Previous Article | Next Article 
Infection and Immunity, May 2001, p. 3057-3066, Vol. 69, No. 5
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.5.3057-3066.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Antigenic Variation of Anaplasma
Marginale: Major Surface Protein 2 Diversity during Cyclic
Transmission between Ticks and Cattle
A. F.
Barbet,1,*
Jooyoung
Yi,1
Anna
Lundgren,1
B. R.
McEwen,2
E. F.
Blouin,2 and
K. M.
Kocan2
Department of Pathobiology, College of
Veterinary Medicine, University of Florida, Gainesville, Florida
32611,1 and Department of Veterinary
Pathobiology, College of Veterinary Medicine, Oklahoma State
University, Stillwater, Oklahoma 740782
Received 21 November 2000/Returned for modification 18 January
2001/Accepted 8 February 2001
 |
ABSTRACT |
The rickettsial pathogen Anaplasma marginale expresses
a variable immunodominant outer membrane protein, major surface protein 2 (MSP2), involved in antigenic variation and long-term persistence of
the organism in carrier animals. MSP2 contains a central hypervariable region of about 100 amino acids that encodes immunogenic B-cell epitopes that induce variant-specific antibodies during infection. Previously, we have shown that MSP2 is encoded on a polycistronic mRNA
transcript in erythrocyte stages of A. marginale and
defined the structure of the genomic expression site for this
transcript. In this study, we show that the same expression site is
utilized in stages of A. marginale infecting tick salivary
glands. We also analyzed the variability of this genomic expression
site in Oklahoma strain A. marginale transmitted from in
vitro cultures to cattle and between cattle and ticks. The structure of
the expression site and flanking regions was conserved except for
sequence that encoded the MSP2 hypervariable region. At least three
different MSP2 variants were encoded in each A. marginale
population. The major sequence variants did not change on passage of
A. marginale between culture, acute erythrocyte stage
infections, and tick salivary glands but did change during persistent
infections of cattle. The variant types found in tick salivary glands
most closely resembled those present in bovine blood at the time of
acquisition of infection, whether infection was acquired from an acute
or from a persistent rickettsemia. These variations in structure of an
expression site for a major, immunoprotective outer membrane protein
have important implications for vaccine development and for obtaining
an improved understanding of the mechanisms of persistence of
ehrlichial infections in humans, domestic animals, and reservoir hosts.
 |
INTRODUCTION |
Anaplasma marginale is an
animal pathogen of major economic importance to livestock production
throughout many areas of North and South America, Africa, Australia,
and Asia (22). Anaplasmosis causes economic losses in the
United States of approximately $300 million/year (cost in 1986 U.S.
dollars) (20). A. marginale is classified as a
genogroup II ehrlichial agent, closely related taxonomically to other
animal and human ehrlichial pathogens (9). Genogroup I and
II ehrlichial agents include Cowdria ruminantium, causative
agent of heartwater disease in ruminants; Ehrlichia canis, a
causative agent of canine ehrlichiosis; Ehrlichia
chaffeensis, which causes human monocytic ehrlichiosis; and agents
related or identical to Ehrlichia phagocytophila and
Ehrlichia ewingii that cause animal and human granulocytic
ehrlichioses. The human ehrlichioses are classified as emerging
diseases, with >500 cases confirmed since 1985 and an estimated 5%
fatality rate.
There are a number of common features to these ehrlichial infections.
