Previous Article | Next Article 
Infection and Immunity, March 2001, p. 1643-1649, Vol. 69, No. 3
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.3.1643-1649.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Interleukin-12- and Gamma Interferon-Dependent Protection against
Malaria Conferred by CpG Oligodeoxynucleotide in Mice
Robert A.
Gramzinski,1,
Denise L.
Doolan,1,2
Martha
Sedegah,1,3
Heather L.
Davis,4,5
Arthur M.
Krieg,6 and
Stephen L.
Hoffman1,*
Malaria Program, Naval Medical Research
Center, Silver Spring, Maryland 20910-75001;
Department of Molecular Microbiology and Immunology, School of
Hygiene and Public Health, Johns Hopkins University, Baltimore,
Maryland 21205-21792; Department of
Microbiology, University of Maryland School of Medicine, Baltimore,
Maryland 212013; Loeb Research
Institute, Ottawa Civic Hospital,4
and Faculties of Health Sciences and Medicine, University
of Ottawa,5 Ottawa, Canada K1Y 4E9; and
Department of Internal Medicine, University of Iowa, Iowa
City, Iowa 522426
Received 6 September 2000/Returned for modification 16 October
2000/Accepted 12 December 2000
 |
ABSTRACT |
Unmethylated CpG dinucleotides in bacterial DNA or synthetic
oligodeoxynucleotides (ODNs) cause B-cell proliferation and
immunoglobulin secretion, monocyte cytokine secretion, and activation
of natural killer (NK) cell lytic activity and gamma interferon
(IFN-
) secretion in vivo and in vitro. The potent Th1-like immune
activation by CpG ODNs suggests a possible utility for enhancing innate
immunity against infectious pathogens. We therefore investigated
whether the innate immune response could protect against malaria.
Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing
diester linkages and phosphorothioate linkages being to the right of
lowercase letters) in the absence of antigen 1 to 2 days prior to
challenge with Plasmodium yoelii sporozoites conferred
sterile protection against infection. A higher level of protection was
consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The
protective effects of both CpG ODNs were dependent on interleukin-12,
as well as IFN-
. Moreover, CD8+ T cells (but not
CD4+ T cells), NK cells, and nitric oxide were implicated
in the CpG ODN 1585-induced protection. These data establish that the
protective mechanism induced by administration of CpG ODN 1585 in the
absence of parasite antigen is similar in nature to the mechanism
induced by immunization with radiation-attenuated P. yoelii
sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether
CD8+ T cells, NK cells, or nitric oxide were required for
the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that
stimulation of the innate immune system by CpG immunostimulatory motifs
can confer sterile protection against malaria.
 |
INTRODUCTION |
It is estimated that the causative
agents of malaria, such as Plasmodium falciparum or
Plasmodium vivax, result in an estimated 300 to 500 million
new infections and 1.5 to 2.7 million deaths annually
(35). In addition, tens of millions of travelers from countries where malaria is not endemic visit countries where it is, and
many of these succumb to illness during their travels or after
returning home. In the latter case, there is a particular risk of
failure to rapidly diagnose and initiate treatment, owing to the lack
of experience with the disease of many local physicians.
The treatment and prevention of malaria have traditionally depended
upon antimalarial drugs targeted against the parasite. Although
historically effective, many of the parasites that cause malaria have
now developed resistance to such drugs, and there are few new drug
candidates on the horizon (14). Thus, new and more
effective methods to prevent and treat this widespread and serious
disease are required. Considerable effort has been put into the
development of vaccines designed to induce specific antiparasite immune
responses. While there has been substantial progress in this endeavor
(14, 27), no antimalarial vaccine has yet been licensed.
It is now well established that there are two general systems of
immunity against pathogen infection: innate immunity, which uses
proteins encoded in the germ line that recognize molecules unique to
infectious organisms, and adaptive (acquired) immunity, which uses T
and B lymphocytes expressing distinct antigen receptors that recognize
pathogen-derived peptides. Innate immunity has been considered only to
provide rapid, short-term, incomplete antimicrobial host defense until
the slower antigen-specific acquired immune response develops.
Recently, however, it has been suggested (1, 10, 28) that
the innate immune response may play a pivotal role in immune regulation
and the development of host immunity by determining which antigens the
acquired immune system responds to and the nature of that response.
Almost all efforts towards the development of an effective malaria
vaccine, however, have focused on the effector phase of the
antigen-specific adaptive immune response (14, 27). In
contrast, here we have investigated the role of the innate immune
response in protective immunity against malaria.
The genomic DNAs of bacteria and vertebrates differ in the frequency
and methylation of CpG dinucleotides, which are at the expected random
frequency in bacterial DNA (approximately 1 every 16 bases) but are
under-represented (CpG suppression) (1 every 50 to 1 every 60 bases) and methylated in vertebrate DNA (3). Bacterial DNA
or synthetic oligodeoxynucleotides (ODNs) containing unmethylated
CpG dinucleotides in particular base contexts induce B-cell
proliferation and immunoglobulin (Ig) secretion, monocyte secretion of
the Th1-like cytokines interleukin-12 (IL-12) and alpha, beta,
and alpha/beta interferons, gamma interferon (IFN-
) secretion,
and natural killer (NK) cell lytic activity (2, 6, 17, 18, 26,
33, 34). Such immune stimulatory CpGs are typically preceded on
the 5' side by an ApA, GpA, or GpT and followed on the 3' side by two
pyrimidines, especially TpT (CpG motifs) (37). Methylated
bacterial DNA or ODNs in which the cytosines of CpG have been converted
to 5-methyl-cytosine (the form present in vertebrate DNA) fail to
induce immune activation (18). Thus, this simple
structural difference between vertebrate and prokaryotic genomic DNAs
may function as a "danger signal" to trigger innate immune defenses
against infection and initiate a specific immune response (5, 13,
20, 21, 22). Immunization of animals against an antigen using a
CpG ODN as an adjuvant induces strong Th1-like responses, as evidenced
by potentiated cytotoxic T-cell responses and a preponderance of the
IgG2a antibody isotype (7, 23, 30, 32, 34). These
responses are antigen specific. In addition to such antigen-specific
responses (22), it appears that the strong Th1-like effect
of CpG-S motifs can induce nonspecific innate immune responses of a
protective nature (13, 21). For example, pretreatment of
mice with a CpG-S ODN was demonstrated to provide complete protection
against infection with a lethal challenge of the bacteria
Listeria monocytogenes (19) and
Leishmania major (39).
