Previous Article | Next Article 
Infection and Immunity, April 2001, p. 2211-2222, Vol. 69, No. 4
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.4.2211-2222.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Cloning and Expression of the Gene Which Encodes a Tube
Precipitin Antigen and Wall-Associated
-Glucosidase of
Coccidioides immitis
Chiung-Yu
Hung,
Jieh-Juen
Yu,
Paul F.
Lehmann, and
Garry T.
Cole*
Department of Microbiology and Immunology,
Medical College of Ohio, Toledo, Ohio 43614-5806
Received 11 September 2000/Returned for modification 5 October
2000/Accepted 10 December 2000
 |
ABSTRACT |
We report the structure and expression of the Coccidioides
immitis BGL2 gene which encodes a previously characterized
120-kDa glycoprotein of this fungal respiratory pathogen. The
glycoprotein is recognized by immunoglobulin M tube precipitin (TP)
antibody present in sera of patients with coccidioidomycosis, a
reaction which has been used for serodiagnosis of early coccidioidal
infection. The deduced amino acid sequence of BGL2 shows 12 potential N
glycosylation sites and numerous serine-threonine-rich regions which
could function as sites for O glycosylation. In addition, the protein
sequence includes a domain which is characteristic of family 3 glycosyl hydrolases. Earlier biochemical studies of the purified 120-kDa TP
antigen revealed that it functions as a
-glucosidase (EC 3.2.1.21). Its amino acid sequence shows high homology to several other
reported fungal
-glucosidases which are members of the family 3 glycosyl hydrolases. Results of previous studies have also suggested
that the 120-kDa
-glucosidase participates in wall modification
during differentiation of the parasitic cells (spherules) of
C. immitis. In this study we showed that expression of
the BGL2 gene is elevated during isotropic growth of
spherules and the peak of wall-associated BGL2 enzyme activity
correlates with this same phase of parasitic cell differentiation.
These data support our hypothesis that the 120-kDa
-glucosidase
plays a morphogenetic role in the parasitic cycle of C. immitis.
 |
INTRODUCTION |
Coccidioidomycosis is a fungal
respiratory disease of humans caused by Coccidioides
immitis. It is recognized as a reemerging problem in regions
of endemicity of the Southwestern United States (16).
Diagnosis of early stages of C. immitis infection is
aided by a serologic test which involves detection of patient
immunoglobulin M (IgM) precipitin antibodies reactive with
specific antigens of C. immitis in an
immunodiffusion-tube precipitin (ID-TP) assay (28). We
have previously described the isolation of a 120-kDa glycoprotein which is recognized by precipitin antibodies
present in sera of patients with coccidioidomycosis (5,
22). The ability of this purified glycoprotein
to bind patient IgM (TP) antibody was confirmed by both the classical
TP reaction and an enzyme-linked immunosorbent assay (4,
22). We have also shown that the 120-kDa TP antigen is a
-glucosidase, and the active enzyme is present in the culture medium
and within the walls of young parasitic cells (presegmented spherules)
(23). We have demonstrated that the
-glucosidase can
utilize isolated and boiled cell wall material of C. immitis spherules as a substrate. It was suggested that the
wall-associated enzyme may cleave structural glucans of the spherule
wall and thereby contribute to wall plasticity and isotropic growth of
the parasitic cells (6, 23). Such in situ enzyme activity
was supported by our observations that the active enzyme can be
extracted from the wall of viable, presegmented spherules and that
exposure of cultured parasitic cells to 1-deoxynojirimycin, a
specific inhibitor of glucosidases, blocks diametric growth of
the pathogen in vitro (23). Moreover, antibody raised
against a conjugate of 1-deoxynojirimycin was used in an
immunofluorescence study to show that the inhibitor was localized in
the wall of the growth-arrested spherules.
Here we report the isolation of the BGL2 gene that encodes
the 120-kDa
-glucosidase (TP) antigen, and present results of the
analysis of BGL2 expression during the parasitic cycle of C. immitis.
 |
MATERIALS AND METHODS |
Fungal strain and growth conditions.
C.
immitis strain C735 used in this study was originally isolated
from a patient with disseminated coccidioidomycosis who resided in
Southern California. The isolate is maintained in the Medical College
of Ohio fungal culture collection. The saprobic phase was grown for 5 days in GYE liquid medium (1% glucose, 0.5% yeast extract) at 30°C,
while the parasitic phase was grown in Converse medium for different
periods of incubation as previously described (17).
Isolation and sequence analysis of the BGL2
genomic clone.
The strategy employed to isolate the gene
that encodes the 120-kDa TP antigen was based on identification of two
conserved amino acid sequences of selected fungal
-glucosidases
which had been deposited in the GenBank database. An amino acid
sequence alignment of these proteins was performed using the MacDNASIS Sequence Analysis Software (version 3.5; Hitachi, San Bruno, Calif.) to
identify the conserved domains. The conserved sequences were used to
design degenerate sense and antisense primers for use in a PCR with
template genomic DNA of C. immitis to amplify a fragment of the putative BGL gene. The nucleotide sequence
of the sense primer deduced from the conserved, upstream peptide sequence (GRNWEGF) was 5'-GGWMGDAAYTGGGARGGNTT-3'
(192-fold degeneracy) (where M is A or C; D is A, G, or T; N is
A, C, G, or T; R is A or G; W is A or T; and Y is C or T). The
nucleotide sequence of the antisense primer was designed on the basis
of a conserved downstream peptide sequence (ELGFQGF) which
had previously been identified as part of the signature motif that
defines family 3 glycosyl hydrolases (18) (see Table 1).
The nucleotide sequence of the antisense primer was
5'-GAAKCCYTGRAAKCCNARYTC-3' (256-fold degeneracy) (where K
is G or T).
The PCR mixture (100 µl) contained 10 mM Tris-HCl (pH 8.3) plus 50 mM
KCl, 1.5 mM MgCl2, a 0.2 mM concentration of each
deoxynucleoside triphosphate (dNTP), a 5 µM concentration of each
primer, 50 ng of C. immitis genomic DNA, and
2.5 U of Taq DNA polymerase (Promega, Madison, Wis.).
Thirty-five cycles were conducted for amplification of the template
genomic DNA. Initial denaturation was performed at 94°C for 3 min. Each subsequent cycle consisted of a melting step (94°C for 1 min), an annealing step (50°C for 1 min), and an extension step
(72°C for 1 min). Three PCR products of different molecular size were
observed by 3.0% agarose gel electrophoresis. The mixture of PCR
amplicons was ligated into the pZErO 2.1 cloning vector (Invitrogen,
Carlsbad, Calif.) by the TA cloning method (2). The clones
were subsequently screened by PCR using primers derived from nucleotide
sequences in the multiple cloning site of the vector (2).
Selected clones were sequenced using the ThermoSequenase radiolabeled
terminator cycle sequencing kit (Amersham, Cleveland, Ohio). A clone
which contained a 423-bp insert was selected on the basis of homology
of its translated sequence to the reported sequence of a secreted
-glucosidase of Histoplasma capsulatum (11,
13). This same glycosyl hydrolase of H. capsulatum has been identified as a seroreactive antigen (H antigen) and is used
in the diagnosis of histoplasmosis (11). H. capsulatum has been shown to be a close relative of C. immitis (27). The 423-bp PCR product was purified,
labeled with [
-32P]dCTP (>3,000 Ci/mmol; ICN, Costa
Mesa, Calif.) using a Multiprimer DNA labeling system (Amersham), and
used to screen a genomic library of C. immitis
C735 which has been reported (32). Positive phages were
selected and amplified, and DNA was extracted for restriction enzyme
digestion and Southern hybridization using the 423-bp PCR product as
previously described (33). This resulted in
detection of a 4.9-kb XbaI genomic fragment of the
BGL2 gene that was subcloned into pZErO 2.1 and sequenced as
described above. The MacDNASIS software package was used for
sequence analysis.
RACE and sequence analysis of BGL2 cDNA.
