Previous Article | Next Article 
Infection and Immunity, April 2001, p. 2542-2548, Vol. 69, No. 4
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.4.2542-2548.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Virulence of a Phosphoribosylaminoimidazole Carboxylase-Deficient
Candida albicans Strain in an
Immunosuppressed Murine Model of Systemic Candidiasis
Matthew
Donovan,1
Jon J.
Schumuke,2
William A.
Fonzi,3
Sheri L.
Bonar,1
Karen
Gheesling-Mullis,1
Gary S.
Jacob,4
Vincent Jo
Davisson,5 and
Stanton
B.
Dotson2,*
Searle Research and Development, Pharmacia Company, St.
Louis, Missouri 631981; Agricultural
Genomics, Monsanto Company, St. Louis, Missouri
631672; Department of Microbiology and
Immunology, Georgetown University, Washington, D.C.
200073; Synergy Pharmaceuticals,
Sommerset, New Jersey 088734; and
Department of Medicinal Chemistry and Molecular
Pharmacology, Purdue University, West Layfayette, Indiana
47907-13335
Received 23 June 2000/Returned for modification 24 August 2000/Accepted 12 December 2000
 |
ABSTRACT |
The relative pathogenicities of three Candida
albicans strains differing in the function of
ADE2 (the gene encoding phosphoribosylaminoimidazole carboxylase) were evaluated in a murine candidiasis model. C. albicans strain CAI7 (ade2/ade2), previously
constructed by site-specific recombination, was avirulent in
immunosuppressed mice compared to the parent strain, CAF2-1, and a
heterozygous ADE2/ade2 strain obtained by
transforming CAI7 with a wild-type allele. The reduced virulence of
CAI7 was correlated with the inability to proliferate in either
synthetic medium or serum without the exogenous addition of >10 µg
of adenine/ml. The loss of virulence upon site-specific disruption of
the ade2 locus, and the restoration of wild-type virulence with the repair of just one ade2 allele,
confirmed that the ADE2 gene and de novo purine
biosynthesis were required for Candida pathogenicity.
The potential of the phosphoribosylaminoimidazole carboxylase enzyme as
a novel target for antifungal drug discovery is discussed.
 |
INTRODUCTION |
Candida albicans is an
opportunistic human pathogen causing mucosal and cutaneous infections
as well as life-threatening systemic infections in immunosuppressed
patients. The incidence of candidiasis has increased markedly over the
past 20 years, coinciding with an increase in immunosuppressed
individuals (6). This increase is primarily due to
the expanded use of chemotherapy and organ transplantation and to the
rapid increase in the numbers of AIDS patients. Candidiasis is
currently treated with amphotericin B or with a number of drugs
collectively referred to as azoles. Amphotericin B exerts its
antifungal activity by binding to the fungal steroid ergosterol and
disrupting membrane integrity (1), whereas the azoles
directly inhibit the biosynthesis of ergosterol (9). The potential for widespread resistance to
azole drugs is an increasing concern (16). The
development of safe, efficacious antifungal drugs that exhibit a
novel mechanism of action is an important challenge for medical
research. A greater understanding of virulence mechanisms and
genes required for C. albicans pathogenesis is needed to
meet this challenge.
Recent attention has focused on the identification of virulence factors
that dictate the ability of C. albicans to invade tissues
and circumvent host defense responses. Tissue adherence (17), cell wall mannan, serine proteases, cellular
hydrolases (2), and phospholipases (8) are
examples of virulence factors utilized by C. albicans for
infection. Also, a number of C. albicans housekeeping and
morphogenesis genes are essential for C. albicans pathogenesis. Although not classical virulence factors, these genes are
critical for C. albicans survival in a host. For example, purine, pyrimidine, and heme biosynthesis, which are all
necessary for cell growth and division in vitro, are
required for C. albicans pathogenesis in experimental murine
candidiasis (10). Similarly, myristoyl-coenzyme
A:protein N-myristoyl transferase, which is involved in protein myristoylation (22), and the
PHR1 gene, which functions as a pH-sensitive
morphological determinant (7), are essential for
pathogenesis. Additional studies of both virulence genes and genes
essential for C. albicans survival will provide a basis for
future antifungal drug development.