Plasmodium yoelii- and P. falciparum-infected
hepatocytes can be eliminated in vitro by the addition of
recombinant IFN-
to the cultures (11, 24, 25).
Parenteral injection of recombinant IL-12 (rIL-12) 2 days before
malaria sporozoite challenge completely prevents development of
blood-stage infection in mice (31) and monkeys
(15). In the BALB/c mouse model, irradiated
sporozoite- and DNA vaccine-induced protection is dependent on
CD8+ T cells, IFN-
, IL-12, NK cells, and inducible
nitric oxide synthase (iNOS) (8, 9). Since both IL-12 and
IFN-
are induced by immunostimulatory CpG motifs (6,
17), we evaluated whether a CpG ODN might prove beneficial for
protection against malaria. We show here that mice challenged with
P. yoelii sporozoites can be completely protected against
malaria sporozoite challenge when pretreated with CpG ODNs and that
this protective effect is dependent on IL-12 and IFN-
.
 |
MATERIALS AND METHODS |
ODNs.
The CpG ODNs used in this study were 1826 (TCC
ATG ACG TTC CTG ACG TT, with the CpG
dinucleotides underlined for clarity), a 20-mer which has a
nuclease-resistant phosphorothioate backbone and which contains two
copies of a CpG motif known to have potent immunostimulatory effects on
the murine immune system, and 1585 (gg GGT CAA CGT TGA
ggg ggG, with g representing diester linkages and
phosphorothioate linkages being to the right of lowercase letters), a
20-mer which contains an unmethylated CpG motif in the middle of a
10-bp palindrome known to induce significant NK cell activity (2,
6). ODNs 1982 (TCC AGG ACT TCT CTC AGG TT) and 2118 (ggG GTC AAG CTT GAg ggg gG) were used as non-CpG control
ODNs for the ODN 1826 and 1585 studies, respectively. ODNs were
provided by Coley Pharmaceutical Group, Inc. (Wellesley, Mass.). The
Na+ salts of the ODNs were ethanol precipitated,
resuspended in phosphate-buffered saline (PBS) (pH 7.2) (ODN 1826) or
Tris-EDTA (pH 8.0) (ODN 1585) at a concentration of 4 to 6 mg/ml, and
stored at 4°C prior to injection. The endotoxin level in the ODNs was
undetectable (less than 1 ng/mg of ODN) by the Limulus assay (Whittaker
Bioproducts, Walkersville, Md.).
CpG ODN treatment.
All studies were carried out with 4- to
8-week-old female BALB/c ByJ mice (Jackson Laboratory, Bar Harbor,
Maine), with 6 to 18 mice in each experimental group. Mice received a
single injection into the tibialis anterior muscle of 3, 10, 50, or 100 µg of CpG ODN 1826 or 50, 100, 200, or 500 µg of CpG ODN 1585 in 50 µl of saline at 7, 2, or 1 day(s) prior to sporozoite infection, on
the day of infection, and/or at 1 day postinfection. In all experiments, non-CpG control ODNs (1982 or 2118, respectively) were
administered in parallel.
Parasites and parasite challenge.
P. yoelii
(17XNL nonlethal strain, clone 1.1) was maintained by alternating
passage of the parasites in Anopheles stephensi mosquitoes
and CD-1 mice. Sporozoites were isolated from mosquito salivary glands
14 days after the mosquitoes had taken an infectious blood meal, by
hand dissection of the mosquito salivary glands in M199 medium
containing 5% normal mouse serum. The recovered sporozoites were
diluted to a final concentration of 250 infectious sporozoites per ml.
For infection (day 0), each mouse was injected in the tail vein with 50 P. yoelii sporozoites in a volume of 200 µl. It has been
established previously that infection with as few as one or two
sporozoites of P. yoelii 17XNL will result in patent
infection of 50% of BALB/c mice. Giemsa-stained blood films were
prepared on days 4 to 14 postchallenge and examined microscopically for
the presence of parasites, with up to 50 oil immersion fields being
examined. Protection was defined as the complete absence of blood-stage
parasitemia at all time points.
In vivo depletions.
In vivo depletions were carried out as
described previously (8, 9). All Igs were purified from
ascites (Harlan Bioproducts for Science, Indianapolis, Ind.) by 50%
ammonium sulfate precipitation, and final antibody concentrations were
determined by optical density readings.
(i) IFN-
depletion.
To deplete IFN-
, mice received the
anti-IFN-
monoclonal antibody (MAb) XMG-6 (4; kindly provided by F. Finkelman, University of Cincinnati College of Medicine, Cincinnati,
Ohio) on each of several days. In the first study, mice received an
intraperitoneal (i.p.) injection of 1 mg of the anti-IFN-
on days
2,
1, and 0 relative to challenge. In the second study, mice
received an injection of 1 mg of the anti-IFN-
MAb on each of days
3 (intravenous [i.v.]),
2 (i.p.), 0 (i.v.), and +2 (i.v.)
relative to challenge on day 0.
(ii) IL-12 depletion.
To deplete IL-12, mice were injected
i.p. with 1 mg of the anti-IL-12 MAb C17.8 (36; kindly provided by M. Wysocka and G. Trinchieri, The Wistar Institute, Philadelphia, Pa.) at
12 h prior to and 3 h after infection.
(iii) Nitric oxide depletion.