The
rapid amplification of cDNA ends (RACE) procedure (17) was
used to resolve the location of the nucleotide termination of the 5'
untranslated region (UTR) as well as the poly(A) addition sites of the
BGL2 gene. In brief, total RNA was first isolated from
mycelia of C. immitis as described (17).
Reverse transcription (RT)-PCR was conducted as reported by Ausubel et
al. (2). High fidelity Taq polymerase (SuperMix
High Fidelity DNA Taq polymerase; Gibco BRL, Grand Island,
N.Y.) was used for the PCR. The two gene-specific primers used for 5'
RACE were as follows: 5'-CCTTTTATCGTTTCAGCG-3' (BG 2.4 [nucleotides {nt} 2300 to 2317] [see Fig. 2B]), and
5'-ACAAGCTTCTTGCATCCA-3' (BG 2.10 [nt 1927 to 1944]). For
3' RACE, one of the two primers used was the synthesized
oligo-d(T)17-adapter construct described by Frohman
(15). The amplified RT-PCR product was obtained using the
BGL2 gene-specific primer, 5'-TGGTGTCAGCATCCTCAA-3'
(BG 2.15 [nt 3662 to 3679]) and the oligo(dT) construct. The
PCR conditions were the same as those used for amplification of the
genomic fragment described above. The RACE products were
separated by 1.5% agarose gel electrophoresis, ligated into the pZErO
2.1 vector, and subjected to nucleotide sequence analysis as
described above.
To amplify the remainder of the cDNA fragment of
BGL2, two
primers were synthesized on the basis of the sequences of the RACE
products. The nucleotide sequences of the sense and antisense
primers
were 5'-GAA
AGATCTGGCCTTCTCACCTCCATA (BG 2.16 [nt
1734 to 1751]) and 5'-AT
GTCGACCCTACGAAGACGGGGCTAGAG
(BG
2.18; nt 4485 to 4505), which contained engineered
BglII and
SalI
restriction sites, respectively
(nucleotides in boldface type).
Thirty-five cycles were performed to
amplify the RT-PCR product.
The PCR conditions were the same as
described above, except that
the extension step was conducted at 72°C
for 3 min. The 2.5-kb
RT-PCR product was digested with
BglII
and
SalI, separated by
1% agarose gel electrophoresis,
isolated, and subcloned into the
BamHI/
SalI site
of pET28b (Novagen, Madison, Wis.) to yield the
pET28b-
BGL2
plasmid construct (
17). The plasmid insert was sequenced
as described
above.
The NCBI-BLAST and PSI-BLAST programs were used to search for protein
sequences in the GenBank and SWISS-PROT databases with
similarity to
the translated sequence of the
C. immitis BGL2 gene
(
1). The PROSITE database was used to identify motifs and
signature
sequences in BGL2 with homology to reported proteins
(
20), the
PSORT database was used for for prediction of
protein localization
sites (
24), and the CLUSTALW program
was used to perform sequence
alignments (
19).
Southern hybridization.
Intact chromosomal DNA of
C. immitis was prepared by the agarose-spheroplast
procedure (25) and subjected to contour-clamped homogeneous electric field (CHEF) gel electrophoresis under the conditions previously described (34). The separated
chromosomal DNA was transferred to a Zeta-probe GT Blotting Membrane
(Bio-Rad, Hercules, Calif.) and hybridized with the radiolabeled,
423-bp PCR product which was described above. In addition, aliquots of equal amounts of total genomic DNA of C. immitis were separately digested with the restriction
endonucleases XbaI, PstI, or KpnI and
analyzed by Southern hybridization with the same 423-bp probe. Hybridization was conducted at low stringency as described by Yu et al.
(33).
Purification of the 120-kDa TP antigen for amino acid sequence
analysis.
The 120-kDa glycoprotein was isolated from
the mycelial filtrate-lysate (F-L) preparation of C. immitis as described previously (4). In brief, the
F-L preparation was first subjected to concanavalin A (ConA) affinity
chromatography. The ConA-bound fraction was eluted from the column and
subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) under reducing conditions (22). The Coomassie
brilliant blue (Sigma)-stained 120-kDa band was excised, and the
glycoprotein was electroeluted from the gel, dialyzed
against water, and concentrated by drying under vacuum. The purified
antigen was reconstituted in phosphate-buffered saline (pH 7.2) to a
concentration of 0.1 mg of protein/ml and tested for patient TP
antibody reactivity in the ID-TP assay as previously reported
(4).
Enzymatic digestion of the purified 120-kDa glycoprotein
was conducted by use of the Protein Finger-printing System kit
(Promega).
The Lys-C digest was subjected to SDS-PAGE (10%
polyacrylamide),
and the separated fragments were electrotransferred to
an Immobilon-P
membrane (Millipore, Bedford, Mass.). Selected peptide
bands visualized
with Coomassie stain were excised and subjected to
N-terminal
sequence analysis in an Applied Biosystems model 477A gas
phase
sequencer by standard procedures (
26).
Expression of BGL2 by Escherichia
coli.
The 2.5-kb cDNA fragment of the BGL2 gene,
which encodes a predicted 90.6-kDa protein (amino acids [aa] 23 to
858 [see Fig. 2B]), was amplified by PCR and subcloned into the
pET28b vector as described above. The pET28b-BGL2 plasmid
construct encodes a recombinant protein that contained a polyhistidine
(His) tag at its N terminus derived from the vector. The stop condon in the plasmid construct was derived from the BGL2 gene insert.
The pET28b-BGL2 construct was used to transform E. coli strain BL21(DE3) as described (17). Growth of
the transformed cells, induction of expression, purification, and
internal amino acid sequence analysis of the recombinant protein
(rBGL2) were conducted as previously reported (17).
C-terminal amino acid sequence analysis of the purified rBGL2 was
conducted to confirm that a C-terminally truncated fragment of the
recombinant protein was expressed by E. coli. The rBGL2 was
isolated by nickel-affinity chromatography as previously described
(33). C-terminal sequence analysis of the rBGL2 was
determined with a Perkin-Elmer Applied Biosystems model 428 amino acid
analyzer and conducted by the Macromolecular Structure Facility,
Michigan State University, East Lansing, using a standard procedure
(3).
Production of antiserum against rBGL2.
The
chromatographically isolated rBGL2 was subjected to SDS-PAGE and
electroeluted from the gel as previously described (26), and the purified recombinant protein was used to immunize BALB/c mice
(6 weeks old) for production of specific antiserum as reported (21). The antiserum was used for examination of BGL2
protein production during in vitro growth of C. immitis
by immunoblot analysis as described below. Preimmune mouse serum was
used as a control.
RT-PCR evaluation of BGL2 gene expression during the
parasitic cycle.
Semiquantitative analysis of BGL2 mRNA
levels in different morphogenetic stages of the parasitic cycle was
conducted essentially as described by Guevara-Olvera et al.
(17). First-generation parasitic cells of C. immitis derived from arthroconidia were grown in Converse medium
and harvested by centrifugation (1,500 × g for 10 min)
after 16, 24, 36, 72, 84, 96, 120, and 132 h of incubation on a
gyratory shaker under conditions previously reported (17).