After an initial acute phase infections may persist for long periods,
even with antibiotic treatment (2, 10, 11, 16, 17, 29). In
persistent infections caused by A. marginale, use of DNA
probes and quantitative PCR revealed recurrent cyclic peaks of
rickettsemia that probably continue for the lifetime of an infected
animal (13, 19). A. marginale organisms express an outer membrane protein, major surface protein 2 (MSP2),
approximately 36 kDa in size, which is strongly recognized by B and T
cells from infected animals and partially protects immunized animals against challenge (8, 12, 23, 24). MSP2 is significantly similar to the major outer membrane protein of other ehrlichial organisms in amino acid sequence and is also encoded by a multigene family (25). Like outer membrane proteins of an agent of
human granulocytic ehrlichiosis, MSP2 contains a single hypervariable region in the central part of the molecule (14). In the
recurrent peaks of a single infection caused by A. marginale
there are at least three different genetic and antigenic variants of
MSP2 expressed in each peak (15). We have demonstrated
previously that the predominant msp2 mRNA transcript in
erythrocyte stages of A. marginale is a polycistronic mRNA
containing msp2 and three other genes. Also, we have
demonstrated that msp2 variation proceeds through the
formation of different sequence mosaics in the expression site for this
polycistronic mRNA (4). The availability of the sequence
of this msp2 expression site, together with the recent development of an in vitro culture system for A. marginale
(21), permits analysis of the extent and limitations of
msp2 variation as organisms cycle between their different
stages in infected tick and mammalian cells.
 |
MATERIALS AND METHODS |
Derivation of A. marginale populations.
An
Oklahoma strain of A. marginale was propagated by in vitro
culture, as described (6). Briefly, infected blood was
collected in 1998 from a calf with clinical anaplasmosis from Wetumka,
Okla., and was subinoculated into a susceptible, splenectomized calf. Blood collected at peak rickettsemia was frozen, thawed, and used as
inoculum on confluent tick cell monolayers derived from lxodes scapularis embryos. Colonies of A. marginale were
apparent in low numbers at 9 days postexposure, and infection in
monolayers reached 100% (terminal cultures) by 4 to 5 weeks
postexposure. Cultures were passaged by placing terminal cultures onto
fresh tick cell monolayers at a dilution of 1:5 or 1:10. By the third passage development of the cultured Oklahoma strain was similar to that
of the Virginia strain described previously (21), and a
1:5 dilution resulted in 100% infection in 10 to 12 days.
After two serial passages were achieved, a 25-cm2 flask
with an infection of ~90% was used to infect a splenectomized calf (PA408). Cells were pipetted from the flask and disrupted with a
ground-glass homogenizer. Cells were suspended in 1 ml of medium and
inoculated intravenously. Calf PA408 was monitored daily for clinical
signs and appearance of rickettsiae in Diff-Quik-stained blood films.
Calf PA408 developed clinical anaplasmosis with a prepatent period of
20 days, a peak rickettsemia of 34%, and a minimum packed cell volume
of 12%. When the A. marginale rickettsemia was
approximately 30%, 200 male Dermacentor variabilis ticks
were acquisition fed on calf PA408 for 7 days during the ascending rickettsemia. After the infected ticks were removed and held for 7 days
in a humidity chamber, they were transmission fed on a second
splenectomized calf (calf PA407), which was monitored as described
previously. Male D. variabilis ticks which fed on calf PA408
transmitted A. marginale to calf PA407 with a prepatent period of 22 days, a peak rickettsemia of 51% and a minimum PCV of
13.5%. Calf PA407 recovered from acute anaplasmosis and remained a
carrier of A. marginale, with recurrent cycles of
erythrocytic rickettsemia approximately every 4 to 6 weeks, of
generally decreasing amplitude with time of infection. Another group of
D. variabilis ticks were acquisition fed on calf PA407
during the peak of persistent rickettsemia that occurred on 28 September 1998 and which represented the fifth microscopically detected
peak of A. marginale in calf PA407. These ticks were
transmission fed on a sheep for 7 days, to allow salivary gland stages
of A. marginale to fully develop. Samples were taken from
all A. marginale populations for DNA isolation and analysis
of the polycistronic msp2 expression site (see Fig. 1).