Aminoguanidine is a
competitive substrate inhibitor of iNOS. To deplete nitric oxide, mice
were administered 50 mg of aminoguanidine (Sigma Chemical Company, St.
Louis, Mo.)/kg of body weight in 0.5 ml of PBS via gastric lavage twice
daily, commencing 24 h (experiment 1) or 48 h (experiment 2)
before ODN administration and continuing for 72 h (experiment 1) or
96 h (experiment 2) postchallenge.
(iv) NK cell depletion.
To deplete NK cells, mice received a
single i.v. dose of 200 µl of anti-asialo GM1 antiserum (Wako
Bioproducts, Richmond, Va.) diluted 1:8 in 0.5× PBS (25 µl of stock;
approximately 675 µg of purified antibody) on days
2, 0, +2, and +4
relative to challenge on day 0.
(v) CD4+ T-cell depletion.
The
anti-CD4+ MAb GK1.5 (rat IgG2a) was obtained from the
American Type Culture Collection (TIB207). On days
7,
6,
5,
4,
3,
2, 0, and +2 relative to challenge on day 0, mice received a
single i.p. dose of 1.0 mg of the anti-CD4+ MAb GK1.5 to
deplete CD4+ T cells.
(vi) CD8+ T-cell depletion.
The
anti-CD8+ MAb 2.43 (mouse IgG2a) was also obtained from the
American Type Culture Collection (TIB210). On days
5,
4,
3,
2,
and 0 relative to challenge on day 0, mice received a single i.p. dose
of 0.5 mg of the anti-CD8+ MAb 2.43 to deplete
CD8+ T cells.
(vii) Control treatment.
In all studies, mice were treated
in parallel with a purified rat Ig control (Rockland Co.,
Gilbertsville, Pa.) in the same manner as the test antibodies.
In vitro assay for IL-12 levels.
Blood was obtained from
several mice on days 2 to 4 after administration of the ODNs. Sera were
separated and frozen at
70°C. Circulating levels of IL-12 (p40)
were assayed using a commercially available enzyme-linked
immunosorbent assay kit (PharMingen, San Diego, Calif.) according
to the manufacturer's specifications.
Statistical analysis.
Statistical analysis was performed
using the chi-square test (uncorrected) or Fisher's exact test
(two-tailed) (if the expected cell value was less than five) (Epi Info,
Version 6.04b, Centers for Disease Control and Prevention, Atlanta,
Ga.). In all cases, P values of <0.05 were considered significant.
The experiments reported herein were conducted according to the
principles set forth in the "Guide for the care and use of laboratory
animals," Institute of Laboratory Animal Resources, National Research
Council, National Academy Press, Washington, D.C., 1996.
 |
RESULTS |
Effect of CpG ODN 1826 on course of P. yoelii
infection.
In all experiments, injection of naïve,
untreated mice with P. yoelii sporozoites resulted in
blood-stage infection (parasitemia) in 100% of mice within 14 days.
Pretreatment of mice with CpG ODN 1826 provided complete protection
from infection when the CpG ODN was administered 1 or 2 days prior to
challenge (Table 1). However, protection
was only partial when a longer period (7 days) intervened between the
CpG ODN treatment and challenge. In this case, only 30 to 80% of mice
were protected (Tables 1 and 2). Mice
receiving CpG ODN 1826 at the same time as sporozoite infection were
not protected (Table 1). These data suggested that the protective
effect of the CpG ODN was mediated by a downstream nonspecific
stimulation of the innate immune system but that this effect decreased
over time.
Doses of 3 to 100 µg of CpG ODN 1826 gave increasing levels of
protection (Table 2), suggesting that the innate immune response stimulated by the CpG ODN was dependent on the amount of CpG ODN administered.
There was usually no protection, and never more than 20% protection,
in mice receiving the control (non-CpG) ODN 1982 (Tables 1 and 2).
There was no relationship between dose and partial protection with the
control ODN, since the group in which some mice did not become infected
received 3 µg of control ODN, and all mice which received 10, 50, or
100 µg of control ODN were infected (Table 2).
In total, these findings indicate that the protective effects seen with
the CpG ODN 1826 were due to the immunostimulatory effects of the CpG motifs.
Role of IL-12 in protective effect of CpG ODN 1826.
Since
IL-12 has been implicated with a role in CpG ODN-induced immunity in
other systems (17-22), we depleted mice of IL-12 in vivo.
There was a complete loss of protection in mice administered CpG ODN
1826 2 days before challenge and additionally treated with anti-IL-12
MAb (Table 3). Administration of rat Ig
as a control had no effect on the CpG ODN-induced protection (Table 3).
We also assessed circulating IL-12 levels in some of the mice. A single
determination of IL-12 levels was done on four mice in the experimental
(1826) ODN group and four mice in the control (1982) ODN group (Table
4). Consistent with other reports that
CpG ODNs cause IL-12 secretion, enhanced levels of IL-12 were detected
in the circulation of mice treated with CpG ODN 1826 (mean, 13,914 pg/ml) compared with mice treated with control ODN 1982 (mean, 1,367 pg/ml) or not treated but infected mice (mean, 389 pg/ml). Thus, the
levels of IL-12 in the circulation of CpG ODN 1826-treated mice were at
least 10 times greater than background.
Although the pathological consequences of CpG ODN administration were
not specifically studied here, there was no evidence of any adverse
reactions associated with CpG ODN 1826 (data not presented). However,
our recent experience with adverse reactions associated with
administration of rIL-12 to humans (unpublished data) but not with
IL-12 administration to mice (31) or monkeys (15) indicates that the apparent pathological response of
mice and monkeys may not predict outcome in humans.
Role of IFN-
in protective effect of CpG ODN 1826.
