Previous Article | Next Article ![]()
Infection and Immunity, March 2001, p. 1687-1696, Vol. 69, No. 3
Department of Medicine and Department of
Microbiology and Immunology, Emory University School of
Medicine,1 Research Service, VA Medical
Center,2 and Centers for Disease Control
and Prevention,4 Atlanta, and State
University of West Georgia, Carrollton,3 Georgia
Received 6 September 2000/Returned for modification 5 October
2000/Accepted 27 November 2000
The genetic structure and evolution of a novel exchangeable
meningococcal genomic island was defined for the important human pathogen Neisseria meningitidis. In 125 meningococcal
strains tested, one of three unrelated nucleotide sequences, designated exl (exchangeable locus), was found between a gene
required for heme utilization, hemO, and
col, encoding a putative Escherichia coli
collagenase homologue. The 5' boundary of each exl
cassette was the stop codon of hemO, whereas the 3'
boundary was delineated by a 33-bp repeat containing neisserial uptake
sequences located downstream of col. One of the three
alternative exl cassettes contained the meningococcal
hemoglobin receptor gene, hmbR (exl3). In
other meningococcal strains, hmbR was absent from the
genome and was replaced by either a nucleotide sequence containing a novel open reading frame, exl2, or a cassette
containing exl3. The proteins encoded by
exl2 and exl3 had no significant amino acid homology to HmbR but contained six motifs that are also present in
the lipoprotein components of the lactoferrin (LbpB), transferrin (TbpB), and hemoglobin-haptoglobin (HpuA) uptake systems. To determine the evolutionary relationships among meningococci carrying
hmbR, exl2, or exl3,
isolates representing 92 electrophoretic types were examined.
hmbR was found throughout the population structure of
N. meningitidis (genetic distance, >0.425), whereas
exl2 and exl3 were found in clonal groups
at genetic distances of <0.2. The commensal neisserial species were
identified as reservoirs for all of the exl cassettes
found in meningococci. The structure of these cassettes and their
correlation with clonal groups emphasize the extensive gene pool and
frequent horizontal DNA transfer events that contribute to the
evolution and virulence of N. meningitidis.
The distinct syndrome of epidemic
meningitis and meningococcemia caused by Neisseria
meningitidis was first reported in 1805 (6). An
interesting aspect of this naturally transformable human pathogen is
the rapid evolution of the meningococcal genome through high-frequency
recombination events and uptake of DNA (10). Because of
this high rate of microevolution, the emergence of new clonal groups
responsible for outbreaks of meningococcal disease can be readily
detected through genetic typing (2). These approaches have
identified the emergence of new clonal groups since the 1960s, the most
recent being lineage III, originally found in The Netherlands in 1980 but now detected worldwide (2).
Conceptually, transformation and recombination of foreign DNA
into the neisserial genome could also facilitate the
incorporation of a new gene(s) into the meningococcal
chromosome. DNA fragments containing uptake sequences are
preferentially incorporated into the genomes of naturally transformable
species such as Haemophilus influenzae
(5), N. meningitidis, and N. gonorrhoeae (16). Uptake sequence-mediated DNA uptake
has been proposed to be the mechanism by which sodC from
Haemophilus spp. has been incorporated into the
meningococcal genome (13). Transformation and
recombination are also proposed to be the mechanisms through which the
DNA island containing the capsule biosynthesis genes was originally
inserted between the conserved genes tex and galE
in the genome of N. meningitidis (22;
D. S. Stephens et al., unpublished data). Further evidence suggests that this process facilitates the exchange of different capsule biosynthesis loci, resulting in capsule switching
(35). Apart from the capsule loci, other
meningococcus-specific genetic cassettes found so far include
those encoding glutathione peroxidase (19), rotamase
(30), and the RTX (repeats in toxin) toxin-like Frp
proteins (37). Subtractive hybridization of meningococcal and gonococcal genomes has identified at least eight genetic islands in
meningococci (11). However, the extent of the gene pool, the rate of dissemination, the mechanisms of acquisition of new genes,
and the association of new genes with virulence in N. meningitidis remain poorly understood.
A comparison of the meningococcal genomes of serogroup A strain Z2491
and serogroup B strain MC58 (21, 36) has revealed that
other genetic islands exist within N. meningitidis. The
genes encoding the hemoglobin (Hb)-haptoglobin (Hp) receptor,
hpuAB, are located on a genetic island that is present in
serogroup A strain Z2491 but absent in serogroup B strain MC58. A
second phase-variable meningococcal Hb receptor, encoded by
hmbR, however, is present in both strains, suggesting that
this receptor is necessary for iron uptake from Hb in strain MC58.