The first generation of parasitic cells isolated at these various times
after inoculation with arthroconidia was fairly well synchronized in
development (7). Mature, ruptured spherules which had
released their endospores (i.e., 132 h postinoculation) were isolated,
washed once with Converse medium, and used as the inoculum for
second-generation cultures. The cells were grown in fresh Converse
medium for 48 h and then harvested as described above. Cells
harvested at each incubation time were separated into three aliquots;
one was used for light-microscopic analysis of the degree of synchrony
of cell development, one was used immediately for RNA extraction as
described below, and the rest of the cells were quick-frozen in 1.5-ml
microcentrifuge tubes and then stored at
70°C until processed for
protein extraction. For light microscopy, the cell types isolated at
each incubation time were scored to characterize their stage of
development. At least 200 cells were examined in each aliquot. The cell
types of the first generation were classified as follows: (i)
swollen, cylindrical spherule initials that were <5 µm in
diameter; (ii) swollen, cylindrical spherule initials that were
5 but
<10 µm in diameter; (iii) spherules that were
10 µm but <20
µm in diameter; (iv) nonsegmented spherules that were >20
µm in diameter; (v) segmented spherules; (vi) early endosporulating (<50%) spherules; (vii) early endosporulating (>50%) spherules; and (viii) mature, ruptured spherules
(
90%) showing released endospores. The second-generation spherules
were scored as nonsegmented parasitic cells that were 15 to 20 µm in diameter. To evaluate stages of segmentation, wall formation, and early
endospore differentiation which occur within intact spherules, aliquots
of parasitic cells from 72- to 120-h cultures were chemically
fixed and sectioned as previously described (30). Thick
sections (approximately 1 µm) were stained with wheat germ agglutinin
(WGA) conjugated with fluorescein isothiocyanate (FITC) (Sigma) and
examined by fluorescence microscopy. The WGA-FITC conjugate stained the
chitin in the spherule and endospore wall.
Total RNA was isolated from each of the cell types described above and
used for RT-PCR analysis of levels of
BGL2 expression.
Total
RNA was also isolated from
C. immitis mycelia grown in
liquid
GYE culture medium for 120 h at 30°C. Since the
120-kDa

-glucosidase
was originally purified from 5-day mycelial
cultures (
23), the
total RNA isolated from the saprobic
phase served as a positive
control for the RT-PCR. Total RNA was
extracted from 100 mg of
fresh parasitic cells or mycelial pellet using
the Plant RNeasy
mini kit (Qiagen, Chatsworth, Calif.) as previously
described
(
17). The crude extract was digested with RQ1
RNase-free DNase
(Promega), and the RNA was purified using the RNA
clean-up protocol
(Plant RNeasy mini kit; Qiagen). The purity and
quantity of RNA
were monitored by UV absorbance. A ratio of optical
density at
260 nm to that at 280 nm that was >1.9 was obtained for
each
preparation.
Gene expression was examined by comparison of the level of mRNA
which encodes
BGL2 to that which encodes the
glyceraldehyde-3-phosphate
dehydrogenase (
GAPDH) gene of
C. immitis (GenBank accession no.
AF288134). The latter
is expressed constitutively in
C. immitis (J.-J. Yu,
C.-Y. Hung, P. W. Thomas, and G. T. Cole, Abstr. 99th
Gen. Meet. Am. Soc. Microbiol. 1999, abstr. F-52, p. 305, 1999).
The
RT-PCR protocol employed was essentially the same as previously
reported (
17). In brief, the cDNA was synthesized in a
50-µl
solution containing 50 mM Tris-HCl (pH 8.3) plus 75 mM KCl, 3
mM MgCl
2, 10 mM dithiothreitol (DTT), 0.5 µM
concentration of
each dNTP, a 200 µM concentration of oligo PCR
d(T)
17-adapter
primer, 5 µg of
C. immitis
total RNA, and 400 U of SuperScript
II RNase H

reverse
transcriptase (Gibco BRL). The reaction mixture was incubated
at 42°C
for 50 min and then shifted to 70°C for 10 min to denature
the
reverse transcriptase. The PCR mixture contained 1 µl of the
cDNA,
which was separated as aliquots diluted in Milli-Q (Millipore)
water
(1:1, 1:2, 1:4, 1:8, 1:16, 1:32, or 1:50). Each aliquot
was mixed with
10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM Mg Cl
2,
a 0.2 mM
concentration of each dNTP, a 5 µM concentration of each
primer, and
1 U of
Taq DNA polymerase (Sigma) in a total volume
of 25 µl. PCR primer pairs synthesized for
C. immitis BGL2
and
GAPDH were each designed to span at least one intron.
Inclusion
of the intron allowed us to distinguish cDNA from
genomic DNA
amplicons based upon their different sizes after
separation by
agarose gel electrophoresis. In order to further rule out
contamination
of the RNA preparations with genomic DNA,
controls included samples
of the
C. immitis RNA
preparation that had not been reverse transcribed
but were subjected to
PCR and examined by agarose gel electrophoresis
as described above. For
GAPDH, the sequences of the PCR primers
were the same as
reported by Guevara-Olvera et al. (
17). For
BGL2, the primer sequences were as follows: sense,
5'-GAAACGATAAAAGGAATCCAGGATGCT-3'
(BG2.7 [nt 2304 to
2330]), and antisense, 5'-GCTGTTGTTGATTTGGTTATATGAACA-3'
(BG2.8 [nt 2577 to 2603]). The primers yielded single RT-PCR
products
for
GAPDH and
BGL2 which were 246 and
243 bp, respectively. The
PCR conditions were the same as described
above, except that the
annealing temperatures were 56°C for
GAPDH and 60°C for
BGL2.
Thirty-five cycles
were used to amplify the
BGL2 and
GAPDH genes.
The PCR products were subjected to agarose gel electrophoresis
(2.0%)
and the amplified cDNA bands were visualized by staining
with ethidium
bromide (EtBr). The intensity of the EtBr stain
for each band was
determined by UV transillumination and densitometric
analysis using the
Bio-Rad Gel Documentation 1000 system and Multi-Analyst
software
program (Bio-Rad). The intensities of the bands, which
represent amount
of
BGL2 and
GAPDH amplicons for each dilution
of
cDNA template, were recorded. The relative amounts of
BGL2 and
GAPDH cDNA determined for each stage of parasitic cell
development
were calculated as the dilution factor that yielded the
same band
intensity as that of the mycelial
BGL2 amplicon at
a 1:50
dilution.
Evaluation of 120-kDa glycoprotein production by
immunoblot analysis.
Detection of the 120-kDa
glycoprotein in total homogenates of the 5-day mycelial mat
and homogenates of cells from the same stages of parasitic cell
development as described above were conducted by SDS-PAGE followed by
immunoblot analysis using the murine antiserum raised against the
rBGL2. Aliquots of each fungal cell isolate were mechanically disrupted
with glass beads (50-µm diameter) in a Mini-Beadbeater (Biospec,
Bartlesville, Okla.). Total protein of each cell preparation was
extracted with 50 mM sodium acetate (NaAc) buffer (pH 5.5) containing
octyl-
-D-glucopyranoside (1% [vol/vol]; Calbiochem,
La Jolla, Calif.), 100 mM NaCl, 6 mM CaCl2, 1 mM
phenylmethylsulfonyl fluoride,
L-1-chloro-3-[4-tosylamido]-4-phenyl-2-butanone (50 µg/ml), leupeptin (1 µg/ml), and pepstatin (1 µg/ml); (Sigma). The protein concentration of each sample was determined using the
Detergent Compatible Protein Assay kit (Bio-Rad), and adjusted so that
equal amounts of protein were applied to each lane of the SDS-PAGE gel.
The protein preparations (approximately 80 µg each) were separated by
SDS-PAGE (10% polyacrylamide), and the reducing gels were stained with
Coomassie brilliant blue. The immunoblot procedure was conducted as
previously described (26), except that secondary antibody
conjugated with horseradish peroxidase and a chemiluminescent substrate
were used (ECL Western blot analysis system; Amersham, Arlington
Heights, Ill.).
Evaluation of
-glucosidase activity.
The same set of
equilibrated protein extracts as described above were also used to
detect
-glycosyl-hydrolase activity by substrate gel electrophoresis
(8). Approximately 40 µg of total protein of each cell
homogenate were mixed with 6× sample buffer (0.35 M Tris-HCl [pH
6.8], 1% SDS, 10% glycerol, 0.002% bromophenol blue, and 0.6 M
dithiothreitol), incubated at 37°C for 5 min, and separated by
SDS-PAGE (10% polyacrylamide). The gel was washed three times with 50 mM NaAc buffer (pH 5.5) containing 0.1% Triton X-100 (37°C; 10 min
each wash) to remove SDS and then incubated with 10 ml of a solution of
4-methyl-umbelliferyl-
-D-glucoside (Sigma) in the same
NaAc buffer (0.1 mg/ml) for 30 min at 37°C. Fluorescent bands
indicative of
-glucosidase activity were viewed under UV light, and
their intensities were determined by image analysis as described above.