The de novo purine biosynthetic pathway is central to cellular
metabolism, providing adenine and guanine nucleotide precursors to DNA
synthesis and repair, to RNA transcription, and to histidine biosynthesis. The ADE2 gene encodes
phosphoribosylaminoimidazole carboxylase, which catalyzes
the sixth step of the de novo purine biosynthesis pathway. The
ADE2 gene is essential to fungi and, interestingly,
ADE2 mutants appear as red colonies when grown on agar
medium (15). The red pigment is thought to result from the
accumulation and subsequent polymerization of the substrate, phosphoribosylaminoimidazole (21). The de novo purine
biosynthetic pathway has been associated with pathogenesis in C. albicans. Purine auxotrophic mutants obtained after random
chemical and UV mutagenesis exhibit reduced virulence in a murine model
of systemic candidiasis (12, 14, 19). These results
indicate that purine auxotrophy may limit C. albicans
virulence, with the caveat that random mutagenesis may have introduced
additional unidentified mutations. Recently, the ADE2 gene
was more directly linked to reduced virulence in C. albicans
(10) and Cryptococcus neoformans
(13). In these studies, the ade2 mutant strains
of C. albicans and C. neoformans were
less virulent than wild-type strains in an immunosuppressed murine
model of systemic candidiasis and in an immunosuppressed rabbit
model of cryptococcal meningitis, respectively. Although
the ade2 mutant strains were again generated by random
mutagenesis, the reduced pathogenesis resulted directly from the
ade2 mutation since the mutant strains recovered wild-type virulence after transformation with a plasmid containing an active ADE2 gene. These experiments more clearly defined the
ADE2 gene as essential for fungal pathogenesis.
In this report, we further investigated the role of de novo purine
biosynthesis and specifically the ADE2 gene in C. albicans pathogenesis. The virulence of C. albicans strain CAI7 (ade2/ade2) that was
previously constructed by gene disruption (4) was evaluated in an immunosuppressed model of systemic candidiasis. The use
of an ade2/ade2 mutant strain generated by targeted gene disruption avoided the potential for secondary mutations inherent with
random mutagenesis techniques. CAI7 was unable to proliferate in the
kidney and was nonpathogenic compared to its parent strain, CAF2-1, and
a heterozygous complemented strain, CAI7-R. The reduced virulence of
CAI7 resulted directly from the block in de novo purine biosynthesis
and the inability to scavenge purines from the host. Furthermore, only
a single copy of the ADE2 gene was required to restore
wild-type virulence.
 |
MATERIALS AND METHODS |
Organisms and media.
The yeast strains utilized for this
study are listed in Table 1. The strains
were routinely grown at 30°C on yeast extract-peptone-dextrose (YEPD) medium or synthetic complete medium solidified with 2% agar as needed (20). A heterozygous ADE2/ade2
strain was constructed by repairing the
ade2::hisG allele of strain CAI7 by
homologous recombination. A XhoI-NotI restriction
enzyme fragment from PBSIIZap 25 CA2 containing the C. albicans ADE2 gene (18) was transfected into strain CAI7 spheroplasts essentially as described previously (11). The heterozygous strain, designated CAI7-R, was
selected on synthetic complete medium without adenine and uridine. The Ura+ Ade+ phenotype
indicated that the transfected ADE2 DNA had recombined with
the ade2::hisG allele and not with the
ade2::hisG-URA3-hisG allele. The heterozygous genotype was confirmed by PCR (25 cycles; annealing temperature, 50°C) utilizing an antisense primer to the
ADE2 coding region,
GGTCGATACGAATTCTTATTTTTTCAATTTATCAG, and a primer to the 5'
promoter region, GGTCGGATCCATGGATAGCAAAACTGTTGG, which
produced a 1.7-kb DNA fragment.
Growth rates.