A second cyclic transmission was performed to investigate more closely
the relationship between
msp2 expression site variants
acquired by ticks from a persistently infected calf (calf PA417)
and
transmitted to a second calf (calf PA420). Calf PA417 was
infected with
the Oklahoma strain of
A. marginale by transmission
feeding
with
D. variabilis ticks. Calf PA417 experienced a
rickettsemia
peak of 64%, with a prepatent period of 23 days and
subsequent
rickettsemia peaks of decreasing amplitude. A group of
D. variabilis ticks were acquisition fed on PA417 on days
111 to 118 (16 to
23 September 1999) after the peak of acute
rickettsemia and subsequently
transmission fed on calf PA420, which
experienced an acute rickettsemia
of 45%. Blood samples were taken
from calf PA417 just prior to
the beginning of tick feeding (13 September 1999; 0.9% rickettsemia),
during tick feeding (20 September
1999; 1.3% rickettsemia), and
just after ticks were removed from the
calf (27 September 1999;
0.5% rickettsemia). Samples were also taken
for DNA isolation
from salivary glands of the infected ticks after
transmission
feeding and from the acute transmitted rickettsemia in
calf PA420.
The sequence of the hypervariable region was determined
from 10
independent clones of the
msp2 expression site in
each
A. marginale population.
To determine if there were differences in
msp2 expression
site variants transmitted by different tick species,
Dermacentor andersoni and
D. variabilis ticks were acquisition fed
at the
same time on
A. marginale-infected calf PA411 during
the acute
rickettsemia. These ticks were subsequently transmission fed
on
different naive calves before dissection and removal of salivary
glands for isolation of DNA for
msp2 expression site
analysis.
Genome and sequence analysis.
Erythrocyte stages of A. marginale were concentrated by passage of infected blood through a
cellulose column (C-6288; Sigma, St. Louis, Mo.). Genomic DNA was
isolated from erythrocytic stages of A. marginale by lysis
with sodium dodecyl sulfate and lysozyme and treatment with proteinase
K and ribonuclease, followed by phenol-chloroform extraction and
ethanol precipitation (5), or by using a kit for genomic
DNA isolation (Qiagen, Valencia, Calif.). DNA from A. marginale-infected tick salivary glands and cultured tick cells
was extracted with NucleoSpin nucleic acid purification kits (Clontech,
Palo Alto, Calif.). Genomic DNA was analyzed by restriction enzyme
digestion followed by agarose gel electrophoresis and Southern
blotting, as described (4), using probes specific for
msp2 or orf2, orf3, or orf4 of the
polycistronic msp2 expression site. The 3.9-kbp genomic
expression site for msp2 was also amplified as described
previously (4) using oligonucleotide primers AB767
(ACGCGCTTGAATAAATCGTT) and AB752
(CACCGGTTGATGAAGTTTGC). In some cases, primers AB750
(GGATTTTGTGGTCGGGTTTGTAT) and AB752 were used to similarly
amplify a 2.9-kbp segment of the expression site lacking
orf4 and its 5' flanking region. PCR amplified products were
analyzed by gel electrophoresis and sequenced directly or cloned into
the pCR-XL-TOPO vector (Invitrogen, Carlsbad, Calif.) and plasmid DNA
was isolated and sequenced. Sequencing was performed at the University
of Florida DNA Sequencing Core Laboratory (Gainesville, Fla.) using ABI
Prism Big Dye Terminator cycle sequencing protocols developed by
Applied Biosystems (Perkin-Elmer Corp., Foster City, Calif.). The
fluorescently labeled extension products were analyzed on an Applied
Biosystems model 373 Stretch DNA Sequencer (Perkin-Elmer Corp.).
Oligonucleotide primers were designed using OLIGO 5.0 (Molecular
Biology Insights, Cascade, Co.) software and synthesized by Genosys
Biotechnologies (The Woodlands, Tex.). Nucleotide sequences were
analyzed using the University of Wisconsin Genetics Computer Group
programs available through the Biological Computing Facility of the
Interdisciplinary Center for Biotechnology Research at the University
of Florida. Nucleotide and amino acid alignments were made using the
program PILEUP and displayed using PRETTY and PLOTSIMILARITY.
msp2 expression site variability was calculated from aligned
amino acid sequences using the following formula: number of different
amino acids at a given position/frequency of the most common amino acid
at that position (18).
Southern blotting of A. marginale genomic DNA.
Probes specific to msp2, orf2, orf3, or orf4 were
prepared and used in Southern blotting of digested A. marginale genomic DNA as described previously (4).