Nucleotide sequence accession number.
The GenBank accession
number for the C. immitis BGL2 gene is AF022893, and
that for the BGL2 protein is AAF21242.
 |
RESULTS |
Selection of putative BGL2 amplicon.
Four fungal
-glucosidase sequences obtained from the GenBank database were
aligned, and two conserved regions were identified (Fig.
1A). The
-glucosidase sequences were
selected on the basis that the native proteins were reported to have
molecular sizes in the range of 80 to 144 kDa. Degenerate
oligonucleotide primers designed on the basis of these sequences were
used for PCR amplification with genomic template DNA. Three
EtBr-stained amplicons visible in the agarose gel (Fig. 1B) were
isolated, purified, cloned, and subjected to nucleotide sequence
analysis. The sizes of the PCR products (amplicons a, b, and c), as
determined by sequence analysis, were 423, 409, and 351 bp,
respectively. Each amplicon was translated to yield the open reading
frames shown in Fig. 1C. The translated PCR primer sequences are
shown at the N and C termini. Alignment of the sequences, excluding the
translated primer regions, was conducted using the CLUSTALW program,
and the sequences showed 62 to 75% homology to each other and 45 to 58% homology to other nonfungal
-glucosidase sequences in the GenBank database. These results suggested that the three PCR products translate three distinct glycosyl hydrolases of C. immitis. In fact, the deduced amino acid sequence of amplicon b
showed complete identity to BGL1, a cytosolic
-glucosidase of
C. immitis which has been reported (J.-J. Yu and
S. L. Smithson, Abstr. 96th Gen. Meet. Am. Soc.
Microbiol. 1996, abstr. F-57, p. 83, 1996) and deposited in the
GenBank database (accession no. AAB67972). BGL1 was not examined
further in this study. The sequences of amplicons a and c were aligned
with the sequence of a previously reported 144-kDa serodiagnostic
antigen (H antigen) of H. capsulatum which was suggested to
function as a
-glucosidase (11, 13). The homologies of
sequences a and c to this putative
-glucosidase were 92 and 69%,
respectively. Earlier studies in our laboratory have suggested a close
phylogenetic relationship between C. immitis and
H. capsulatum (27). For example, 72% amino
acid sequence identity was revealed between the heat shock
proteins (HSP60) of these two pathogens (31). On the basis
of the above structural and functional homology data, we tentatively
identified sequence a as a fragment of the gene which encodes the
120-kDa
-glucosidase of C. immitis, and we refer to
this gene as BGL2. This 423-bp PCR product was used as a
probe to screen the genomic library. The sequence of amplicon c
was designated as a fragment of the BGL3 gene, which is
further examined in temporal expression studies in this work.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Alignment of amino acid sequences of two conserved
regions of fungal -glucosidase reported in GenBank for
Aspergillus aculeatus (Aa), H. capsulatum (Hc),
Saccharomycopsis fibuligera (Sf), and Pichia
anomala (Pa). (B) PCR products (a, b, and c) amplified from
C. immitis genomic DNA using degenerate primers
designed on the basis of conserved amino acid sequences in panel A. (C)
Translated sequences of PCR products shown in panel B. The translated
primer sequences are indicated (#). An asterisk indicates amino acid
identity; a dot indicates a conserved substitution (see Table 2).
|
|
Isolation and structure of the BGL2 gene.
The
random hexamer primer-labeled 423-bp PCR product was used to screen a
C. immitis genomic library constructed in
FIXII (32). A clone which hybridized with the
probe was isolated, digested with XbaI to yield a
4.9-kb fragment, subcloned into pZErO 2.1, and subjected to
DNA sequence analysis. The restriction map of the 4.9-kb fragment of
the phage insert is shown in Fig. 2A. The
deduced open reading frame of the cDNA sequence,
which was obtained by 5'-3' RACE as described above, matched
the genomic sequence and confirmed that the gene contained
five introns (Fig. 2B). A putative CAAT box was located
224 bp upstream of the 5' end of the UTR (nt 1359). The latter
was identified by 5' RACE. No discernible TATA box was found. Two
putative poly(A) tail addition sites were identified at nt 4712 and nt
4850.


View larger version (129K):
[in this window]
[in a new window]
|
FIG. 2.
Restriction map of 4.9-kb phage insert digested with
XbaI and subcloned into pZErO (A), and nucleotide sequence
of C. immitis BGL2 gene and deduced amino acid sequence
(B). The 423-bp probe in panel A is derived from PCR product (a) in
Fig. 1. The two underlined amino acid sequences represent matched
peptide sequence of the Lys-C-digested, native 120-kDa
glycoprotein. The amino acid sequence in boldface type (aa
559 to 577) matched the peptide sequence of Lys-C-digested recombinant
BGL2. The boxed sequence represents the 18-aa signature motif of family
3 glycosyl hydrolases. The aspartic acid residue within this sequence
(boldface type) is the putative active site. Residues contained within
square brackets are putative N glycosylation sites. The
arrow between aa 18 and 19 indicates a putative cleavage site of the
signal peptide. The double-underlined nucleotide sequences indicate
conserved 5'-3' sequences of introns. The gene-specific primers used
for RACE and RT-PCR are indicated. The putative CAAT box (boldface
type), 5' end of the UTR ( ), stop codon (asterisk), and putative
poly(A) addition sites ( ) are also indicated.
|
|
The translated
BGL2 gene contains 858 aa and, in the absence
of any posttranslational modification, has a predicted molecular
mass
of 92.8 kDa and a pI of 5.0. Sequence analysis performed
by PSORT
(
24) showed that 18 aa at the N terminus have the
characteristic
of a signal peptide with a putative cleavage site
between A
18 and E
19. The predicted molecular
size of the mature BGL2 protein is 90.9
kDa. The translated protein
showed 12 potential N glycosylation
sites, multiple S/T-rich
regions which could function as O glycosylation
sites, a
glycosyl-hydrolase family 3 signature motif at aa 266
to 283 (
18), and a predicted active-site residue at
D
280 (
10). The 18-aa sequence of the signature
motif of BGL2 is
very similar to that reported for all other fungal
family 3 glycosyl
hydrolases currently deposited in the GenBank
database, with the
exception of
Kluyveromyces
marxianus (Table
1). The predicted
full-length sequence of the
C. immitis BGL2
protein was compared
to reported amino acid sequences of fungal family
3 glycosyl hydrolases
in the database. The highest identity (74.3%)
was shown between
BGL2 and the H antigen of
H. capsulatum
(Table
2).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Summary of calculated values for conserved amino acid
similarities and identities between C. immitis BGL2
and -glucosidase sequences of other fungi
|
|
Southern hybridization.
Southern hybridization of chromosomal
DNA separated by CHEF gel electrophoresis was conducted using the same
random hexamer primer-labeled 423-bp PCR amplicon as described above.
The Southern blot showed that the BGL2 gene is located on
chromosome II (Fig. 3A). Total
genomic DNA preparations of C. immitis were
separately digested with XbaI, PstI, and
KpnI; subjected to agarose gel electrophoresis; and
hybridized with the same labeled 423-bp probe (Fig. 3B). The sizes of
the three single bands were predicted by the restriction map of
the 4.9-kb BGL2 sequence (Fig. 2A). The Southern
hybridization data indicate that BGL2 is a single-copy gene.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 3.
EtBr-stained CHEF electrophoresis gel of C. immitis strain C735 with Southern blot (S.B.) of separated
chromosomal DNA (A), and Southern blot of restriction enzyme-digested
genomic DNA (B). Abbreviations: Chrom., chromosome; Std.,
standard.
|
|
Purification and amino acid sequence analysis of 120-kDa TP
antigen.