Strains were grown overnight in synthetic
complete medium supplemented with 100 µg of adenine (Sigma)/ml. Each
strain was diluted to 104 cells/ml into synthetic
complete medium lacking adenine. Duplicate dilutions were also made
into synthetic complete medium supplemented with 100 µg of
adenine/ml. Growth rates were monitored by determining both the optical
density at 600 nm and the number of CFU.
Serum growth.
C. albicans
strains were grown in YEPD medium, inoculated into fresh mouse or human
serum at a concentration of 103 CFU/ml, and
incubated at 35°C for up to 24 h.
Experimental murine model.
Female Swiss Webster mice
weighing 20 to 25 g were injected with 100 mg of cyclophosphamide
(catalog no. C7397; Sigma)/kg of body weight on days 4 and 1 prior to
Candida infection and every 3 days during the course
of the experiment. Immunosuppression with this dosing regimen
was confirmed by determining the differential leukocyte counts
with a Coulter counter. Candida strains were grown to
saturation (16 h) in YEPD at 30°C. Prior to injection, yeast cells
were washed three times in sterile phosphate-buffered saline, diluted,
and counted on a hemacytometer. The cell concentrations were adjusted
to 106 to 109 cells/ml for
CAI7 and 104 to 107
cells/ml for CAF2-1 and CAI7-R. Murine candidiasis was induced by
injection of 0.1 ml of yeast cell suspension into the lateral tail
vein. Survival was monitored for 21 days.
Histological techniques.
Histological analysis of the liver,
lungs, spleen, and kidneys were done for lethally moribund mice or for
separate groups of mice infected specifically to provide histological
samples for studying time-course infection. Tissue was fixed in 10%
phosphate-buffered formalin and processed with standard histological
techniques. The sections were stained with hematoxylin and eosin stain
(H&E), periodic acid-Schiff stain (PAS), or Gimori's methenamine
silver stain (GMS) to visualize the extent of yeast cell invasion and proliferation.
 |
RESULTS |
Properties of C. albicans strains.
Three
strains of C. albicans were used in this study (Table 1).
The parent strain, CAF2-1, was phenotypically wild type for in vitro
growth and pathogenesis (5). Strain CAI7 was
phenotypically an adenine auxotroph and produced red colonies on medium
depleted of adenine. Strain CAI7-R was constructed by replacing the
ade2::hisG allele of strain CAI7 with a
wild-type copy of the C. albicans ADE2 gene. Strain CAI7 was
unable to grow in adenine-free medium as expected for a homozygous
ade2 mutant (Fig. 1).
Interestingly, the heterozygous strain, CAI7-R, exhibited
slower growth than CAF2-1 in adenine-free medium, which was
reversed with exogenous adenine. The slower growth of the heterozygote
indicated that purine biosynthesis was partially rate limiting for
growth when only one copy of the ade2 gene was present. All
three strains had similar growth rates when cultured in YEPD medium
(data not shown) or on synthetic complete medium supplemented with 50 µg of adenine/ml.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
In vitro growth rates of CAF2-1, CAI7, and CAI7-R.
Wild-type CAF2-1 (squares), ade2/ade2 adenine
auxotrophic CAI7 (circles), and heterozygous ADE2/ade2
CAI7-R (triangles) were grown in synthetic minimal medium in the
presence (closed symbols) or the absence (open symbols) of 50 µg of
adenine/ml. At the designated times, growth (CFU) was determined from
replicated samples diluted in YEPD broth and grown on YEPD agar for 2 days at 37°C.
|
|
Systemic candidiasis in immunosuppressed mice.
Invasive fungal
infections typically occur in immunosuppressed hosts. We compared the
virulence of strain CAI7 with that of CAF2-1, its parent strain, in
an immunosuppressed murine model of candidiasis. Chronic immune
suppression was achieved by administration of cyclophosphamide (100 mg/kg) intraperitoneally every 3 days, starting 4 days prior to
Candida injection and continuing for the duration of the
experiment. Lymphocyte levels were suppressed to <100/µl for the
entire course of the experiment compared to >8,000/µl in untreated
mice. The observed 50% lethal dose (LD50) was
5 × 103 wild-type C. albicans blastoconidia per mouse for injections into the tail
veins of immunosuppressed mice (Fig. 2).