CpG ODNs
are also known to induce IFN-
secretion (18-22),
suggesting that IFN-
may be involved in the CpG-induced protection against sporozoite challenge. Therefore, we treated mice with either
control antibody or the anti-IFN-
MAb XMG-6 to specifically deplete
IFN-
in vivo, using the treatment regimen previously shown to be
effective in eliminating the protection induced by immunization with
irradiated sporozoites or plasmid DNA (8, 9). In the first
study, 80% of mice treated with anti-IFN-
were still protected by
administration of CpG ODN 1826 (Table 3, experiment 1). One possibility
for the lack of effect of the anti-IFN-
MAb was the IFN-
responses were so robust that the MAb was not able to neutralize them.
We therefore conducted a second experiment in which the duration of
anti-IFN-
MAb administration was increased and most of the
injections were done i.v. Protection was reduced from 100 to 20%
(P = 0.0003; chi-square test), the same level conferred
by treatment with the control ODN (Table 3, experiment 2).
Administration of rat Ig as an antibody control had no effect on the
CpG ODN-induced protection. These data establish that the CpG ODN
1826-induced protection was dependent on IFN-
as well as IL-12.
Role of NK cells and nitric oxide in protective effect of CpG ODN
1826.
Previously, it was reported that the protective immunity
against P. yoelii sporozoite challenge in BALB/c mice
induced by immunization with irradiated sporozoites or plasmid DNA is
dependent on nitric oxide and is mediated by CD8+ T cells
but not CD4+ T cells, and in part by NK cells (8,
9). Therefore, we next investigated if a similar protective
mechanism was induced by treatment with CpG ODN 1826. In two separate
experiments, treatment of mice with aminoguanidine, a competitive
substrate inhibitor of iNOS, had little or no effect on the ODN
1826-induced protection (Table 3). Likewise, treatment with anti-asialo
GM1 antibodies to eliminate NK cells or with MAbs to specifically
deplete CD8+ or CD4+ T cells had no significant
effect on protection (Table 3).
Although we cannot exclude the possibility that the treatment regimens
used here may have been inadequate to deplete a potentially robust
immune response induced by the CpG ODN, these data suggested that the
ODN-induced protection may be mediated via an effector mechanism
distinct from that activated by the irradiated sporozoite or DNA
vaccines (9). It is possible that the effector mechanism induced by irradiated sporozoites or DNA vaccines might still have been
operative but that an alternate protective mechanism(s) may be
activated with CpG ODNs.
Effect of CpG ODN 1585 on course of P. yoelii
infection.
Previous studies in other systems showed that another
CpG ODN, 1585, caused preferential activation of NK cells (2,
6). Since NK cells have been implicated with a role in
protection against P. yoelii sporozoite challenge
(9), we next determined whether administration of CpG ODN
1585 could protect against malaria. As shown in Table
5, pretreatment of mice with doses of 50 to 500 µg of CpG ODN 1585 protected 20 to 90% of mice from infection when the CpG ODN was administered around the time of sporozoite challenge. Mice receiving CpG ODN 1585 at the same time as sporozoite infection could be protected, although treatment prior to challenge appeared to be more effective (Table 5). The highest level of protection (90%) resulted from administration of 200 µg of CpG ODN
1585 the day before challenge or 100 µg of CpG ODN 1585 on the day
before and the day of challenge (Table 5). Despite different doses and
administration regimens, however, we were unable to achieve complete
sterile immunity with CpG ODN 1585.
Role of IL-12, IFN-
, and NK cells in protective effect of CpG
ODN 1585.
Next, we investigated the mechanism of protection
induced by treatment with CpG ODN 1585. As noted with CpG ODN 1826, where protection was dependent on both IL-12 and IFN-
, in vivo
depletion of either IL-12 or IFN-
significantly reduced the
protection conferred by treatment with CpG ODN 1585 (Table
6). Consistent with the reported ability
of CpG ODN 1585 to activate NK cells (2) and of NK cells
to protect against sporozoite challenge (9), treatment of
mice with anti-asialo GM1 antibodies also had a significant effect on
protection (Table 6). Administration of rat Ig control had no effect on
the CpG ODN 1585-induced protection.
Role of CD8+ and CD4+ T cells in protective
effect of CpG ODN 1585.
We also investigated the requirement for
nitric oxide and CD8+ and CD4+ T cells in the
CpG ODN 1585-induced protection. As shown in Table 6, treatment of mice
with aminoguanidine to specifically deplete nitric oxide markedly
reduced the protection. Unexpectedly, in vivo depletion of
CD8+ T cells with an anti-CD8+ MAb also
appeared to reduce the ODN-induced protection (Table 6). Treatment with
an anti-CD4+ MAb had no effect. These data suggest that CpG
ODN 1585 treatment alone may increase CD8+ T-cell function,
including the CD8+ T cell-mediated production of IFN-
.
We consider it unlikely, however, that CD8+ T cells are the
primary source of the IFN-
. In the irradiated sporozoite and
P. yoelii circumsporozoite protein (PyCSP) DNA vaccine
models, we believe that parasite-specific CD8+ T cells are
critical for the initial activation of the effector response and that
these cells trigger a mechanism of adaptive immunity which is dependent
on T cell- and non-T cell-derived cytokines, in particular IFN-
and
IL-12, and requires NK cells but not CD4+ T cells
(9).
In total, our data indicate that the protective mechanism induced by
administration of CpG ODN 1585 in the absence of parasite antigen
is similar in nature to the mechanism induced by immunization with
radiation-attenuated P. yoelii sporozoites or with
plasmid DNA encoding preerythrocytio-stage P. yoelii antigens.
 |
DISCUSSION |
Our studies to assess the protective role of CpG ODNs against
challenge with P. yoelii sporozoites were initiated because of an observation made in an experiment in which we used CpG ODN 1826 as an immune enhancer for a DNA vaccine. In that experiment, 100 µg
of CpG ODN 1826 was combined with 100 µg of a PyCSP DNA vaccine or
the control DNA vaccine without insert, with the intended purpose of
using ODNs to enhance the immunogenicity of the DNA vaccine. The
ODN-DNA vaccines were administered intramuscularly (i.m.) to 4- to
8-week-old BALB/c ByJ mice in three doses at 3-week intervals. Two
weeks after the last dose, mice were challenged with 50 P. yoelii sporozoites. In this study, there was no apparent positive
effect of the CpG ODN coadministration on the induction of
antigen-specific antibodies or cytotoxic T lymphocytes or on protection. However, it was observed that 23% (3 of 13) of the control
animals that received the placebo DNA vaccine with the CpG ODN were
protected from malaria sporozoite challenge, yet none (0 of 14) of the
animals that received just the placebo DNA vaccine were protected (data
not shown). This suggested to us that the CpG ODN was inducing a
nonspecific protective effect.