Conversely, Richardson and Stojiljkovic (28) have found
that many clinical meningococcal isolates have lost hmbR but
have retained hpuAB. In this report, we have investigated
the genetic mechanism that results in the complete loss of the
hmbR locus from clinical meningococcal isolates. We have
identified an exchangeable DNA island (exl) consisting of
multiple cassettes that are capable of being exchanged for hmbR in the meningococcal genome. The commensal neisserial
species appear to be the reservoirs for these exl cassettes.
Bacterial strains and culture conditions.
Meningococcal
strains were cultured under aerobic conditions with 3.5%
CO2 at 37°C on GC agar (Difco) supplemented
with 0.4% glucose, 0.01% glutamine, 0.2 mg of cocarboxylase/liter,
and 5 mg of Fe(NO3)3/liter.
The meningococcal strains used in this study were obtained from several
geographic locations over a period of years and span the genetic
diversity of N. meningitidis. Invasive isolates collected as
part of a prospective population-based surveillance for meningococcal
disease in metropolitan Atlanta, Ga., from 1988 to the present
(25, 31), serogroup A meningococcal isolates representing
each clonal group (I to VIII) (kindly provided by Mark Achtman), and
isolates obtained from the collection of the Centers for Disease
Control and Prevention, Atlanta, Ga., were examined in this study.
Nasopharyngeal isolates were provided from a study of asymptomatic
carriers in the metropolitan Atlanta area (Stephens et al.,
unpublished). Commensal Neisseria spp. have been
described previously (18).
Amplification of the exl cassettes and flanking
regions.
The region surrounding the exl cassettes was
PCR amplified from chromosomal preparations of 10 meningococcal
isolates: NMB (32), 44/76 (38), 6940 (41), M981 (41), FAM18 (18), M1205 (35), M1843 (35), F8229
(23), GA0929 (Atlanta Surveillance Group, VA Medical
Center, Atlanta, Ga.), and 6083 (18). Gonococcal strain
FA1090 was used as a positive control. Region I (Fig.
1) was PCR amplified from these strains
using the primer pair pqi3A (5'-CTCGATATACGTCATACCGTAAGC-3')
and pqi11 (5'-GCGAACACGACTTTGTAGAATGC-3').
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.3.1687-1696.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
exl, an Exchangeable Genetic Island
in Neisseria meningitidis
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (23K):
[in a new window]
FIG. 1.
Genetic arrangement of the hmbR locus in
N. gonorrhoeae strain FA1090 (accession number AF319529)
and N. meningitidis strains NMB (accession numbers
AF319530 and AF319531), 44/76 (accession number AF319527), and FAM18
(accession number AF319528). Each ORF is represented by an arrow that
indicates the direction of transcription. The thin black vertical line
indicates the position of a 23-bp sequence which is duplicated in
hemO of strain NMB. The thick grey vertical lines
indicate the positions of the 33-bp repeats of orfU.
Black bars represent a 112-bp conserved nucleotide sequence immediately
bordering the 3' end of hmbR. White bars indicate the
locations of neisserial repeat sequences (4). Hatched bars
indicate the positions of the 1,280-bp sequence containing
orfYX.
Southern blot analysis. Chromosomal DNA from meningococcal strains was prepared using the method of Nath (20). Double-stranded DNA probes were labeled with digoxigenin using a Genius 2 labeling kit (Boehringer Mannheim Biochemicals) according to the manufacturer's instructions. The internal hmbR probe from N. meningitidis strain NMB was amplified with hmbR2 (5'-GAAGCTGCAACCGAAACCACACC-3') and hmbR3 (5'-GTGGTGCTGTAGCTATACAAACCG-3'), the exl2 probe from N. meningitidis strain GA0929 was amplified with tbp1 (5'-GTCTAGCTCTTTCAGCTTGTAGTTCG-3') and col12 (5'-GCTTTCGTCAAATCAAGGATTCAAACG-3'), and the exl3 probe from N. meningitidis strain 6083 was amplified with Acol23 (5'-GAACATACTGAGCCTGCGATGAATGC-3') and Acol28 (5'-CATCCCCATACCTGAAGGATCTTTGG-3'). Chromosomal DNA was digested with either Bsp106 or StyI overnight and electrophoresed in a 0.7% agarose gel. Southern transfer onto a nylon membrane was performed as described by Maniatis et al. (15). Hybridization and development of the Southern blots were carried out according to the instructions for the Genius system (Boehringer).
DNA sequencing. Automated sequencing was performed at the Emory DNA Sequencing Core Facility (VA Medical Center, Atlanta, Ga.). The sequence was analyzed using the GAP sequence comparison program of the Genetics Computer Group software package (version 7.3.1 for UNIX) and the Lasergene suite of programs (DNASTAR). All the sequences described in this manuscript have been submitted to GenBank (see below).