This was the lowest LD50 reported for a murine
candidiasis model and likely resulted from the extended
immunosuppressive treatment. Kidneys from lethally moribund or
dead mice displayed numerous severe microabscesses on the surface (Fig.
3A) and exhibited prolific Candida invasion of the cortex, medulla, and papilla regions
(Fig. 3B). In this chronic immunosuppressed murine model, microabscess formation on the kidneys enabled reliable and consistent visual scoring
for Candida infection.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
Virulence of C. albicans CAF2-1 and CAI7
in immunosuppressed mice. Mice were injected with 2 × 103 ( ), 2 × 104 ( ), 2 × 105 ( ), or 2 × 106 ( )
of wild-type CAF2-1 blastoconidia (top) or 5 × 105
( ), 5 × 106 ( ), 5 × 107
( ), or 5 × 108 ( ) of
ade2/ade2 CAI7 blastoconidia (bottom). Ten mice were
inoculated through the tail veins with the indicated number of
blastoconidia, and mortality was determined over the course of a 21-day
experiment. Data were recorded as percent survival on each day.
|
|

View larger version (98K):
[in this window]
[in a new window]
|
FIG. 3.
Infection of C. albicans in the kidneys
of immunosuppressed mice. Kidneys were dissected, and transverse
sections were stained with H&E and GMS to aid in histological
examination. Representative kidney (A) and histological (B) sections
from mice 4 days after injection with 104 CAF2-1
(wild-type) blastoconidia are shown, as are representative kidney (C)
and histological (D) sections from mice 6 days after injection with
105 CAI7 (ade2/ade2)
blastoconidia.
|
|
Strain CAI7 generally appeared to be nonpathogenic at doses less than
10
6 blastoconidia per mouse in this model. The
LD
50 was determined
to be 2.5 × 10
6 compared to the LD
50 of
5 × 10
3 for strain CAF2- (Fig.
2).
Histological examination of the kidneys
provided an equally striking
difference between strains. Kidney
sections were examined for every
mouse infected with strain CAI7
at the end of the 21-day experiment. No
evidence of infection
was histologically detectable in the kidney
cortex or the medulla,
which is the major site of infection by
wild-type
C. albicans (Fig.
3C and D). Furthermore, no
secondary sites of infection
were observed upon examination of
heart, lung, liver, spleen,
and brain tissues. Clearly, the
ADE2 gene was required for normal
infection in this
chronic immunosuppressed murine
model.
Infection with the highest titer of strain CAI7 (5 × 10
8 blastoconidia/mouse) resulted in a 100%
incidence of mortality in
the cyclophosphamide-treated mice (Fig.
2).
This mortality at
the high doses appeared to be an acute response
rather than the
result of a progressive fungal infection, and the
potential causes
were investigated histologically. Mice were injected
with 10
8 yeast cells of strain CAI7/mouse, and
tissues were taken 1, 3,
and 7 days after injection. Kidney, spleen,
liver, and lung sections
were stained with PAS and GMS to aid in
histological examination.
At 10
8
blastoconidia/mouse, CAI7 was observed in all tissues evaluated.
Yeast
cells were observed in especially high numbers in the lung
at 24 h
after injection (Fig.
4). The
microcapillary beds in the
lung were highly occluded and likely
resulted in the acute mortality
seen at the high titer. The acute
mortality and accumulation of
blastoconidia in lung microcapillary beds
associated with high-titer
infections were also observed for strain
CAI4, a nonpathogenic
homozygous
C. albicans ura3 mutant,
and was not specific to strain
CAI7 (data not shown).

View larger version (159K):
[in this window]
[in a new window]
|
FIG. 4.
Localization of C. albicans CAI7 in the
murine lung. Immunosuppressed mice were injected with 108
C. albicans CAI7 blastoconidia through the tail veins.
Lung tissues were dissected 4 days after injection. Sections were
stained with PAS and GMS to aid in histological examination.