The dialyzed F-L preparation of the mycelial phase of
C. immitis was bound to ConA, eluted, and separated
by SDS-PAGE, and the 120-kDa glycoprotein was
isolated from the gel by electroelution (Fig.
4A). Antigenic activity of the
isolated glycoprotein was confirmed by the ID-TP assay
(Fig. 4B). The purified TP antigen was subjected to Lys-C digestion,
and two of the proteolytic fragments with molecular sizes of 55 and 60 kDa (Fig. 4C) were subjected to N-terminal amino acid sequence
analysis. The sequence of the 60-kDa fragment (LTAVIGEDAGPNL)
matched aa 416 to 428 of the translated BGL2 sequence (Fig. 2B),
while the sequence of the 50-kDa fragment (EWAFSPPYY) was
identical to aa 21 to 29.

View larger version (94K):
[in this window]
[in a new window]
|
FIG. 4.
(A) SDS-PAGE gel separation of ConA-bound fraction of
mycelial filtrate plus lysate preparation (Con A-Bd. Fr.), and
gel-electroeluted (EE) 120-kDa glycoprotein. Std.,
standard. (B) ID-TP assay of immunoreactivity of purified 120-kDa
glycoprotein. (C) SDS-PAGE gel separation of Lys-C-digested
120-kDa glycoprotein.
|
|
Expression of rBGL2 and antibody production.
To express the
BGL2 gene, the PCR-generated cDNA was subcloned into
pET28b to yield the pET28b-BGL2 construct. The predicted molecular size of the recombinant protein was 94 kDa (including the
vector-encoded peptide which contained the His tag at the N terminus).
SDS-PAGE was used to analyze cell lysates obtained from E. coli strain BL21(DE3) which had been transformed with the
plasmid construct and induced with IPTG
(isopropyl-
-D-thiogalactopyranoside). An unpredicted
66-kDa band was detected in the lysate of IPTG-induced bacteria (Fig. 5A). The cDNA insert
of the pET28b-BGL2 construct was sequenced and
confirmed to contain an open reading frame that was identical to the
sequence in Fig. 2B. The 66-kDa protein was isolated by nickel-affinity
chromatography, separated by SDS-PAGE, and purified by electroelution
(Fig. 5A). The protein was digested with Lys-C, separated by
high-pressure liquid chromatography (17), and subjected to
N-terminal amino acid sequence analysis, which yielded the following:
WYDHPNVTAILWAGLPGQE. The sequence was identical to the
predicted amino acid sequence of the BGL2 gene (aa 559 to 577) (Fig. 2B). C-terminal sequence analysis of the rBGL2, isolated
by Ni-affinity chromatography, revealed that the last three residues
were WAA. This sequence matches aa 600 to 602 of the translated
sequence of the BGL2 gene (Fig. 2B). The predicted molecular
size of rBGL2, taking this C terminus into account, is 66.1 kDa. This
predicted size is the same as the SDS-PAGE estimate of the molecular
size of the recombinant protein. It appears that the transformed
bacteria produced a C-terminally truncated form of the rBGL2.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 5.
(A) SDS-PAGE and immunoblot analysis of E. coli-expressed rBGL2. Shown are standards (Std.), separations of
lysates of transformed bacteria grown in the presence (+) or absence
( ) of IPTG, nickel-affinity-isolated rBGL2 (Ni-Bd), purified
rBGL2 obtained by gel electroelution (EE), and an immunoblot (Ib.) of
the lysate of transformed E. coli using murine
anti-rBGL2 antibody. (B) SDS-PAGE separation of detergent-extracted
mycelial homogenate (My. Hm.) and corresponding immunoblot (Ib.) of
native glycoprotein using anti-rBGL2 antibody.
|
|
The purified rBGL2 was used to immunize mice for production of
polyclonal antibody. The antiserum recognized the 66-kDa recombinant
protein in the bacterial lysate (Fig.
5A) as well as the native
120-kDa
glycoprotein in the crude, detergent-extracted mycelial
homogenate (Fig.
5B). The 120-kDa glycoprotein was isolated
from
the mycelial homogenate as reported (
23) and
confirmed to have

-glucosidase activity (data not shown). This same
antiserum was
subsequently used in the immunoblot assay of BGL2 in cell
homogenates
of
C. immitis obtained from different
stages of the parasitic
cycle.
Isolation of C. immitis cell types for studies of
BGL2 expression, BGL2 production, and enzyme activity.
Figure 6A to N show light micrographs of the mycelia (Fig.
6A, 5-day culture), parasitic cell types
isolated from first-generation cultures grown for 16 to 132 h
(Fig. 6B to M), and a second-generation culture grown for 48 h
(Fig. 6N). Inserts (Fig. 6F, H, J, and L) show thick sections of
representative spherules isolated from 72-, 84-, 96-, and 120-h
cultures which were stained with the WGA-FITC chitin-specific, lectin
conjugate. The sectioned cells show stages of development of the
segmentation wall complex (Fig. 6F and H) and early stages of endospore
differentiation (Fig. 6J and L) within the intact spherules. The
isotropic growth phase of the first-generation parasitic cells prior to
segmentation is represented by Fig. 6B to E. Early differentiation of
endospore initials (Fig. 6I and J) is signaled by isotropic growth of
cells contained within the maternal spherule. Some swelling of the
latter occurs at this stage as growth of the endospores occurs.
Continued isotropic growth of the endospores (Fig. 6K and L) leads to
rupture of the first generation spherules (Fig. 6M) and maturation of second-generation parasitic cells (Fig. 6N). The homogenate of each of
these developmental stages was used to monitor BGL2 gene expression, 120-kDa glycoprotein production, and
-glucosidase activity. The similar morphology of the parasitic cells
at each progressive stage of differentiation shown in Fig. 6B to N
suggests the near-synchronous state of the first- and second-generation cultures grown in vitro.

View larger version (150K):
[in this window]
[in a new window]
|
FIG. 6.
Light micrographs of 5-day mycelia of C. immitis (A), and developmental stages of first-generation
spherules (B to M) and second-generation spherules (N). Inserts (F, H,
J, L) show WGA-FITC-stained sections of spherules at stages which
correspond to parasitic cells shown in panels E, G, I, and K,
respectively. Developmental stages (B, C, D, E, G, I, K, and M) are
derived from parasitic-phase cultures inoculated with arthroconidia and
incubated for 16, 24, 36, 72, 84, 96, 120, and 132 h,
respectively. Second-generation spherules in panel N were derived from
endosporulating spherules (M) which were incubated in fresh medium for
48 h. (A and F) Bars represent 20 µm.
|
|
RT-PCR analysis of BGL2 expression during the parasitic
cycle.
A diagrammatic representation of first- and early
second-generation parasitic cell development is shown in Fig.
7A. Each developmental stage is
designated by the culture time (i.e., hours postinoculation), which was
used to identify the cell homogenates examined in Fig. 7B to D and Fig.
8. The EtBr-stained bands in Fig.
7B represent PCR products of BGL2 cDNA
amplification using diluted template cDNA (1:1 to 1:32). The
cDNA templates were derived from RT of separate RNA preparations
obtained from selected developmental stages of the parasitic cycle. The
intensity of each gel band examined by densitometric analysis was
compared to that of the mycelial BGL2 amplicon. The latter was
generated by PCR amplification of mycelial cDNA template that was
diluted by a factor of 1:50. The relative amounts of BGL2
and GAPDH cDNA at selected developmental stages of the
parasitic cycle are shown in two separate analyses of gene expression
(i.e., experiments 1 and 2 in Fig. 7C and D). The relative amounts of
cDNA were calculated as described in Materials and Methods. As
indicated, expression of the GAPDH gene was constitutive during the parasitic cycle. In contrast, expression of the
BGL2 gene in first-generation cultures was elevated during
the isotropic growth phase of spherules (16 to 36 h
postinoculation) but decreased sharply once this diametric expansion
was arrested and the cells began to undergo segmentation (72 h
postinoculation in the first generation). As endospore differentiation
was initiated (~96 h postinoculation) and the cells began a second
phase of isotropic growth, the expression level of BGL2 rose
again. At 48 h after transfer of the released endospores to fresh
culture medium, a sharp decrease in expression of BGL2
correlated with the near completion of isotropic growth of the
second-generation spherules.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 7.