Results of subsequent studies presented here clearly show that the
stimulation of the innate immune system by CpG immunostimulatory motifs
incorporated in either ODN 1826 or 1585 can confer complete protection
against malaria in mice. There is a latency period for the development
of such immunity, and CpG ODNs must be administered at least 1 day
prior to infection for complete protection. Furthermore, the protective
effects are relatively short-lived and are already diminishing by 7 days, as evidenced by the decreased protection seen when CpG ODN 1826 is administered 7 days prior to infection. Nevertheless, the finding
that with treatment 7 days prior to challenge higher doses of CpG ODNs
gave better protection than lower doses indicates that even higher
doses may provide longer-lasting protection. A more prolonged
antimalaria effect might also be obtained following repeat dosing
with a CpG ODN or delivery of a CpG ODN in controlled release
vesicles (e.g., microencapsulated) or formulated in such a way as
to retard in vivo degradation (e.g., liposomes).
The protective antimalaria effect induced by CpG ODNs appears to be
mediated by cytokines, since the protection could be abrogated by
treatment with a MAb against IL-12 or IFN-
. These results are
consistent with previous in vivo and in vitro findings. Parenteral injection of rIL-12 into mice (31) or monkeys
(15) 2 days before malaria sporozoite challenge completely
prevented development of blood-stage infection. Administration of
anti-IFN-
to the mice eliminated the protective effect, and the
protection in the monkeys was associated with circulating levels of
IFN-
.
It is presumed that administration of CpG DNA enhances the production
of IFN-
, which in turn induces the intracellular generation of
nitric oxide, leading to the destruction of the infected hepatocytes, as has been reported for DNA vaccines and the irradiated sporozoite vaccine (8, 9). This model is supported by in vitro
observations that P. yoelii- and P. falciparum-infected hepatocytes can be eliminated by exposure to
IFN-
(11, 24, 25) and that this activity of IFN-
is
prevented by inhibition of iNOS (25). The data obtained
here, at least with CpG ODN 1585, are consistent with this
interpretation. The apparent lack of involvement of nitric oxide and NK
cells in the CpG ODN 1826-induced protection may simply be a reflection
of inadequate depletion of a robust immune response induced by the CpG
ODN or of activation of an alternate pathway that can also confer
protection. In support of this, a higher level of protection was always
induced by the CpG ODN 1826 compared with the CpG ODN 1585. We cannot
exclude the possibility that these different CpG ODNs (1826 and 1585) may induce distinct protective mechanisms.
Recently, it has been reported that NKT cells can significantly inhibit
the liver-stage development of P. yoelii and
Plasmodium berghei in vivo (12) and in vitro
(29). Interestingly, the inhibition of liver-stage
development induced by in vivo administration of
alpha-galactosylceramide was shown to require NKT cells and CD1
molecules, but not NK cells, T cells, or B cells, and was absolutely
dependent on IFN-
but independent of IL-12 (12). The
same researchers reported that the mode of protection mediated by the
activated NKT cells was distinct from that induced by administration of
rIL-12, since neither NKT cells nor CD1 were required for the antimalarial activity of IL-12. Our data demonstrating an absolute requirement for IL-12, as well as IFN-
, and a role for NK cells suggest that the CpG ODN-induced protection is mediated by an IL-12-dependent mechanism which may not involve activated NKT cells.
Further experiments are required to confirm this.
From a practical point of view, a brief period of protection from
malaria may be adequate for persons passing through or spending short
periods of time in areas where malaria is endemic. Even in cases where
protection for longer than a week is desired, it may be possible to
give repeat administrations of CpG ODNs. In this event, CpG ODNs may
prove simpler, less expensive, and safer to use than repeated
administrations of cytokines, although the potential side effects
associated with administration of any nonspecific proinflammatory
stimulus would need to be considered.
It is possible that longer-lasting and more robust protection could be
attained by coupling the CpG ODN-induced protective innate responses
with antigen-specific responses, with a potentially lower dose of the
CpG ODN being required compared to that required for direct
prophylaxis. It has been shown with a number of antigens, including the
PyCSP (16), that CpG ODNs are potent adjuvants for the induction of Th1-type immunity as well as antibody responses (7, 16, 23, 26, 30, 32, 34, 39). Similar effects may also
be realized when CpG ODNs are used as adjuvants with DNA vaccines.
Further studies will be necessary to evaluate these possibilities.
 |
ACKNOWLEDGMENTS |
The authors thank HM2 Arnell Belmonte, HM3 Romeo Wallace, and
Stephen Matheny for providing P. yoelii sporozoites and
technical assistance. We also thank Tonette Bangura and Norma Graber
for technical support, Maria Wysocka and Giorgio Trinchieri (Wistar Institute, Philadelphia, Pa.) for providing the anti-IL-12 MAb C17.8,
and Fred Finkelman (University of Cincinnati College of Medicine,
Cincinnati, Ohio) for providing the anti-IFN-
MAb XMG-6.