Representative sections are shown for uninfected (A) and CAI7-infected
(B) mice.
|
|
The necessity of a functional
ade2 allele for infection was
further established by repairing one
ade2 allele in strain
CAI7
by using site-specific homologous recombination and evaluating
the
virulence of the heterozygous complemented strain, CAI7-R.
Strains
CAF2-1 and CAI7-R were injected at 10
4
blastoconidia/mouse, and both resulted in similar rates of mortality
over the course of the 21-day experiment (Fig.
5). Histological
examination of kidneys
from infected mice revealed that at the
time of death both strains had
similarly infected the kidneys,
resulting in numerous microabscesses
and prolific invasion of
the cortex and medulla. Consistent with
previous results, strain
CAI7 was nonpathogenic in this experiment,
even at 10
5 yeast cells/mouse. These observations
demonstrated that the reduced
pathogenesis of strain CAI7 resulted
directly from the
ade2 mutation
since full virulence was
recovered by specifically repairing the
ade2::
hisG mutant allele. Furthermore,
only a single functioning
ADE2 allele was required for
apparent wild-type virulence.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 5.
Restoration of virulence for strain CAI7 in
immunosuppressed mice. Mice (10 per treatment) received a tail vein
injection of 104 blastoconidia of C.
albicans wild-type CAF2-1 ( ), heterozygous
ADE2/ade2 CAI7-R ( ), or 105 blastoconidia
of ade2/ade2 auxotroph CAI7 ( ). Mortality was
determined over the course of a 21-day experiment. Data were recorded
as percent survival on each day.
|
|
Strain CAI7 was unable to proliferate in serum.
The virulence
of the mutant was attenuated presumably because serum purine levels
were inadequate to support growth. To test this hypothesis, each strain
was evaluated for growth in human serum. Strains CAF2-1 and CAI7-R
rapidly underwent a dimorphic switch and proliferated in normal human
serum in both the presence and the absence of exogenous adenine (Fig.
6). Strain CAI7 initiated a dimorphic
switch but was unable to proliferate in normal serum. The ability of
strain CAI7 to proliferate in serum was restored when serum was
supplemented with 50 µg of exogenous adenine/ml. Interestingly, the
addition of <10 µg of adenine/ml had little effect on CAI7
proliferation in serum, suggesting that a threshold concentration of
adenine was required for growth. These experiments were repeated using
murine serum with similar results (data not shown).

View larger version (87K):
[in this window]
[in a new window]
|
FIG. 6.
Growth of C. albicans in whole human
serum. Strains CAF2-1 (A) and CAI7-R (B) were inoculated in whole human
serum without the addition of exogenous adenine. Similar results were
obtained for both strains in the presence of up to 50 µg of
adenine/ml (data not shown). Strain CAI7 was inoculated into human
serum with 0 (C), 0.5 (D), 5 (E), and 50 (F) µg of exogenous
adenine/ml. Observations were made at 24 h after inoculation.
|
|
 |
DISCUSSION |
The de novo purine biosynthetic pathway is an essential pathway in
fungi. The ADE2 gene encodes phosphoribosylaminoimidazole carboxylase, a bifunctional enzyme that catalyzes the sixth step of de
novo purine biosynthesis. Homozygous C. albicans ade2
mutants are adenine auxotrophs in vitro and appear as red colonies due to the accumulation and spontaneous polymerization of the substrate aminoimidazole ribosyl phosphate. The requirement of the
ADE2 gene for infection was previously shown for both
C. albicans and C. neoformans (10,
13) with the use of ade2 mutants obtained by random
mutagenesis procedures. Recently, a homozygous ade2 C. albicans strain, CAI7, was generated by targeted gene disruption, which is a direct and selective means of creating isogenic strains to
study gene function. The availability of strain CAI7 provided a new
opportunity to study the role of the ADE2 gene and de novo purine biosynthesis in pathogenesis. The virulence of strain CAI7 was
compared to the phenotypically wild-type parent strain, CAF2-1, from
which it was derived. This was a critical experiment to determine whether strain CAI7 could scavenge purines from the host, circumventing the block in de novo biosynthesis. The titer of C. albicans
needed to kill 50% of the mice was >100-fold higher for strain CAI7
than for strain CAF2-1 in an immunosuppressed murine candidiasis model. Correlated with the reduced virulence, strain CAI7 was unable to
proliferate in the cortex or medulla of the kidney, which is the
primary site of infection for wild-type C. albicans in the murine experimental model. Furthermore, strain CAI7 was unable to
infect the heart, spleen, lungs, or nervous system under the same
conditions, which result in lethal systemic and disseminated candidiasis by a wild-type strain. The inability of CAI7 to proliferate in human serum was directly correlated to the observed reduced virulence. These results provided a more-detailed confirmation of a
previous report that C. albicans ade2 mutants are avirulent (10). Clearly, de novo purine biosynthesis is required for
C. albicans infection and ade2 mutant strains are
unable to scavenge sufficient purines from host tissues to overcome the
block in de novo biosynthesis.
