichia coli heat-labile enterotoxin.
Infect. Immun.
63:1076-1083[Abstract].
|
| 5.
|
Bost, K. L., and M. J. Mason.
1995.
Thapsigargin and cyclopiazonic acid initiate rapid and dramatic increases in IL-6 mRNA expression and IL-6 secretion in murine peritoneal macrophages.
J. Immunol.
155:285-296[Abstract].
|
| 6.
|
Bost, K. L.,
W. K. Ramp,
N. C. Nicholson,
J. L. Bento,
I. Marriott, and M. C. Hudson.
1999.
Staphylococcus aureus infection of mouse or human osteoblasts induces high levels of IL-6 and IL-12 production.
J. Infect. Dis.
180:1912-1920[CrossRef][Medline].
|
| 7.
|
Ellington, J. K.,
S. S. Reilly,
W. K. Ramp,
M. S. Smeltzer,
J. F. Kellam, and M. C. Hudson.
1999.
Mechanisms of Staphylococcus aureus invasion of cultured osteoblasts.
Microb. Pathog.
26:317-323[CrossRef][Medline].
|
| 8.
|
Emery, J. G.,
P. McDonnell,
M. B. Burke,
K. C. Deen,
S. Lyn,
C. Silverman,
E. Dul,
E. R. Appelbaum,
C. Eichman,
R. DiPrinzio,
R. A. Dodds,
I. E. James,
M. Rosenberg,
J. C. Lee, and P. R. Young.
1998.
Osteoprotegerin is a receptor for the cytotoxic ligand TRAIL.
J. Biol. Chem.
273:14363-14367[Abstract/Free Full Text].
|
| 9.
|
Gallagher, J. A.,
R. Gundle, and J. N. Beresford.
1996.
Isolation and culture of bone forming cells (osteoblasts) from human bone, p. 233-241.
In
G. E. Jones (ed.), Methods in molecular medicine: human cell culture protocols. Humana Press, Totowa, N.J.
|
| 10.
|
Griffith, T. S.,
W. A. Chin,
G. C. Jackson,
D. H. Lynch, and M. Z. Kubin.
1998.
Intracellular regulation of TRAIL-induced apoptosis in human melanoma cells.
J. Immunol.
161:2833-2840[Abstract/Free Full Text].
|
| 11.
|
Griffith, T. S., and D. H. Lynch.
1998.
TRAIL: a molecule with multiple receptors and control mechanisms.
Curr. Opin. Immunol.
10:559-563[CrossRef][Medline].
|
| 12.
|
Griffith, T. S.,
C. T. Rauch,
P. J. Smolak,
J. Y. Waugh,
N. Boiani,
D. H. Lynch,
C. A. Smith,
R. G. Goodwin, and M. Z. Kubin.
1999.
Functional analysis of TRAIL receptors using monoclonal antibodies.
J. Immunol.
162:2597-2605[Abstract/Free Full Text].
|
| 13.
|
Gundle, R., and J. N. Beresford.
1995.
The isolation and culture of cells from explants of human trabecular bone.
Calcif. Tissue Int.
56(Suppl. 1):S8-S10.
|
| 14.
|
Hudson, C. M.,
W. K. Ramp, and K. P. Frankenburg.
1999.
Staphylococcus aureus adhesion to bone matrix and bone-associated biomaterials.
FEMS Microbiol. Lett.
173:279-284[CrossRef][Medline].
|
| 15.
|
Hudson, C. M.,
W. K. Ramp,
N. C. Nicholson,
A. S. Williams, and M. T. Nousiainen.
1995.
Internalization of Staphylococcus aureus by cultured osteoblasts.
Microb. Pathog.
19:409-419[CrossRef][Medline].
|
| 16.
|
Jevon, M.,
C. Guo,
B. Ma,
N. Mordan,
S. P. Nair,
M. Harris,
B. Henderson,
G. Bentley, and S. Meghji.
1999.
Mechanisms of internalization of Staphylococcus aureus by cultured human osteoblasts.
Infect. Immun.
67:2677-2681[Abstract/Free Full Text].
|
| 17.
|
Jilka, R. L.,
R. S. Weinstein,
T. Bellido,
A. M. Parfitt, and S. C. Manolagas.
1998.
Osteoblast programmed cell death (apoptosis): modulation by growth factors and cytokines.
J. Bone Miner. Res.
13:793-802[CrossRef][Medline].
|
| 18.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
277:680-685.
|
| 19.
|
Mariani, S. M., and P. H. Krammer.
1998.
Differential regulation of TRAIL and CD95 ligand in transformed cells of the T and B lymphocyte lineage.
Eur. J. Immunol.
28:973-982[CrossRef][Medline].
|
| 20.
|
Marie, P. J.,
A. Lomri,
A. Sabbagh, and M. Basle.
1989.
Culture and behavior of osteoblastic cells isolated from normal trabecular bone surfaces.
In Vitro Cell. Dev. Biol.
25:373-380[Medline].
|
| 21.
|
Meghji, S.,
S. J. Crean,
P. A. Hill,
M. Sheikh,
S. P. Nair,
K. Heron,
B. Henderson,
E. B. Mawer, and M. Harris.
1998.
Surface-associated protein from Staphylococcus aureus stimulates osteoclastogenesis: possible role in S. aureus-induced bone pathology.
Br. J. Rheumatol.
37:1095-1101[Abstract/Free Full Text].
|
| 22.
|
Menzies, B. E., and I. Kourteva.
1998.
Internalization of Staphylococcus aureus by endothelial cells induces apoptosis.
Infect. Immun.