These studies were supported by the Naval Medical Research and
Development Command work units STO F 6.1 61102AA0100BFX and STO F 6.2 62787A00101EFX. A.M.K. is supported by DARPA, the Department of
Veterans Affairs, and the National Institutes of Health. H.D. is
supported in part by an Ontario Ministry of Health Career Scientist Award.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Malaria Program,
Naval Medical Research Center, 503 Robert Grant Ave., Silver Spring, MD
20910-7500. Phone: (301) 319-7570. Fax: (301) 319-7545. E-mail: hoffmans{at}nmrc.navy.mil.
Present address: Naval Medical Research Unit No. 2, Jakarta, Indonesia.
Editor:
J. M. Mansfield
 |
REFERENCES |
| 1.
|
Abbas, A. K.,
K. M. Murphy, and A. Sher.
1996.
Functional diversity of helper T lymphocytes.
Nature
383:787-793[CrossRef][Medline].
|
| 2.
|
Ballas, Z. K.,
W. I. Rassmussen, and A. M. Krieg.
1996.
Induction of natural killer activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA.
J. Immunol.
157:1840-1845[Abstract].
|
| 3.
|
Bird, A. P.
1987.
CpG islands as gene markers in the vertebrate nucleus.
Trends Genet.
3:342[CrossRef].
|
| 4.
|
Cherwinski, H. M.,
K. D. Schumacher,
F. W. Brown, and T. R. Mosmann.
1987.
Two types of mouse helper T cell clone. III. Further differences in lymphocyte synthesis between Th1 and Th2 clones revealed by RNA hybridization, functionally monospecific bioassays, and monoclonal antibodies.
J. Exp. Med.
166:1229-1244[Abstract/Free Full Text].
|
| 5.
|
Chu, R. S.,
O. S. Targoni,
A. M. Krieg,
P. V. Lehmann, and C. V. Harding.
1997.
CpG oligodeoxynucleotides act as adjuvants that switch on T helper (Th1) immunity.
J. Exp. Med.
186:1623-1631[Abstract/Free Full Text].
|
| 6.
|
Cowdery, J. S.,
J. H. Chase,
A. K. Yi, and A. M. Krieg.
1996.
Bacterial DNA induces NK cells to produce IFN-gamma in vivo and increases the toxicity of lipopolysaccharides.
J. Immunol.
156:4570-4575[Abstract].
|
| 7.
|
Davis, H. L.,
R. Weeratna,
T. J. Waldschmidt,
L. Tygrett,
J. Schorr, and A. M. Krieg.
1998.
CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen.
J. Immunol.
160:870-876[Abstract/Free Full Text].
|
| 8.
|
Doolan, D. L.,
M. Sedegah,
R. C. Hedstrom,
P. Hobart,
Y. Charoenvit, and S. L. Hoffman.
1996.
Circumventing genetic restriction of protection against malaria with multigene DNA immunization: CD8+ T cell, interferon- , and nitric oxide dependent immunity.
J. Exp. Med.
183:1739-1746[Abstract/Free Full Text].
|
| 9.
|
Doolan, D. L., and S. L. Hoffman.
1999.
NK cells and IL-12 are required for antigen specific adaptive immunity against malaria initiated by CD8+ T cells.
J. Immunol.
163:884-892[Abstract/Free Full Text].
|
| 10.
|
Fearson, D. T., and R. M. Locksley.
1996.
The instructive role of innate immunity in the acquired immune response.
Science
272:50-54[Abstract].
|
| 11.
|
Ferreira, A.,
L. Schofield,
H. Schellekens,
P. van der Meide,
W. E. Collins,
R. S. Nussenzweig, and V. Nussenzweig.
1986.
Inhibition of development of exoerythrocytic forms of malaria parasites by gamma-interferon.
Science
232:881-884[Abstract/Free Full Text].
|
| 12.
|
Gonzalez-Aseguinolaza, G.,
C. de Oliveira,
M. Tomaska,
S. Hong,
O. Bruna-Romero,
T. Nakayama,
M. Taniguchi,
A. Bendelac,
L. Van Kaer,
Y. Koezuka, and M. Tsuji.
2000.
-galactosylceramide-activated V 14 natural killer T cells mediate protection against murine malaria.
Proc. Natl. Acad. Sci. USA
97:8461-8466[Abstract/Free Full Text].
|
| 13.
|
Heeg, K., and S. Zimmermann.
2000.
CpG DNA as a Th1 trigger.
Int. Arch. Allergy Immunol.
121:87-97[CrossRef][Medline].
|
| 14.
|
Hoffman, S. L., and L. H. Miller.
1996.
Perspectives on malaria vaccine development, p. 1-13.
In
S. L. Hoffman (ed.), Malaria vaccine development: a multi-immune response approach. American Society for Microbiology, Washington, D.C.
|
| 15.
|
Hoffman, S. L.,
S. K. Crutcher,
S. K. Puri,
A. A. Ansari,
F. Villinger,
E. D. Franke,
P. P. Singh,
F. Finkelman,
M. K. Gately,
G. P. Dutta, and M. Sedegah.
1997.
Sterile protection of monkeys against malaria after administration of interleukin-12.
Nat. Med.
3:80-83[CrossRef][Medline].
|
| 16.
|
Jones, T. R.,
N. Obaldia III,
R. A. Gramzinski,
Y. Charoenvit,
N. Kolodny,
S. Kitov,
H. L. Davis,
A. M. Krieg, and S. L. Hoffman.
1999.
Synthetic oligodeoxynucleotides containing CpG motifs enhance immunogenicity of a peptide malaria vaccine in Aotus monkeys.
Vaccine
17:3065-3071[CrossRef][Medline].
|
| 17.
|
Klinman, D.,
A. K. Yi,
S. L. Beaucage,
J. Conover, and A. M. Krieg.
1996.
CpG motifs expressed by bacterial DNA rapidly induce lymphocytes to secrete IL-6, IL-12, and IFN.
Proc. Natl. Acad. Sci. USA
93:2879-2883[Abstract/Free Full Text].
|
| 18.
|
Krieg, A. M.,
A.-K. Yi,
S. Matson,
T. J. Waldschmidt,
G. A. Bishop,
R. Teasdale,
G. Koretzky, and D. Klinman.
1995.