Diagrammatic representation of the parasitic cycle of
C. immitis (A) and RT-PCR analysis of BGL2
and GAPDH expression (B to D). (A to D) Developmental stages
of first- and second-generation parasitic cells are identified by
incubation time after inoculation of the parasitic-phase cultures. (B)
The EtBr-stained gels show BGL2 amplicons produced by RT-PCR
as described in Materials and Methods. The dilution factors for the
parasitic and mycelium phase-derived template cDNAs are indicated.
The intensity of the gel bands was determined by densitometric
analysis. (C and D) The relative amounts of BGL2 and
GAPDH cDNAs are plotted as the dilution factor of the
template cDNA that yielded the same EtBr-stained gel band intensity
as that of the mycelial BGL2 amplicon using a cDNA
template dilution of 1:50. The data presented in Experiment 1 (C) were
derived from densitometric analysis of the gels shown in panel B.
|
|

View larger version (93K):
[in this window]
[in a new window]
|
FIG. 8.
SDS-PAGE separation of Coomassie blue-stained detergent
extracts of total parasitic cell and mycelial homogenates and results
of both immunoblot analysis and substrate gel electrophoresis (SUBST.
GEL) of these same total protein preparations. The developmental stages
of the parasitic cycle are represented by incubation time (h) after
inoculation of cultures (first generation, 16 to 132 h; second
generation, 48 h). Lane M, homogenate of 5-day mycelial culture.
Three bands are identified in the substrate gel with estimated
molecular sizes of 120, 50, and 45 kDa.
|
|
BGL2 protein production.
The relative intensity of the
Coomassie blue-stained protein bands of cell homogenates shown in Fig.
8 indicates that equal amounts of protein were applied to the
respective lanes of the two SDS-PAGE gels. Detection of the BGL2
glycoprotein in each lane was accomplished by immunoblot
analysis using the murine, polyclonal anti-rBGL2 antiserum. The results
of this assay support the interpretation of the RT-PCR data. The
120-kDa glycoprotein was detected in cell homogenates
during the isotropic growth phases of both the first-generation
spherules (16, 24, and 36 h) and second-generation endospores (96, 120, and 132 h), but was not detectable once the parasitic cells
ceased diametric growth and began to undergo segmentation. Detection of
the 120-kDa glycoprotein in the immunoblot of the mycelial
homogenate served as a positive control.
-Glucosidase activity.
The results of substrate gel
electrophoretic analysis of the same cell homogenates as described
above are shown in Fig. 8. The parasitic cell homogenate preparations
were first separated by SDS-PAGE under reducing conditions, and
the gels were then washed to renature the proteins and remove the
SDS. After incubation of the gel
with 4-methyl-umbelliferyl-
-D-glucoside substrate, fluorescent bands
were visible which corresponded to the 120-kDa
-glucosidase activity. The results suggest that enzyme activity remains high during
the isotropic growth phase of both the first-generation spherules (16, 24, and 36 h) and endospores (96, 120, and 132 h) but
decreases sharply once diametric growth is arrested (72 h). Results of
the RT-PCR semiquantitative analysis of BGL2 expression at
72 and 84 h in the first generation showed the absence and then
slight increase in BGL2 mRNA, respectively (Fig. 7B to
D). The immunoblot assay demonstrated the presence of minute amounts of
BGL2 protein at these same developmental stages. However, substrate gel
analysis of BGL2 enzyme activity appears to be more sensitive than the
immunoblot technique. We suggest that the absence of BGL2
mRNA at 72 h but detection of a low level of BGL2 enzyme activity
at this same developmental stage (Fig. 8) is due to presence of a small
amount of residual enzyme from the earlier developmental stage. On the
other hand, the slightly elevated BGL2 enzyme activity at 84 h
revealed by the substrate gel correlates with the slight increase in
BGL2 mRNA at this same developmental stage (Fig. 7B to
D). Similarly, the low level of BGL2 enzyme activity suggested by the
fluorescent band, which represents the second-generation spherules at
48 h, correlates with the slightly elevated level of
BGL2 mRNA (Fig. 7B to D) and BGL2 protein detected by
immunoblot analysis of this same developmental stage (Fig. 8).
The second-generation cells in Fig.
6N (corresponds to lanes
labeled 48 h in Fig.
7 and
8) had not initiated
segmentation
and, therefore, had not completed their
isotropic growth phase.
The substrate gel revealed two additional
fluorescent bands with
estimated molecular sizes of 45 and 50 kDa. In
contrast to the
120-kDa

-glucosidase, the highest activity of these
enzymes apparently
correlated with phases of spherule segmentation (72 and 84 h)
and early endosporulation (96 h) in the first generation
of the
parasitic cycle. To test whether the
BGL3 gene
fragment (Fig.
1C) possibly encodes either the 45- or 50-kDa glycosyl
hydrolase,
RT-PCR analysis of
BGL3 expression was conducted
using gene-specific
primers. The results indicated that
BGL3
is constitutively expressed
during the parasitic cycle (data not
shown). The anti-rBGL2 mouse
serum, which was raised against
approximately two-thirds of the
mature BGL2 protein, including the
putative active site, did not
recognize the 45- or 50-kDa bands in the
immunoblot. These data
suggest that the 45- and 50-kDa proteins were
not degradation
products of BGL2 and may represent novel glycosyl
hydrolases of
C. immitis.
 |
DISCUSSION |
The secreted 120-kDa glycoprotein of C. immitis has been shown to be both a serodiagnostic antigen and a
-glucan-degrading enzyme (23). In this study, we have
cloned and characterized the gene which encodes this TP antigen and
wall-associated
-glucosidase. On the basis of analysis of the
translated BGL2 gene sequence, the predicted molecular size
of the mature protein is 90.9 kDa. It is argued, therefore, that the
native 120-kDa glycoprotein is highly glycosylated and the
carbohydrate moiety contributes approximately 25% of its molecular
weight. In fact, the translated amino acid sequence of the
BGL2 gene reveals several potential sites for both N and O
glycosylation. The recombinant BGL2 protein expressed by E. coli was not recognized by the reference patient antibody which had been used to detect the purified, native TP antigen in the ID-TP assay. This result is consistent with our earlier
finding that 3-O-methyl-D-mannose residues added
to BGL2 by posttranslational modification are largely responsible for the reactivity of IgM precipitin antibodies with this TP antigen (5).
Our earlier studies had also confirmed that the purified 120-kDa
glycoprotein is a
-glucosidase (23). Of the
70 recognized families of glycosyl hydrolases
(http://afmb.cnrs-mrs.fr/~pedro/CAZY/ghf_3.html) (9), the translated BGL2 sequence is closely related
to family 3, which currently accommodates both prokayotic and
eukaryotic enzymes with a broad range of substrate specifities (e.g.,
EC 3.2.1.21, -.37, -.52, -.55, -.57, -.58, and -.74). This family is
characterized by an aspartate residue at the active site
(10) and a specific peptide signature motif
(9). Our sequence analysis showed that the location of the
conserved 18-aa signature motif within the BGL2 sequence is very
similar to that of all other reported fungal family 3 glycosyl
hydrolases except for K. marxianus. However, the latter does
contain the putative aspartate active site and four additional
conserved residues within the signature motif of other members of this family.