Interestingly, strain CAI7 was not completely avirulent but instead
exhibited 100-fold attenuation of virulence. Injection of
108 CAI7 yeast cells in the immunosuppressed
murine model resulted in significant acute mortality within 48 h
that was distinct from mortality resulting from the time-dependent
appearance of systemic candidiasis. Acute mortality at higher doses may
have reflected a limitation of the experimental animal model resulting
from several possible explanations. High doses of avirulent bacterial
strains often lead to acute mortality in experimental models as the
result of endotoxin-induced septic shock. Although not known to produce endotoxins, C. albicans does produce a number of
tissue-damaging proteases and hydrolases which may have contributed to
the observed acute mortality at high titer (2).
Additionally, the number of blastoconidia, which can be introduced into
the bloodstream of mice, may have an upper limit before the shear
volume of blastoconidia results in occluded capillaries. In fact, our
observations confirmed that >107 CAI7 yeast
cells per mouse resulted in highly occluded capillary beds in the
lungs. The acute mortality resulting from tissue-degrading enzymes and
physical occlusion of capillary beds likely has less clinical relevance
than the time-dependent systemic infection of organs, such as the
kidneys, which is observed at lower titers. When the objective is an
experimental assessment of virulence or drug efficacy, we suggest that
the C. albicans titer be more appropriately limited to
ensure that the host survives the first 48 h.
C. albicans ade2 mutants exhibited some ability to survive
in vivo, albeit with attenuated pathogenicity. First, C. albicans ade2 mutants were able to undergo a dimorphic switch and initiated hyphae in serum in vitro and in murine kidney sections in vivo. Prior
to the experiments, strain CAI7 was grown in rich medium containing
adenine and then introduced as blastoconidia. The blastoconidia appeared to contain enough purine reserves to make a dimorphic switch
and initiate hyphae. Second, some red CAI7 colonies were obtained from
kidneys of chronically immunosuppressed mice up to 21 days after
injection, although a majority of the kidneys were sterile at this
time. The recovery of viable CAI7 colonies from minced kidneys without
histological evidence of the ability to proliferate in the kidney
cortex suggests that strain CAI7 may survive in a static state for
several weeks.
A prediction from the murine models was that de novo purine
biosynthesis and specifically the ADE2 gene will be required
for C. albicans infection in humans. This prediction assumes
that free purine levels in human tissues are similar to those in murine tissues; otherwise, free adenine or adenosine might circumvent a block
in de novo synthesis. In fact, the C. albicans ade2/ade2 strain was unable to proliferate in human serum unless it was supplemented with exogenous adenine. These results confirm that human
serum does not have enough free purines to support growth and, in
combination with the murine candidiasis experimental data, support the
prediction that the ADE2 gene is required for pathogenesis in humans. The identification of the ADE2 gene as
potentially critical for human pathogenesis has increased importance in
light of recent publications that suggest a divergent catalytic
mechanism between human and bacterial phosphorylribosylaminoimidazole
carboxylase enzymes (3). The bacterial enzymes catalyze
the ATP- and bicarbonate-dependent carboxylation of
phosphoribosylaminoimidazole to
carboxyphosporibosylaminoimidazole through an
N5-carbamate intermediate, whereas the
vertebrate ADE2 enzymes catalyze CO2-dependent, ATP-independent direct
carboxylation of the imidazole ring, foregoing the carbamate
intermediate. Sequence analysis and complementation testing
confirm that the C. albicans ADE2 gene is similar to the
bacterial genes (18). The divergent catalytic mechanisms
may provide a basis to develop selective mechanism-based antifungal compounds.