Multilocus enzyme electrophoresis. Multilocus enzyme electrophoresis was carried out by established methods (39). Briefly, constitutive cytosolic enzymes were extracted and run in 11% starch gels. The band position for each of 24 cellular enzymes was established by specific staining for each enzyme. Relative enzyme mobilities (alleles) were numbered in order of increasing anodal migration, and each unique set of alleles was defined as an electrophoretic type (ET). Strains representing ET0717, ET0715, ET0712, ET700, and ET708 were included as markers for serogroup A subgroups I, II, III, IV-1, V, VI, VII, and VIII (courtesy of Tanya Popovic, Centers for Disease Control and Prevention) but were not available for exl cassette typing.
Carriage of exl cassettes in the meningococcal population. Colony PCR was performed on each isolate using an anchor primer, pqi10 (5'-GCATTCTACAAAGTCGTGTTCGC-3'), Fpqi10 (5'-GTGAAACCTTCGGTTTGCCGGAAGG-3), or Ypqi10 (5'-GCATTTTACAAAGTCGTGTTGCG-3'), paired with a primer specific for each open reading frame (ORF) located in the exl cassette. ORF-specific primers were hmbR2 and hmbR3 for hmbR; col14 (5'-GTCAAGTTGCGCGAACGGAAATGC-3') for exl2; Acol26 (5'-CCTGTTTTAGGTTGGTTATCGGCAGC-3') for exl3; and A1col2 (5'-CATATCACGGTTGTTTTCAGGCTGC-3') for exl3A. PCR amplification of an internal section of the conserved flanking gene, col, using primers col1 (5'-CGATTCGCTCGAAATCATCCACC-3') and col2 (5'-GGTGGATGATTTCGAGCGAATCG-3') was included as a positive control for template quality in every PCR run.
Nucleotide sequence accession numbers. The nucleotide sequences submitted to GenBank (accession numbers in parentheses) are as follows: region I from N. gonorrhoeae strain FA1090 (AF319529), region I from N. meningitidis strain NMB (AF319530), region II and III in N. meningitidis strain FAM18 (AF319528), region II and III from N. meningitidis strain NMB (AF319531), region II and III from N. meningitidis strain 44/76 (AF319527); exl2 from N. meningitidis strain GA0929 (AF319532), exl3 from N. meningitidis strain 6083 (AF319533), exl2C from N. cinerea (AF319536), exl3L from N. lactamica AF319537), exl3A from N. meningitidis strain Z5005 (AF319534), and exl3 from N. meningitidis strain Z5035 (AF319535).
| |
RESULTS |
|---|
|
|
|---|
Arrangement of the hmbR (exl1) locus in N. meningitidis We first studied the organization of the hmbR locus because of the reported linkage of hmbR to the lipopolysaccharide heptosyltransferase encoded by rfaC (33). Using chromosome walking, direct PCR, and sequencing, we found that rfaC was not linked to hmbR in N. meningitidis or N. gonorrhoeae (Fig. 1). DNA sequencing of the locus located upstream of hmbR an ORF which was subsequently termed hemO, as it encodes the heme oxygenase necessary for the release of iron from imported heme (40). Upstream of hemO lies a homologue of Escherichia coli pqiA which encodes a paraquat-inducible stress protein (12). The ORF downstream of hmbR was termed col and was predicted to encode a protein with 63% identity and 75% similarity to a putative collagenase from E. coli.
Region I contains pqiA and hemO and was shown by PCR to be identical in size in eight meningococcal isolates (see Materials and Methods). Region I in gonococcal strain FA1090 produced a larger PCR product which, upon sequencing, was shown to contain insertion element IS1016 and an associated 55-bp deletion located downstream of hemO (accession number AF319529). Nevertheless, a comparison of the hemO genes from gonococcal strain FA1090 and serogroup B meningococcal strain NMB (accession number AF319530) showed 88.5% nucleotide sequence identity between these two strains, indicating a high degree of conservation. Similarly, region II, which contains col (Fig. 1), was highly conserved at the nucleotide level in meningococcal strains FAM18 (accession number AF319528) and NMB (97% identity over 146 bp). Region III was polymorphic (Fig. 1) and contained four elements that were found in different combinations in the eight meningococcal isolates and the one gonocococcal strain examined. Downstream of col in strain FA1090, a 524-bp novel ORF, orfU, flanked by two 33-bp inverted repeats (AATGC CGTCTGAAAACGGTTTCAGACGGCATT) containing neisserial uptake sequences (shown in bold) was found (B. A. Roe, S. Clifton, and D. W. Dyer, Gonococcal Genome Sequencing Project [http://www.genome.ou.edu]). The organization of orfU resembles that of many insertion sequence elements. However, in meningococcal serogroup B strain NMB, orfU was replaced with a 1,280-bp sequence that contained a 418-bp ORF, orfX, and a 248-bp ORF, orfY (accession number AF319531). OrfX shares 50% identity at the amino acid level with a hypothetical protein encoded by an ORF found in multiple copies in the genomes of Synechocystis spp., whereas OrfY shares 34% amino acid identity with a conserved hypothetical protein from Streptomyces coelicolor (26). Region III of serogroup B meningococcal strain 44/76 (accession number AF319527) and serogroup C strain FAM18 (accession number AF319528) possessed hybrid sequences containing orfYX bounded by a neisserial repeat element and the 33-bp inverted repeat and either a partial or a complete orfU gene (Fig. 1). Southern analysis of these strains indicated that both orfYX and orfU were exclusively associated with this genomic location (data not shown). The various combinations and arrangements of the elements in region III suggest that it is a site for recombination. Invariably, region III was delineated by the stop codon of hemO and the 33-bp repeat found downstream of col. Region III will be subsequently referred to as the exl (exchangeable locus) cassette.Detection and organization of exl2 and
exl3 loci in N. meningitidis
Southern analysis of a panel of 10 meningococcal isolates using an
hmbR probe revealed that serogroup Y strain GA0929 and serogroup W-135 strain 6083 did not contain hmbR (Fig.