The translated sequence of the C. immitis BGL2 gene
showed 74% identity and 85% similarity to that of the serodiagnostic
H antigen of H. capsulatum (11). Based on amino
acid sequence homology of the H antigen to reported extracellular
-glucosidases of other fungi (11), and results of
functional analysis of the recombinant protein (13), it
has been reported that the H. capsulatum antigen is a
secreted glycosyl hydrolase. We have shown that the 120-kDa
-glucosidase of C. immitis is both associated with
the cell wall of presegmented spherules and secreted into the culture medium (4, 23). However, an important additional
observation is that the concentration of the C. immitis
macromolecule in the culture filtrate fluctuates during the parasitic
cycle. The peaks of concentration of the secreted 120-kDa
-glucosidase in the medium corresponded to stages of endospore
release, and the lowest concentrations corresponded to phases of
isotropic growth (23). We previously showed that the
active enzyme could be extracted from viable, intact, presegmented
spherules by incubation of the cells with 1%
octyl-
-D-thioglucoside (23). After
isolation of the active
-glucosidase by this method the spherules
remained viable, suggesting that the enzyme was derived from the
spherule wall. Furthermore, exposure of spherule initials (Fig. 6C) to an inhibitor of the 120-kDa
-glucosidase resulted in the arrest of isotropic growth of the parasitic cells. These data suggested that
the active enzyme is associated with the spherule wall during its
isotropic growth phase and may perform a morphogenetic role during the
parasitic cycle.
Our ability to further evaluate the function of the 120-kDa
-glucosidase was enhanced by the isolation of the BGL2
gene and our success in achieving near synchrony of parasitic cell
development in liquid culture. The parasitic cycle can be separated
into three fairly distinct morphogenetic phases: isotropic growth,
segmentation, and endosporulation (17). An important
developmental feature relevant to this study is that initiation of
isotropic growth of endospores (i.e., cells which differentiate into
new generations of spherules) occurs while the cells are still within
the maternal spherule. The results of analyses of temporal expression
of the BGL2 gene, production of the BGL2 protein, and
activity of the BGL2 enzyme suggest that the peaks of 120-kDa
-glucosidase activity in detergent extracts of spherule homogenates
correlate with the isotropic growth phases of first- and
second-generation parasitic cells. The first morphological change that
is observed after arthroconidia are incubated in Converse medium is
cell swelling and most likely involves water uptake and concomitant
increase in internal cell pressure, new wall biosynthesis, and wall
loosening (12). The last of these events may be at least
partly accomplished by BGL2. The 120-kDa
-glucosidase is capable of
digesting boiled,
-mercaptoethanol-treated and washed, presegmented
spherule wall material (23). Quantitative and qualitative
analysis of the C. immitis
-glucosidase activity in
the presence of laminarin (Km, 1.03 mM)
indicated that the enzyme can utilize
-1,3-linked polyglucans as a
substrate to release monomeric and polymeric fragments
(23). The 120-kDa
-glucosidase is also capable of
efficient digestion of the synthetic p-nitrophenol-
-D-glucopyranoside substrate,
which is characteristic of
-1,3-exoglucosidases (14)
rather than endoglucosidases as previously suggested (23).
Fungal wall-associated exo- and endo-
-glucosidases have been
proposed to play a role in morphogenesis (14). However, apparently not all such glycosyl hydrolases participate in cell wall modification. The ability of the C. immitis
-glucosidase to digest its own wall contrasts with activity of
the exoG-II wall-associated hydrolase of Aspergillus
fumigatus, which showed very limited activity in the presence of
cell wall
-1,3-glucans (14). Although definitive proof
of function of the C. immitis BGL2 is not yet
available, the recent development of a transformation system for
C. immitis (29) now permits us to evaluate
the phenotype of a BGL2 knockout strain. Nevertheless, we
have provided evidence for a morphogenetic role of BGL2 in isotropic
growth of parasitic cells based on results of immunolocalization,
biochemical analyses, in vitro inhibition studies, and temporal
evaluations of gene, glycoprotein, and enzyme expression in
near-synchronized parasitic-phase cultures of C. immitis.
 |
ACKNOWLEDGMENTS |
We are grateful to K. R. Seshan for technical assistance in
culture preparation and morphological examinations.
This investigation was supported by Public Health Service grant AI
19149 and the National Institute of Allergy and Infections Diseases.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Medical College of Ohio, 3055 Arlington Ave., Toledo, OH 43614-5806. Phone: (419) 383-5423. Fax: (419) 383-3002. E-mail: gtcole{at}mco.edu.
Editor:
T. R. Kozel
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 2.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1989.
Current protocols in molecular biology.
Wiley, New York, N.Y.
|
| 3.
|
Boyd, V. L.,
M. Bozzini,
G. Zon,
B. L. Noble, and R. J. Mattaliano.
1992.
Sequencing of peptides and proteins from the carboxy terminus.
Anal. Biochem.
206:344-352[CrossRef][Medline].
|
| 4.
|
Cole, G. T.,
D. Kruse, and K. R. Seshan.
1991.
Antigen complex of Coccidioides immitis which elicits a precipitin antibody response in patients.
Infect. Immun.
59:2434-2446[Abstract/Free Full Text].
|
| 5.
|
Cole, G. T.,
D. Kruse,
S. W. Zhu,
K. R. Seshan, and R. W. Wheat.
1990.
Composition, serologic reactivity, and immunolocalization of a 120-kilodalton tube precipitin antigen of Coccidioides immitis.
Infect. Immun.
58:179-188[Abstract/Free Full Text].
|
| 6.
|
Cole, G. T.,
E. J. Pishko, and K. R. Seshan.
1995.
Possible roles of wall hydrolases in the morphogenesis of Coccidioides immitis.
Can. J. Bot.
73(Suppl.):S1132-S1141.
|
| 7.
|
Cole, G. T., and S. H. Sun.
1985.
Arthroconidium-spherule-endospore transformation in Coccidioides immitis, p. 281-333.
In
P. J. Szaniszlo (ed.), Fungal dimorphism. Plenum Press, New York, N.Y.
|
| 8.
|
Cole, G. T.,
S. W. Zhu,
S. Pan,
L. Yuan,
D. Kruse, and S. H. Sun.
1989.
Isolation of antigens with proteolytic activity from Coccidioides immitis.
Infect. Immun.
57:1524-1534[Abstract/Free Full Text].
|
| 9.
|
Coutinho, P. M., and B. Henrissat.
1999.
The molecular structure of cellulases and other carbohydrate-active enzymes: an integrated database approach, p. 15-23.
In
K. Ohmiya, K. Hayashi, K. Sakka, Y. Kobayashi, S. Karita, and T. Kimura (ed.), Genetics, biochemistry and ecology of cellulose degradation. Uni Publishers Co., Tokyo, Japan
|
| 10.
|
Dan, S.,
I. Marton,
M. Dekel,
B. A. Bravdo,
S. He,
S. G. Withers, and O. Shoseyov.
2000.
Cloning, expression, characterization, and nucleophile identification of family 3, Aspergillus niger beta-glucosidase.
J. Biol. Chem.
275:4973-4980[Abstract/Free Full Text].
|
| 11.
|
Deepe, G. S., and G. G. Durose.
1995.
Immunological activity of recombinant H antigen from Histoplasma capsulatum.
Infect. Immun.
63:3151-3157[Abstract].
|
| 12.
|
d'Enfert, C.
1997.
Fungal spore germination: insights from the molecular genetics of Aspergillus nidulans and Neurospora crassa.
Fung. Genet. Biol.
21:163-172.
|
| 13.
|
Fisher, K. L., and J. P. Wood.
2000.
Determination of beta-glucosidase enzymatic function of the Histoplasma capsulatum H antigen using a native expression system.
Gene
247:191-197[CrossRef][Medline].
|
| 14.
|
Fontaine, T.,
R. P. Hartland,
M. Diaquin,
C. Simenel, and J. P. Latgé.
1997.
Differential patterns of activity displayed by two exo-beta-1,3-glucanases associated with the Aspergillus fumigatus cell wall.
J. Bacteriol.
179:3154-3163[Abstract/Free Full Text].
|
| 15.
|
Frohman, M. A.
1990.
RACE: rapid amplification of cDNA ends, p. 28-38.
In
M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, New York, N.Y.
|
| 16.
|
Galgiani, J. N.
1999.
Coccidioidomycosis: a regional disease of national importance. Rethinking approaches for control.