66:5994-5998[Abstract/Free Full Text].
|
| 23.
|
Morimoto, Y.,
H. Morimoto,
T. Murata,
S. Kobayashi,
T. Ohba, and T. Haneji.
1999.
Extracts of Actinobacillus actinomycetemcomitans induce apoptotic cell death in human osteoblastic MG63 cells.
J. Dent. Res.
78:735-742[Abstract/Free Full Text].
|
| 24.
|
Nair, S. P.,
Y. Song,
S. Meghji,
K. Reddi,
M. Harris,
A. Ross,
S. Poole,
M. Wilson, and B. Henderson.
1995.
Surface-associated proteins from Staphylococcus aureus demonstrate potent bone resorbing activity.
J. Bone Miner. Res.
10:726-734[Medline].
|
| 25.
|
Pan, G.,
J. Ni,
Y.-F. Wei,
G. I. Yu,
R. Gentz, and V. M. Dixit.
1997.
An antagonist decoy receptor and a death domain-containing receptor for TRAIL.
Science
277:815-818[Abstract/Free Full Text].
|
| 26.
|
Patti, J. M.,
B. L. Allen,
M. J. McGavin, and M. Hook.
1994.
MSCRAMM-mediated adherence of microorganisms to host tissues.
Annu. Rev. Microbiol.
48:585-617[Medline].
|
| 27.
|
Ramp, W. K.,
R. M. Dillaman,
L. G. Lenz,
D. M. Gay,
R. D. Roer, and T. A. Ballard.
1991.
A serum substitute promotes osteoblast-like phenotypic expression in cultured cells from chick calvariae.
Bone Miner.
15:1-17[CrossRef][Medline].
|
| 28.
|
Ramp, W. K.,
L. G. Lenz, and K. K. Kaysinger.
1994.
Medium pH modulates matrix, mineral, and energy metabolism in cultured chick bones and osteoblast-like cells.
Bone Miner.
24:59-73[Medline].
|
| 29.
|
Reilly, S. S.,
M. C. Hudson,
J. F. Kellam, and W. K. Ramp.
2000.
In vivo internalization of Staphylococcus aureus by embryonic chick osteoblasts.
Bone
26:63-70[Medline].
|
| 30.
|
Rodan, G. A.,
J. K. Heath,
K. Yoon,
M. Noda, and S. B. Rodan.
1988.
Diversity of the osteoblastic phenotype.
Ciba Found. Symp.
136:78-91[Medline].
|
| 31.
|
Tucker, K. A.,
S. S. Reilly,
C. S. Leslie, and M. C. Hudson.
2000.
Intracellular Staphylococcus aureus induces apoptosis in mouse osteoblasts.
FEMS Microbiol. Lett.
186:151-156[CrossRef][Medline].
|
| 32.
|
Vidalain, P.-O.,
O. Azocar,
B. Lamouille,
A. Astier,
C. Rabourdin-Combe, and C. Servet-Delprat.
2000.
Measles virus induces functional TRAIL production by human dendritic cells.
J. Virol.
74:556-559[Abstract/Free Full Text].
|
| 33.
|
Wesson, C. A.,
J. Deringer,
L. E. Liou,
K. W. Bayles,
G. A. Bohach, and W. R. Trumble.
2000.
Apoptosis induced by Staphylococcus aureus in epithelial cells utilizes a mechanism involving caspases 8 and 3.
Infect. Immun.
68:2998-3001[Abstract/Free Full Text].
|
| 34.
|
Wesson, C. A.,
L. E. Liou,
K. M. Todd,
G. A. Bohach,
W. R. Trumble, and K. W. Bayles.
1998.
Staphylococcus aureus Agr and Sar global regulators influence internalization and induction of apoptosis.
Infect. Immun.
66:5238-5243[Abstract/Free Full Text].
|
| 35.
|
Wiley, S. R.,
K. Schooley,
P. J. Smolak,
W. S. Din,
C. P. Huang,
J. K. Nicholl,
G. R. Sutherland,
T. D. Smith,
C. Rauch,
C. A. Smith, and R. G. Goodwin.
1995.
Identification and characterization of a new member of the TNF family that induces apoptosis.
Immunity
3:673-682[CrossRef][Medline].
|
| 36.
|
Yamamoto, S.,
M. Mogi,
K. Kinpara,
Y. Ishihara,
N. Ueda,
K. Amano,
T. Nishihara,
T. Noguchi, and A. Togari.
1999.
Anti-proliferative capsular-like polysaccharide antigen from Actinobacillus actinomycetemcomitans induces apoptotic cell death in mouse osteoblastic MC3T3-E1 cells.
J. Dent. Res.
78:1230-1237[Abstract/Free Full Text].
|
Infection and Immunity, March 2001, p. 1581-1586, Vol. 69, No. 3
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.3.1581-1586.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Somayaji, S. N., Ritchie, S., Sahraei, M., Marriott, I., Hudson, M. C.
(2008). Staphylococcus aureus Induces Expression of Receptor Activator of NF-{kappa}B Ligand and Prostaglandin E2 in Infected Murine Osteoblasts. Infect. Immun.
76: 5120-5126
[Abstract]
[Full Text]
-
Potter, B. K., Burns, T. C., Lacap, A. P., Granville, R. R., Gajewski, D. A.
(2007). Heterotopic Ossification Following Traumatic and Combat-Related Amputations. Prevalence, Risk Factors, and Preliminary Results of Excision. JBJS
89: 476-486
[Abstract]
[Full Text]
-
Frick, K. K., LaPlante, K., Bushinsky, D. A.
(2005). RANK ligand and TNF-{alpha} mediate acid-induced bone calcium efflux in vitro. Am. J. Physiol. Renal Physiol.
289: F1005-F1011
[Abstract]
[Full Text]