2A). The region between
hemO and col from both isolates was
amplified and then sequenced. Region I from strains GA0929 (accession
number AF319532) and 6083 (accession number AF319533) were both 93%
identical to the corresponding region in strain NMB (data not shown).
Likewise, col from region II (146 bp) was 100%
identical in GA0929 and 6083 and 94% identical to the same region in
strain NMB. The 1,904-bp exl cassette in strain GA0929,
however, diverged from the hmbR loci immediately
after the stop codon of hemO (Fig. 3) and contained an 809-bp ORF designated
exl2. Southern analysis of the panel of 10 meningococcal
isolates using a specific probe containing an internal section of
exl2 showed that none of the hmbR-containing strains carried this ORF elsewhere in
their chromosomes (Fig. 2).
|
|
|
Commensal Neisseria species contain hmbR, exl2, and exl3 Stojiljkovic et al. (34) previously showed that the commensal Neisseria spp., N. polysaccharea and N. perflava, contain hmbR. To determine whether exl2 and exl3 were also present in commensal Neisseria spp., Southern hybridization using exl probes was performed on a representative sample of commensal strains. Representative isolates of N. polysaccharea, N. mucosa, and N. macaca contained a locus which hybridized to the hmbR probe, whereas the exl3 probe hybridized to N. lactamica and N. flavescens. N. cinerea hybridized to the exl2 probe. Three isolates representing the commensal species N. subflava, N. elongata, and N. sicca did not bind to any of the probes. As with meningococci, hmbR, exl2, and exl3 were mutually exclusive, with only one copy of each ORF present in each genome. The linkage of pqiA to col in N. lactamica, N. flavescens, N. cinerea, and N. polysaccharea was confirmed by PCR. The organization of this region in the N. subflava and N. sicca isolates that we examined could not be confirmed, even though pqiA and col were present in their genomes (data not shown).
A comparison of the nucleotide sequence of exl2 from N. meningitidis strain GA0929 with that of its homologue in N. cinerea (accession number AF319536) indicated that meningococcal exl2 had been shortened by an internal deletion that removed 331 codons (or one-third of the ORF). The translational frame of meningococcal exl2 was maintained but contained a stop codon at position 203. These features suggest that meningococcal exl2 was a deletion version of the ORF designated exl2C in N. cinerea (data not shown). The nucleotide sequences of the exl3-like ORF from N. lactamica (exl3L; accession number AF319537) and exl3 from N. meningitidis strain 6083 were 63% identical (data not shown). Complete analysis of an exl cassette from the serogroup A meningococcal strain Z5005, which hybridized weakly to the exl3 probe, revealed the presence of a third variant of exl3, termed exl3A (accession number AF319534). In contrast to the size variations observed in exl2 variants, all of the exl3 variants were of approximately similar sizes. For clarity, we assigned new gene names where the nucleotide sequence of an ORF was less than 90% identical to the closest homologue.Distributions of hmbR, exl2, and
exl3 in the N. meningitidis
population.
A survey of 125 meningococcal isolates representing 92 ETs (genetic distance, >0.425) was conducted to determine the
distributions of hmbR, exl2, and exl3
or exl3A in the meningococcal population. Multiple isolates
with the same ET contained the same exl cassette (data not
shown). When categorized by serogroup, isolates of serogroups B, C, and
A contained similar proportions of hmbR and exl3
or exl3A (approximately 80 and 20%, respectively). In
contrast, 55% of serogroup Y strains (11 of 20) examined carried
exl2, 35% (7 of 20) carried exl3 or
exl3A, and 10% (2 of 20) contained hmbR. Nongroupable isolates collected from asymptomatic carriers contained hmbR, exl2, and exl3A in a ratio of
6:3:1. From this survey, no correlation of exl type with
site of isolation could be found (e.g., blood, cerebrospinal fluid, or
nasopharynx) (Fig. 5).
|
Acquisition, dissemination, and microevolution of
exl2 and exl3.