 |
ACKNOWLEDGMENTS |
We acknowledge the excellent technical assistance provided by
Jana Dodge, Jim Nuckolls, and Suzanne Davis at the Pharmacia Animal
Research Facility. We also appreciate the critical comments provided by
Thomas Sanderson of Pharmacia Product Safety Assessment. Finally, we
acknowledge the efforts of Ruth Berger at Histotechniques for the
preparation and staining of histological sections.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Agricultural
Genomics, Monsanto Company, 800 North Lindbergh Blvd., St. Louis, MO
63167. Phone: (314) 694-8271. Fax: (314) 694-3914. E-mail:
stanton.b.dotson{at}monsanto.com.
Editor:
R. N. Moore
 |
REFERENCES |
| 1.
|
Brajtburg, J.,
W. G. Powderly,
G. S. Kobayashi, and G. Medoff.
1990.
Amphotericin B: current understanding of mechanisms of action.
Antimicrob. Agents Chemother.
34:183-188[Free Full Text].
|
| 2.
|
Cutler, J. E.
1992.
Putative virulence factors of Candida albicans.
Annu. Rev. Microbiol.
45:187-218[CrossRef][Medline].
|
| 3.
|
Firestine, S. M.,
S.-W. Poon,
E. J. Mueller,
J. Stubbe, and V. J. Davisson.
1994.
Reactions catalyzed by 5-aminoimidazole ribonucleotide carboxylases from Escherichia coli and Gallus gallus: a case for divergent catalytic mechanisms.
Biochemistry
33:11927-11934[CrossRef][Medline].
|
| 4.
|
Fonzi, W. A., and M. Y. Irwin.
1993.
Isogenic strain construction and gene mapping in Candida albicans.
Genetics
134:717-728[Abstract].
|
| 5.
|
Gale, C. A.,
C. M. Bendel,
M. McClellan,
M. Hauser,
J. M. Becker,
J. Berman, and M. K. Hostetter.
1998.
Linkage of adhesion, filamentous growth, and virulence in Candida albicans to a single gene, INT1.
Science
279:1355-1358[Abstract/Free Full Text].
|
| 6.
|
Georgopapadakou, N. H., and T. J. Walsh.
1994.
Human mycoses: drugs and targets for emerging pathogens.
Science
264:371-373[Free Full Text].
|
| 7.
|
Ghannoum, M. A.,
B. Spellberg,
S. M. Saporito-Irwin, and W. A. Fonzi.
1995.
Reduced virulence of Candida albicans PHR1 mutants.
Infect. Immun.
63:4528-4530[Abstract].
|
| 8.
|
Ibrahim, A. S.,
F. Mirbod,
S. G. Filler,
Y. Banno,
G. T. Cole,
Y. Kitajima,
J. E. Edwards, Jr.,
Y. Nozawa, and M. A. Ghannoum.
1995.
Evidence implicating phospholipase as a virulence factor in Candida albicans.
Infect. Immun.
63:1993-1998[Abstract].
|
| 9.
|
Joly, V.,
J. Bolar, and P. Yeni.
1992.
In vitro models for studying toxicity of antifungal agents.
Antimicrob. Agents Chemother.
36:1799-1804[Free Full Text].
|
| 10.
|
Kirsch, D. R., and R. R. Whitney.
1991.
Pathogenicity of Candida albicans auxotrophs in experimental infections.
Infect. Immun.
59:3297-3300[Abstract/Free Full Text].
|
| 11.
|
Kurtz, M. B.,
M. W. Cortelyou,
S. M. Miller,
M. Lai, and D. R. Kirsch.
1987.
Development of autonomously replicating plasmids for Candida albicans.
Mol. Cell. Biol.
7:209-217[Abstract/Free Full Text].
|
| 12.
|
Kwon-Chung, K. J., and W. B. Hill.