Ann. Intern. Med.
130:293-300.
|
| 17.
|
Guevara-Olvera, L.,
C.-Y. Hung,
J.-J. Yu, and G. T. Cole.
2000.
Sequence, expression and functional analysis of the Coccidioides immitis ODC (ornithine decarboxylase) gene.
Gene
242:437-448[CrossRef][Medline].
|
| 18.
|
Henrissat, B., and A. Bairoch.
1993.
New families in the classification of glycosyl hydrolases based on amino acid sequence similarities.
Biochem. J.
293:781-788.
|
| 19.
|
Higgins, D. G., and P. M. Sharp.
1988.
CLUSTAL: a package for performing multiple sequence alignment on a microcomputer.
Gene
73:237-244[CrossRef][Medline].
|
| 20.
|
Hofmann, K.,
P. Bucher,
L. Falquet, and A. Bairoch.
1999.
The PROSITE database, its status in 1999.
Nucleic Acids Res.
27:215-219[Abstract/Free Full Text].
|
| 21.
|
Hung, C.-Y.,
N. M. Ampel,
L. Christian,
K. R. Seshan, and G. T. Cole.
2000.
A major cell surface antigen of Coccidioides immitis which elicits both humoral and cellular immune responses.
Infect. Immun.
68:584-593[Abstract/Free Full Text].
|
| 22.
|
Kruse, D., and G. T. Cole.
1990.
Isolation of tube precipitin antibody-reactive fractions of Coccidioides immitis.
Infect. Immun.
58:169-178[Abstract/Free Full Text].
|
| 23.
|
Kruse, D., and G. T. Cole.
1992.
A seroreactive 120-kilodalton -1,3-glucanase of Coccidioides immitis which may participate in spherule morphogenesis.
Infect. Immun.
60:4350-4363[Abstract/Free Full Text].
|
| 24.
|
Nakai, K., and M. Kanehisa.
1992.
A knowledge base for predicting protein localization sites in eukaryotic cells.
Genomics
14:897-911[CrossRef][Medline].
|
| 25.
|
Pan, S., and G. T. Cole.
1992.
Electrophoretic karyotypes of clinical isolates of Coccidioides immitis.
Infect. Immun.
60:4872-4880[Abstract/Free Full Text].
|
| 26.
|
Pan, S., and G. T. Cole.
1995.
Molecular and biochemical characterization of a Coccidioides immitis-specific antigen.
Infect. Immun.
63:3994-4002[Abstract].
|
| 27.
|
Pan, S.,
L. Sigler, and G. T. Cole.
1994.
Evidence for a phylogenetic connection between Coccidioides immitis and Uncinocarpus reesii (Onygenaceae).
Microbiology
140:1481-1494[Abstract/Free Full Text].
|
| 28.
|
Pappagianis, D., and B. L. Zimmer.
1990.
Serology of coccidioidomycosis.
Clin. Microbiol. Rev.
3:247-268[Abstract/Free Full Text].
|
| 29.
|
Reichard, U.,
C.-Y. Hung,
P. W. Thomas, and G. T. Cole.
2000.
Disruption of the gene which encodes a serodiagnostic antigen and chitinase of the human fungal pathogen Coccidioides immitis.
Infect. Immun.
68:5830-5838[Abstract/Free Full Text].
|
| 30.
|
Seshan, K. R., and G. T. Cole.
1994.
Structural studies in Coccidioides immitis, p. 265-273.
In
B. Maresca, and G. S. Kobayashi (ed.), Molecular biology of pathogenic fungi. Telos Press, New York, N.Y.
|
| 31.
|
Thomas, P. W.,
E. E. Wyckoff,
E. J. Pishko,
J.-J. Yu,
T. N. Kirkland, and G. T. Cole.
1997.
The hsp60 gene of the human pathogenic fungus Coccidioides immitis encodes a T-cell reactive protein.
Gene
199:83-91[CrossRef][Medline].
|
| 32.
|
Wyckoff, E. E.,
E. J. Pishko,
T. N. Kirkland, and G. T. Cole.
1995.
Cloning and expression of a gene encoding a T-cell reactive protein from Coccidioides immitis: homology to 4-hydroxyphenylpyruvate dioxygenase and the mammalian F antigen.
Gene
161:107-111[CrossRef][Medline].
|
| 33.
|
Yu, J.-J.,
S. L. Smithson,
P. W. Thomas,
T. N. Kirkland, and G. T. Cole.
1997.
Isolation and characterization of the urease gene (URE) from the pathogenic fungus Coccidioides immitis.
Gene
198:387-391[CrossRef][Medline].
|
| 34.
|
Yu, J.-J.,
L. Zheng,
P. W. Thomas,
P. J. Szaniszlo, and G. T. Cole.
1999.
Isolation and confirmation of function of the Coccidioides immitis URA5 (orotate phosphoribosyl transferase) gene.
Gene
226:233-242[CrossRef][Medline].
|
Infection and Immunity, April 2001, p. 2211-2222, Vol. 69, No. 4
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.4.2211-2222.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Xue, J., Chen, X., Selby, D., Hung, C.-Y., Yu, J.-J., Cole, G. T.
(2009). A Genetically Engineered Live Attenuated Vaccine of Coccidioides posadasii Protects BALB/c Mice against Coccidioidomycosis. Infect. Immun.
77: 3196-3208
[Abstract]
[Full Text]
-
Herr, R. A., Hung, C.-Y., Cole, G. T.
(2007). Evaluation of Two Homologous Proline-Rich Proteins of Coccidioides posadasii as Candidate Vaccines against Coccidioidomycosis. Infect. Immun.
75: 5777-5787
[Abstract]
[Full Text]
-
Tarcha, E. J., Basrur, V., Hung, C.-Y., Gardner, M. J., Cole, G. T.
(2006). Multivalent Recombinant Protein Vaccine against Coccidioidomycosis.. Infect. Immun.
74: 5802-5813
[Abstract]
[Full Text]
-
Mirbod-Donovan, F., Schaller, R., Hung, C.-Y., Xue, J., Reichard, U., Cole, G. T.
(2006). Urease Produced by Coccidioides posadasii Contributes to the Virulence of This Respiratory Pathogen. Infect. Immun.
74: 504-515
[Abstract]
[Full Text]
-
Tarcha, E. J., Basrur, V., Hung, C.-Y., Gardner, M. J., Cole, G. T.
(2006). A Recombinant Aspartyl Protease of Coccidioides posadasii Induces Protection against Pulmonary Coccidioidomycosis in Mice. Infect. Immun.
74: 516-527
[Abstract]
[Full Text]
-
Hung, C.-Y., Seshan, K. R., Yu, J.-J., Schaller, R., Xue, J., Basrur, V., Gardner, M. J., Cole, G. T.
(2005). A Metalloproteinase of Coccidioides posadasii Contributes to Evasion of Host Detection. Infect. Immun.
73: 6689-6703
[Abstract]
[Full Text]
-
Adams, D. J.
(2004). Fungal cell wall chitinases and glucanases. Microbiology
150: 2029-2035
[Abstract]
[Full Text]
-
Delgado, N., Xue, J., Yu, J.-J., Hung, C.-Y., Cole, G. T.
(2003). A Recombinant {beta}-1,3-Glucanosyltransferase Homolog of Coccidioides posadasii Protects Mice against Coccidioidomycosis. Infect. Immun.
71: 3010-3019
[Abstract]
[Full Text]
-
Hung, C.-Y., Yu, J.-J., Seshan, K. R., Reichard, U., Cole, G. T.
(2002). A Parasitic Phase-Specific Adhesin of Coccidioides immitis Contributes to the Virulence of This Respiratory Fungal Pathogen. Infect. Immun.
70: 3443-3456
[Abstract]
[Full Text]
-
Faure, D.
(2002). The Family-3 Glycoside Hydrolases: from Housekeeping Functions to Host-Microbe Interactions. Appl. Environ. Microbiol.
68: 1485-1490
[Full Text]