To understand the
dissemination of the exl cassettes, we analyzed the
nucleotide sequences of 10 meningococcal isolates (genetic distance,
>0.4) that contained exl3 alleles (allele defined as >90% identity at the nucleotide sequence level). A 290-bp region spanning the last 56 bp of hemO, the intergenic space, and
the first 124 bp of the exl3 allele was amplified and
sequenced. We hypothesized that if the insertion of the
exl3-containing cassettes were the result of a specific
integration into this region, then polymorphisms within the
hemO nucleotide sequence would be randomly distributed and
not linked to polymorphisms in the exl3 sequences. However,
in the 10 meningococcal isolates and an N. lactamica isolate, the sequence polymorphisms in hemO and the
intergenic space were linked to the sequence polymorphisms in the
exl3, exl3A, and exl3L alleles
(Fig.
6A).
These results indicated that homologous recombination within the
conserved flanking gene, hemO, is the mechanism by which the
exl cassettes have spread in meningococci.
|
| |
DISCUSSION |
|---|
|
|
|---|
The ability of N. meningitidis and N. gonorrhoeae to establish infections is in part due to their ability to scavenge essential nutrients, such as iron, from human tissues. Indeed, it has been recently shown that the ability to utilize transferrin is essential for gonococci to establish an infection in the human challenge model (3). Unlike many other pathogens that use siderophores to shuttle iron, meningococci and gonococci express at least four outer membrane protein receptors that are specific for transferrin (tbpAB), lactoferrin (lbpAB), Hb (hmbR), and Hb-Hp complexes (hpuAB) (7). Once heme has been transported into the cytoplasm, iron is released from the heme by a heme oxygenase-like enzyme, encoded by hemO, which is found upstream of hmbR (40).
However, during the investigation of the genetic region containing hemO, we found that many meningococcal isolates did not contain hmbR. In these isolates, hmbR was absent from the chromosome and had been replaced by two distinct DNA islands, which contain ORFs exl2 and exl3. The predicted Exl2 and Exl3 proteins had significant sequence identity with GNA2132, a highly antigenic TbpB-like protein that was recently identified as a potential vaccine candidate (24). In a broader context, Exl2, Exl3, and GNA2132 contain six motifs that are also present in TbpB, LbpB, and HpuA (Fig. 4). TbpB contains two sets of these motifs, one each in the N-terminal and C-terminal domains, which are hypothesized to be involved in binding to the bilobed substrate human transferrin (27). The function of these motifs, however, in LbpB and HpuA, which differ from TbpB in their substrate specificities, is currently unknown. The family of proteins consisting of Exl2, Exl3, and GNA2132 may represent iron binding proteins with an as-yet-undefined substrate specificity.
A comparison of the organization of the exl cassettes in meningococci and commensal Neisseria spp. suggests that each cassette arose from a specific insertion event. This concept is supported by the finding that each exl cassette is delineated by clearly defined 5' (hemO stop codon) and 3' (uptake sequence downstream of col) boundaries. In this respect, each cassette resembles an integron, but no other features, such as an integration site (att) or a gene encoding an integrase, could be identified (9). Since orfYX and orfU have some of the features of insertion sequence elements and are located at the 3' boundary of each exl cassette, they may have been involved in the initial acquisition of the exl cassettes (8). Correlation of the nucleotide polymorphisms outside the 5' boundary of the exl cassette with base-pair changes found in the cassette, however, indicates that once the cassette was inserted, it was disseminated by homologous recombination within the conserved flanking neisserial genes.
The prevalence of hmbR within the meningococcal population and in N. gonorrhoeae suggests that hmbR may have been present in a common ancestor. Although hmbR has a high degree of primary sequence conservation, alleles of this gene have been previously identified (34), indicating that hmbR has undergone microevolution within meningococci. Examination of the exl cassettes containing exl3 and exl3A within the meningococcal population also revealed that these genes have undergone microevolution, and evidence of transfer of identical exl3 and exl3A alleles to distantly related strains indicates that horizontal transfer has occurred in the meningococcal population. The finding that exl3 and exl3A are mostly confined to a few clonal groups suggests, however, that these alleles have only recently been acquired by meningococci and are slowly being dispersed by homologous recombination outside these organisms.
The detection of only one allele of the exl2-containing cassette suggests that it has only recently been acquired by meningococci. Further, the exl2-containing DNA cassette is largely restricted to strains within the ET501-ET508 clonal complex. Interestingly, the ET501-ET508 clonal complex has a relatively short history, as it has emerged over the last decade as a major causative agent of serogroup Y disease in the United States (29). The presence of the exl2-containing DNA cassette in meningococci offers the unique opportunity to track the rates of microevolution and dissemination of a novel gene within the meningococcal population.