CpG motifs in bacterial DNA trigger direct B-cell activation.
Nature
374:546-549[CrossRef][Medline].
|
| 19.
|
Krieg, A. M.,
I. Love-Homan,
A. K. Yi, and J. T. Harty.
1998.
CpG DNA induces sustained IL-12 expression in vivo and resistance to Listeria monocytogenes challenge.
J. Immunol.
161:2428-2434[Abstract/Free Full Text].
|
| 20.
|
Krieg, A. M.
1999.
Mechanisms and applications of immune stimulatory CpG oligodeoxynucleotides.
Biochim. Biophys. Acta
1489:107-116[Medline].
|
| 21.
|
Krieg, A. M.
2000.
The role of CpG motifs in innate immunity.
Curr. Opin. Immunol.
12:35-43[CrossRef][Medline].
|
| 22.
|
Krieg, A. M.,
G. Hartmann, and A. K. Yi.
2000.
Mechanism of action of CpG DNA.
Curr. Top. Microbiol. Immunol.
247:1-21[Medline].
|
| 23.
|
Lipford, G. B.,
M. Bauer,
C. Blank,
R. Reiter,
H. Wagner, and K. Heeg.
1987.
CpG-containing synthetic oligonucleotides promote B and cytotoxic T cell responses to protein antigen: a new class of vaccine adjuvants.
Eur. J. Immunol.
27:2340-2344.
|
| 24.
|
Mellouk, S.,
S. J. Green,
C. A. Nacy, and S. L. Hoffman.
1991.
IFN-gamma inhibits development of Plasmodium berghei exoerythrocytic stages in hepatocytes by an L-arginine-dependent effector mechanism.
J. Immunol.
146:3971-3976[Abstract].
|
| 25.
|
Mellouk, S.,
S. L. Hoffman,
Z. Z. Liu,
P. De la Vega,
T. R. Billiar, and A. K. Nussler.
1994.
Nitric oxide-mediated anti-plasmodial activity in human and murine hepatocytes induced by gamma interferon and the parasite itself:enhancement by exogenous tetrahydrobiopterin.
Infect. Immun.
62:4043-4046[Abstract/Free Full Text].
|
| 26.
|
Messina, J. P.,
G. S. Gilkeson, and D. S. Pisetsky.
1991.
Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA.
J. Immunol.
147:1759-1764[Abstract].
|
| 27.
|
Miller, L. H., and S. L. Hoffman.
1998.
Research toward vaccines against malaria.
Nat. Med.
4:520-524[CrossRef][Medline].
|
| 28.
|
O'Garra, A.
1998.
Cytokines induce the development of functionally heterogenous T helper cell subsets.
Immunity
8:275-283[CrossRef][Medline].
|
| 29.
|
Pied, S.,
J. Roland,
A. Louise,
D. Voegtle,
V. Soulard,
D. Mazier, and P.-A. Cazenave.
2000.
Liver CD4 CD8 NK1.1+ TCR intermediate cells increase during experimental malaria infection and are able to exhibit inhibitory activity against the parasite liver stage in vitro.
J. Immunol.
164:1463-1469[Abstract/Free Full Text].
|
| 30.
|
Roman, M.,
E. Martinorozco,
S. Goodman,
M. D. Nguygen,
Y. Sato,
A. Ronaghy,
R. S. Kornbluth,
D. D. Richman,
D. A. Carson, and E. Raz.
1997.
Immunostimulatory DNA sequences function as T helper-1 promoting adjuvants.
Nat. Med.
3:849-854[CrossRef][Medline].
|
| 31.
|
Sedegah, M.,
F. Finkelman, and S. L. Hoffman.
1994.
Interleukin-12 induction of interferon gamma-dependent protection against malaria.
Proc. Natl. Acad. Sci. USA
91:10700-10702[Abstract/Free Full Text].
|
| 32.
|
Sun, S.,
H. Kishimoto, and J. Sprent.
1998.
DNA as an adjuvant: capacity of insect DNA and synthetic oligodeoxynucleotides to augment T cell responses to specific antigen.
J. Exp. Med.
187:1145-1150[Abstract/Free Full Text].
|
| 33.
|
Tokunaga, T.,
H. Yamamoto,
S. Shimada,
H. Abe,
T. Fukuda,
Y. Fujisawa,
Y. Furutani,
O. Yano,
T. Kataoka,
T. Sudo,
N. Makiguchi, and T. Suganuma.
1984.
Antitumor activity of deoxyribonucleic acid fraction from mycobacterium bovis BCG. I. Isolation, physicochemical characterization, and antitumor activity.
JNCI
72:955-962.
|
| 34.
|
Weiner, G. J.,
H.-M. Liu,
J. E. Wooldridge,
C. E. Dahle, and A. M. Krieg.
1997.
Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization.
Proc. Natl. Acad. Sci. USA
94:10833-10837[Abstract/Free Full Text].
|
| 35.
|
World Health Organization.
1997.
World health report 1997: conquering suffering, enriching humanity.
World Health Organization, Geneva, Switzerland.
|
| 36.
|
Wysocka, M.,
M. Kubin,
L. Q. Vieira,
L. Ozmen,
G. Garotta,
P. Scott, and G. Trinchieri.
1995.
Interleukin-12 is required for interferon-gamma production and lethality in lipopolysaccharide-induced shock in mice.
Eur. J. Immunol.
25:672-676[Medline].
|
| 37.
|
Yi, A.-K.,
D. M. Klinman,
T. L. Martin,
S. Matson, and A. M. Krieg.
1996.
Rapid immune activation by CpG motifs in bacterial DNA: systemic induction of IL-6 transcription through an antioxidant-sensitive pathway.
J. Immunol.
157:5394-5402[Abstract].
|
| 38.
|
Yoneto, T.,
T. Yoshimoto,
C. R. Wang,
Y. Takahama,
M. Tsuji,
S. Waki, and H. Nariuchi.
1999.