1970.
Studies on the pink, adenine-deficient strains of Candida albicans. 1. Cultural and morphological characteristics.
Sabouraudia
8:48-59[Medline].
|
| 13.
|
Perfect, J. R.,
D. L. Toffaletti, and T. H. Rude.
1993.
The gene encoding phosphoribosylaminoimidazole carboxylase (ade2) is essential for growth of Cryptococcus neoformans in cerebrospinal fluid.
Infect. Immun.
61:4446-4451[Abstract/Free Full Text].
|
| 14.
|
Poulter, R. T. M., and E. H. A. Rikkerink.
1983.
Genetic analysis of red, adenine-requiring mutants of Candida albicans.
J. Bacteriol.
156:1066-1077[Abstract/Free Full Text].
|
| 15.
|
Reaume, S. E., and E. L. Tatum.
1948.
Spontaneous and nitrogen mustard-induced nutritional deficiencies in Saccharomyces cerevisiae.
Arch. Biochem.
22:331-338.
|
| 16.
|
Rex, J. H.,
M. G. Rinaldi, and M. A. Pfaller.
1995.
Resistance of Candida species to fluconazole.
Antimicrob. Agents Chemother.
39:1-8[Medline].
|
| 17.
|
Rotrosen, D.,
R. A. Calderone, and J. E. Edwards, Jr.
1986.
Adherence of Candida species to host tissues and plastic surfaces.
Rev. Infect. Dis.
8:73-85[Medline].
|
| 18.
|
Schmuke, J. J.,
V. J. Davisson,
K. Gheesling-Mullis,
S. L. Bonar, and S. B. Dotson.
1997.
Sequence analysis of the Candida albicans ADE2 gene and physical separation of the two functionally distinct domains of the phosphoribosylaminoimidazole carboxylase.
Yeast
13:769-776[CrossRef][Medline].
|
| 19.
|
Shepard, M. G.
1985.
Pathogenicity of morphological and auxotrophic mutants of Candida albicans in experimental infections.
Infect. Immun.
50:541-544[Abstract/Free Full Text].
|
| 20.
|
Sherman, F.,
G. R. Fink, and J. B. Hicks.
1986.
Methods in yeast genetics.
Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y.
|
| 21.
|
Smirnov, M. N.,
V. N. Smirnov,
E. I. Budowsky,
S. G. Inge-Vechtomov, and N. G. Serebrjakov.
1967.
Red pigment of adenine-deficient yeast Saccharomyces cerevisiae.
Biochem. Biophys. Res. Commun.
3:299-304.
|
| 22.
|
Weinberg, R. A.,
C. A. McWherter,
S. K. Freeman,
D. C. Wood,
J. I. Gordon, and S. C. Lee.
1995.
Genetic studies reveal that myristoylCoA:protein N-myristoyl transferase is an essential enzyme in Candida albicans.
Mol. Microbiol.
16:241-250[CrossRef][Medline].
|
Infection and Immunity, April 2001, p. 2542-2548, Vol. 69, No. 4
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.4.2542-2548.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chen, Y.-L., Kauffman, S., Reynolds, T. B.
(2008). Candida albicans Uses Multiple Mechanisms To Acquire the Essential Metabolite Inositol during Infection. Infect. Immun.
76: 2793-2801
[Abstract]
[Full Text]
-
Jezewski, S., von der Heide, M., Poltermann, S., Hartl, A., Kunkel, W., Zipfel, P. F., Eck, R.
(2007). Role of the Vps34p-interacting protein Ade5,7p in hyphal growth and virulence of Candida albicans. Microbiology
153: 2351-2362
[Abstract]
[Full Text]
-
Brand, A., MacCallum, D. M., Brown, A. J. P., Gow, N. A. R., Odds, F. C.
(2004). Ectopic Expression of URA3 Can Influence the Virulence Phenotypes and Proteome of Candida albicans but Can Be Overcome by Targeted Reintegration of URA3 at the RPS10 Locus. Eukaryot Cell
3: 900-909
[Abstract]
[Full Text]