In this report, we have defined an exchangeable DNA island that has been inserted into a single site in the meningococcal chromosome and that consists of at least three distinct cassettes. One of these cassettes encodes the Hb receptor, HmbR, while the other two cassettes encode unique proteins, Exl3 or Exl3A and Exl2. It is currently unclear why so many different strategies have been used by N. meningitidis to change the patterns of expression of the Hb receptors HpuAB and HmbR. Apart from phase-variable expression, the genes of both receptors can be completely replaced or removed from the genome. It is possible that complete removal of HmbR has been developed as a way of replacing a relatively antigenically stable outer membrane protein (34) in the meningococcal population. For many other outer membrane proteins, such as TbpB (14), a high level of antigenic variation is necessary for maintenance in the meningococcal population.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by NIH grant AI-33517-08 from the National Institute of Allergy and Infectious Diseases of the National Institutes of Health.
We thank John K. Davies and Harry Sakellaris for critical reading of the manuscript. We are also grateful to Lane Pucko for assistance in preparing the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Present address: Department of Microbiology, Monash University, Wellington Rd., Clayton 3800, Australia. Phone: 03/99054842. Fax: 03/99054811. E-mail: charlene.kahler{at}monash.edu.au.
Editor: T. R. Kozel
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Altschul, S. F.,
T. L. Madden,
A. A. Schäffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402 |
| 2. | Caugant, D. A. 1998. Population genetics and molecular epidemiology of Neisseria meningitidis. APMIS 106:505-525[Medline]. |
| 3. | Cornelissen, C. N., M. Kelley, M. M. Hobbs, J. E. Anderson, J. G. Cannon, M. S. Cohen, and P. F. Sparling. 1998. The transferrin receptor expressed by gonococcal strain FA1090 is required for the experimental infection of human male volunteers. Mol. Microbiol. 27:611-616[CrossRef][Medline]. |
| 4. |
Correia, F. F.,
S. Inouye, and M. Inouye.
1988.
A family of small repeated elements with some transposon-like properties in the genome of Neisseria gonorrhoeae.
J. Biol. Chem.
263:12194-12198 |
| 5. | Deich, R. A., and H. O. Smith. 1980. Mechanism of homospecific DNA uptake in Haemophilus influenzae transformation. Mol. Gen. Genet. 177:369-374[CrossRef][Medline]. |
| 6. |
DeVoe, I. W.
1982.
The meningococcus and mechanisms of pathogenicity.
Microbiol. Rev.
46:162-190 |
| 7. | Genco, C. A., and P. J. Desai. 1996. Iron acquisition in the pathogenic Neisseria. Trends Microbiol. 4:179-184[CrossRef][Medline]. |
| 8. | Hacker, J., G. Blum-Oehler, I. Muhldorfer, and H. Tschape. 1997. Pathogenicity islands of virulent bacteria: structure, function and impact on microbial evolution. Mol. Microbiol. 23:1089-1097[CrossRef][Medline]. |
| 9. | Hall, R. M., C. M. Collis, M. J. Kim, S. R. Partridge, G. D. Recchia, and H. W. Stokes. 1999. Mobile gene cassettes and integrons in evolution. Ann. N. Y. Acad. Sci. 870:68-80[CrossRef][Medline]. |
| 10. | Holmes, E. C., R. Urwin, and M. C. J. Maiden. 1999. The influence of recombination on the population structure and evolution of the human pathogen Neisseria meningitidis. Mol. Biol. Evol. 16:741-749[Abstract]. |
| 11. |
Klee, S. R.,
X. Nassif,
B. Kusecek,
P. Merker,
J.-L. Beretti,
M. Achtman, and C. R. Tinsley.
2000.
Molecular and biological analysis of eight genetic islands that distinguish Neisseria meningitidis from the closely related pathogen Neisseria gonorrhoeae.
Infect. Immun.
68:2082-2095 |
| 12. |
Koh, Y.-S., and J.-H. Roe.
1995.
Isolation of a novel paraquat-inducible (pqi) gene regulated by the soxRS locus in Escherichia coli.
J. Bacteriol.
177:2673-2678 |
| 13. |
Kroll, J. S.,
K. E. Wilks,
J. L. Farrant, and P. R. Langford.
1998.
Natural genetic exchange between Haemophilus and Neisseria: intergeneric transfer of chromosomal genes between major human pathogens.
Proc. Natl. Acad. Sci. USA
95:12381-12385 |
| 14. | Linz, B., M. Schenker, P. Zhu, and M. Achtman. 2000. Frequent interspecific genetic exchange between commensal Neisseriae and Neisseria meningitidis. Mol. Microbiol. 36:1049-1058[CrossRef][Medline]. |
| 15. | Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 16. |
Mathis, L. S., and J. J. Scocca.
1982.