Gamma interferon production is critical for protective immunity to infection with blood-stage Plasmodium berghei XAT but neither NO production nor NK cell activation is critical.
Infect. Immun.
67:2349-2356[Abstract/Free Full Text].
|
| 39.
|
Zimmermann, S.,
O. Egeter,
S. Hausmann,
G. B. Lipford,
M. Rocken,
H. Wagner, and K. Heeg.
1988.
CpG oligodeoxynucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis.
J. Immunol.
160:3627-3630[Abstract/Free Full Text].
|
Infection and Immunity, March 2001, p. 1643-1649, Vol. 69, No. 3
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.3.1643-1649.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Krieg, A. M.
(2007). Antiinfective Applications of Toll-like Receptor 9 Agonists. Proc Am Thorac Soc
4: 289-294
[Abstract]
[Full Text]
-
Harris, T. H., Mansfield, J. M., Paulnock, D. M.
(2007). CpG Oligodeoxynucleotide Treatment Enhances Innate Resistance and Acquired Immunity to African Trypanosomes. Infect. Immun.
75: 2366-2373
[Abstract]
[Full Text]
-
Adachi, Y., Kindzelskii, A. L., Petty, A. R., Huang, J.-B., Maeda, N., Yotsumoto, S., Aratani, Y., Ohno, N., Petty, H. R.
(2006). IFN-{gamma} Primes RAW264 Macrophages and Human Monocytes for Enhanced Oxidant Production in Response to CpG DNA via Metabolic Signaling: Roles of TLR9 and Myeloperoxidase Trafficking.. J. Immunol.
176: 5033-5040
[Abstract]
[Full Text]
-
Waag, D. M., McCluskie, M. J., Zhang, N., Krieg, A. M.
(2006). A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei. Infect. Immun.
74: 1944-1948
[Abstract]
[Full Text]
-
Ito, S., Ishii, K. J., Ihata, A., Klinman, D. M.
(2005). Contribution of Nitric Oxide to CpG-Mediated Protection against Listeria monocytogenes. Infect. Immun.
73: 3803-3805
[Abstract]
[Full Text]
-
Ito, S., Ishii, K. J., Gursel, M., Shirotra, H., Ihata, A., Klinman, D. M.
(2005). CpG Oligodeoxynucleotides Enhance Neonatal Resistance to Listeria Infection. J. Immunol.
174: 777-782
[Abstract]
[Full Text]
-
Deng, J. C., Moore, T. A., Newstead, M. W., Zeng, X., Krieg, A. M., Standiford, T. J.
(2004). CpG Oligodeoxynucleotides Stimulate Protective Innate Immunity against Pulmonary Klebsiella Infection. J. Immunol.
173: 5148-5155
[Abstract]
[Full Text]
-
Wongratanacheewin, S., Kespichayawattana, W., Intachote, P., Pichyangkul, S., Sermswan, R. W., Krieg, A. M., Sirisinha, S.
(2004). Immunostimulatory CpG Oligodeoxynucleotide Confers Protection in a Murine Model of Infection with Burkholderia pseudomallei. Infect. Immun.
72: 4494-4502
[Abstract]
[Full Text]
-
Ito, S.-i., Ishii, K. J., Shirota, H., Klinman, D. M.
(2004). CpG Oligodeoxynucleotides Improve the Survival of Pregnant and Fetal Mice following Listeria monocytogenes Infection. Infect. Immun.
72: 3543-3548
[Abstract]
[Full Text]
-
Kumar, S., Jones, T. R., Oakley, M. S., Zheng, H., Kuppusamy, S. P., Taye, A., Krieg, A. M., Stowers, A. W., Kaslow, D. C., Hoffman, S. L.
(2004). CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine. Infect. Immun.
72: 949-957
[Abstract]
[Full Text]
-
Osorio, Y., Cohen, J., Ghiasi, H.
(2004). Improved Protection from Primary Ocular HSV-1 Infection and Establishment of Latency Using Multigenic DNA Vaccines. IOVS
45: 506-514
[Abstract]
[Full Text]
-
Raghavan, S., Nystrom, J., Fredriksson, M., Holmgren, J., Harandi, A. M.
(2003). Orally Administered CpG Oligodeoxynucleotide Induces Production of CXC and CC Chemokines in the Gastric Mucosa and Suppresses Bacterial Colonization in a Mouse Model of Helicobacter pylori Infection. Infect. Immun.
71: 7014-7022
[Abstract]
[Full Text]
-
Su, Z., Tam, M.-F., Jankovic, D., Stevenson, M. M.
(2003). Vaccination with Novel Immunostimulatory Adjuvants against Blood-Stage Malaria in Mice. Infect. Immun.
71: 5178-5187
[Abstract]
[Full Text]
-
Ashkar, A. A., Bauer, S., Mitchell, W. J., Vieira, J., Rosenthal, K. L.
(2003). Local Delivery of CpG Oligodeoxynucleotides Induces Rapid Changes in the Genital Mucosa and Inhibits Replication, but Not Entry, of Herpes Simplex Virus Type 2. J. Virol.
77: 8948-8956
[Abstract]
[Full Text]
-
Harandi, A. M., Eriksson, K., Holmgren, J.
(2002). A Protective Role of Locally Administered Immunostimulatory CpG Oligodeoxynucleotide in a Mouse Model of Genital Herpes Infection. J. Virol.
77: 953-962
[Abstract]
[Full Text]
-
Near, K. A., Stowers, A. W., Jankovic, D., Kaslow, D. C.
(2002). Improved Immunogenicity and Efficacy of the Recombinant 19-Kilodalton Merozoite Surface Protein 1 by the Addition of Oligodeoxynucleotide and Aluminum Hydroxide Gel in a Murine Malaria Vaccine Model. Infect. Immun.
70: 692-701
[Abstract]
[Full Text]