Haemophilus influenzae and Neisseria gonorrhoeae recognize different specificity determinants in the DNA uptake step of genetic transformation.
J. Gen. Microbiol.
128:1159-1161 |
| 17. | Mazarin, V., B. Rokbi, and M. J. Quentin-Millet. 1995. Diversity of the transferrin-binding protein Tbp2 of Neisseria meningitidis. Gene 158:145-146[CrossRef][Medline]. |
| 18. | McAllister, C. F., and D. S. Stephens. 1993. Analysis in Neisseria meningitidis and other Neisseria species of genes homologous to the FKBP immunophilin family. Mol. Microbiol. 10:13-23[CrossRef][Medline]. |
| 19. | Moore, T. D. E., and P. F. Sparling. 1995. Isolation and identification of a glutathione peroxidase homolog gene, gpxA, present in Neisseria meningitidis but absent in Neisseria gonorrhoeae. Infect. Immun. 63:1603-1607[Abstract]. |
| 20. |
Nath, K.
1990.
A rapid DNA isolation procedure from petri dish grown clinical bacterial isolates.
Nucleic Acids Res.
18:6462 |
| 21. | Parkhill, J., M. Achtman, K. D. James, S. D. Bentley, C. Churcher, S. R. Klee, G. Morelli, D. Basham, D. Brown, T. Chillingworth, R. M. Davies, P. Davis, K. Devlin, T. Feltwell, N. Hamlin, S. Holroyd, K. Jagels, S. Leather, S. Moule, K. Mungall, M. A. Quail, M.-A. Rajandream, K. M. Rutherford, M. Simmonds, J. Skelton, S. Whitehead, B. G. Spratt, and B. G. Barrell. 2000. Complete DNA sequence of a serogroup A strain of Neisseria meningitidis Z2491. Nature 404:502-506[CrossRef][Medline]. |
| 22. |
Petering, H.,
S. Hammerschmidt,
M. Frosch,
J. P. M. van Putten,
C. A. Ison, and B. D. Robertson.
1996.
Genes associated with the meningococcal capsule complex are also found in Neisseria gonorrhoeae.
J. Bacteriol.
178:3342-3345 |
| 23. | Pine, L., F. Quinn, E. Ewing, Jr., K. Birkness, E. White, D. Stephens, and E. Ribot. 1995. Evaluation of the chick embryo for the determination of relative virulence of Neisseria meningitidis. FEMS Microbiol. Lett. 130:37-44[Medline]. |
| 24. |
Pizza, M.,
V. Scarlato,
V. Masignani,
M. M. Giuliani,
B. Arico,
M. Comanducci,
G. T. Jennings,
L. Baldi,
E. Bartolini,
B. Capecchi,
C. L. Galeotti,
E. Luzzi,
R. Manetti,
E. Marchetti,
M. Mora,
S. Nuti,
G. Ratti,
L. Santini,
S. Savino,
M. Scarselli,
E. Storni,
P. Zuo,
M. Broeker,
E. Hundt,
B. Knapp,
E. Blair,
T. Mason,
H. Tettelin,
D. W. Hood,
A. C. Jeffries,
N. J. Saunders,
D. M. Granoff,
J. C. Venter,
E. R. Moxon,
G. Grandi, and R. Rappuoli.
2000.
Identification of vaccine candidates against serogroup B meningococcus by whole-genome sequencing.
Science
287:1816-1820 |
| 25. | Raymond, N. J., M. Reeves, G. Ajello, W. Baughman, L. L. Gheesling, G. M. Carlone, J. D. Wenger, and D. S. Stephens. 1997. Molecular epidemiology of sporadic (endemic) serogroup C meningococcal disease. J. Infect. Dis. 176:1277-1284[Medline]. |
| 26. | Redenbach, M., H. M. Kieser, D. Denapaite, A. Eichner, J. Cullum, H. Kinashi, and D. A. Hopwood. 1996. A set of ordered cosmids and a detailed genetic and physical map for the 8 Mb Streptomyces coelicolor A3(2) chromosome. Mol. Microbiol. 21:77-96[CrossRef][Medline]. |
| 27. | Retzer, D. M., R. H. Yu, and A. B. Schryvers. 1999. Identification of sequences in human transferrin that bind to the bacterial receptor protein, transferrin-binding protein B. Mol. Microbiol. 32:111-121[CrossRef][Medline]. |
| 28. |
Richardson, A. R., and I. Stojiljkovic.
1999.
HmbR, a hemoglobin-binding outer membrane protein of Neisseria meningitidis, undergoes phase variation.
J. Bacteriol.
181:2067-2074 |
| 29. | Rosenstein, N. E., B. A. Perkins, D. S. Stephens, L. Lefkowitz, M. L. Cartter, R. Danila, P. Cieslak, K. A. Shutt, T. Popovic, A. Schuchat, L. H. Harrison, and A. L. Reingold. 1999. The changing epidemiology of meningococcal disease in the United States, 1992-1996. J. Infect. Dis. 180:1894-1901[CrossRef][Medline]. |
| 30. |
Sampson, B. A., and E. C. Gotschlich.
1992.
Neisseria meningitidis encodes an FK506-inhibitable rotamase.
Proc. Natl. Acad. Sci. USA
89:1164-1168 |
| 31. |
Stephens, D. S.,
R. A. Hajjeh,
W. S. Baughman,
R. C. Harvey,
J. D. Wenger, and M. M. Farley.
1995.
Sporadic meningococcal disease in adults: results of a 5-year population-based study.
Ann. Intern. Med.
123:937-940 |
| 32. |
Stephens, D. S.,
J. S. Swartley,
S. Kathariou, and S. A. Morse.
1991.
Insertion of Tn916 in Neisseria meningitidis resulting in loss of group B capsular polysaccharide.
Infect. Immun.
59:4097-4102 |
| 33. |
Stojiljkovic, I.,
V. Hwa,
J. Larson,
L. Lin,
M. So, and X. Nassif.
1997.
Cloning and characterization of the Neisseria meningitidis rfaC gene encoding 1,5 heptosyltransferase I.
FEMS Microbiol. Lett.
151:41-49[Medline].
|
| 34. |
Stojiljkovic, I.,
J. Larson,
V. Hwa,
S. Anic, and M. So.
1996.
HmbR outer membrane receptors of pathogenic Neisseria spp.: iron-regulated, hemoglobin-binding proteins with a high level of primary structure conservation.
J. Bacteriol.
178:4670-4678 |
| 35. |
Swartley, J. S.,
A. A. Marfin,
S. Edupuganti,
L.-J. Liu,
P. Cieslak,
B. Perkins,
J. D. Wenger, and D. S. Stephens.
1997.
Capsule switching of Neisseria meningitidis.
Proc. Natl. Acad. Sci. USA
94:271-276 |
| 36. |
Tettelin, H.,
N. J. Saunders,
J. Heidelberg,
A. C. Jeffries,
K. E. Nelson,
J. A. Eisen,
K. A. Ketchum,
D. W. Hood,
J. F. Peden,
R. J. Dodson,
W. C. Nelson,
M. L. Gwinn,
R. DeBoy,
J. D. Peterson,
E. K. Hickey,
D. H. Haft,
S. L. Salzberg,
O. White,
R. D. Fleischmann,
B. A. Dougherty,
T. Mason,
A. Cieko,
D. S. Parksey,
E. Blair,
H. Cittone,
E. B. Clark,
M. D. Cotton,
T. R. Utterback,
H. Khouri,
H. Qin,
J. Vamathevan,
J. Gill,
V. Scarlato,
V. Masignani,
M. Pizza,
G. Grandi,
L. Sun,
H. O. Smith,
C. M. Fraser,
E. R. Moxon,
R. Rappuoli, and J. C. Venter.
2000.
Complete genome sequence of Neisseria meningitidis serogroup B strain MC58.
Science
287:1809-1815 |
| 37. | Thompson, S. A., L. L. Wang, and P. F. Sparling. 1993. Cloning and nucleotide sequence of frpC, a second gene from Neisseria meningitidis encoding a protein similar to RTX cytotoxins. Mol. Microbiol. 9:85-96[CrossRef][Medline]. |
| 38. |
Wakarchuk, W.,
A. Martin,
M. Jennings,
E. R. Moxon, and J. C. Richards.
1996.
Functional relationships of the genetic locus encoding the glycosyltransferase enzymes involved in expression of the lacto-N-neotetraose terminal lipopolysaccharide structure in Neisseria meningitidis.
J. Biol. Chem.
271:19166-19173 |
| 39. |
Woods, T. C.,
L. O. Helsel,
B. Swaminathan,
W. F. Bibb,
R. W. Pinner,
B. G. Gellin,
S. F. Collin,
S. H. Waterman,
M. W. Reeves,
D. J. Brenner, and C. V. Broome.
1992.
Characterization of Neisseria meningitidis serogroup C by multilocus enzyme electrophoresis and ribosomal DNA restriction profiles (ribotyping).
J. Clin. Microbiol.
30:132-137 |
| 40. |
Zhu, W.,
D. J. Hunt,
A. R. Richardson, and I. Stojiljkovic.
2000.
Use of heme compounds as iron sources by pathogenic neisseriae requires the product of the hemO gene.
J. Bacteriol.
182:439-447 |
| 41. |
Zollinger, W. D., and R. E. Mandrell.
1977.
Outer-membrane protein and lipopolysaccharide serotyping of Neisseria meningitidis by inhibition of a solid-phase radioimmunoassay.
Infect. Immun.
18:424-433 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»