DNA probes were labeled with fluorescein-dUTP, hybridized, washed under
high-stringency conditions (60°C; 0.1× SSC [1× SSC is 0.15 M NaCl
plus 0.015 M sodium citrate], 0.1% SDS), and detected by
chemiluminescence (Illuminator Chemiluminescent Detection System;
Stratagene, La Jolla, Calif.). Molecular size standards were
Illuminator nonradioactive markers (Stratagene).
RNA isolation and RT-PCR.
Total RNA was isolated from
infected tick salivary glands preserved in RNAlater (Ambion, Austin,
Tex.) using the RNAqueous kit (Ambion). Isolated RNA was digested with
DNase I (DNA-free; Ambion) before use in reverse transcription
(RT)-PCRs. RNA transcripts of the msp2 gene were reverse
transcribed into DNA using the RETRO script kit (Ambion) and primer
AB198 (5'AAGGCAAACCTAACACCCAACTCACCACCA3'), which anneals to
the conserved 3' end of the coding region of the msp2 gene.
Primary RT-PCRs used oligonucleotide primers AB765 (5'GGAACAACCCCAATACCATC3') and AB766
(5'GTATGTCGATTCGCGGAAGAGCCTGTTGT3'), which amplify a 3.2-kb
segment of the msp2 polycistronic transcript; a 200 µM
concentration of each deoxynucleoside triphosphate, and 2.5 U of
AmpliTaq DNA polymerase (Perkin-Elmer). Secondary (nested) RT-PCRs used
primers AB192 (5'CTATCCTTGAAGCTAATCTTG3') plus AB783 (5'AGTATCACATTGGGGAGGTTT3') to amplify a segment containing
the 3' end of orf4, all of orf2 and -3, and the
5' end of msp2, of size 2.1 kbp. Control reactions were
conducted similarly, but without reverse transcriptase in the initial
RT reaction. Products of RT-PCR were analyzed by agarose gel
electrophoresis and Southern blotting using an orf2-specific
DNA probe. RT-PCR products were also cloned into the pCR-XL-TOPO vector
(Invitrogen), and plasmid DNA was isolated and sequenced to verify the
structure of amplified DNA.
Nucleotide sequence accession numbers.
The sequences
reported here have been assigned GenBank accession numbers AF317720 to
AF317726.
 |
RESULTS |
Structural conservation of the polycistronic msp2
expression site in A. marginale from culture, cattle, and
ticks.
Figure 1 shows the derivation
of A. marginale organisms used for analysis of the
msp2 expression site. Genomic DNA was extracted from each of
the seven different populations of A. marginale, and the
~3.9-kbp msp2 expression site was amplified by PCR and sequenced. The structure and sequence were similar to that described previously for the msp2 polycistronic expression site from
Florida and Idaho strains of A. marginale (4).
There were three open reading frames upstream of the msp2
gene, encoding polypeptides predicted by the PSORT algorithm
(http://psort.nibb.ac.jp) to be outer membrane proteins. As in Florida
and Idaho strains (4), orf3 and orf4
encoded polypeptides significantly similar to the outer membrane
protein OMP1b of E. chaffeensis. When the different Oklahoma
strain DNA sequences were aligned there were very few changes
observed in orf2, orf3, or orf4
between the different life cycle stages and populations of the Oklahoma
strain A. marginale (a total of 5 amino acid changes between
all seven populations in polypeptides encoded by orf2,
orf3, and orf4). In contrast, many differences
were present in the central msp2 hypervariable region
including substitutions, insertions and deletions (Fig. 2a). There was more variability,
particularly in orf4 when the expression site sequences of
acute erythrocyte stages from Oklahoma, Florida, and Idaho strains were
aligned (Fig. 2b). No changes were present between Oklahoma (all
stages), Florida, and Idaho strains in the 5'-flanking region of
orf4, which was previously shown to contain the +1 site
for transcription and a predicted prokaryotic promoter
(4).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 1.
Derivation of cyclically transmitted A. marginale populations for analysis of sequence diversity in the
polycistronic msp2 expression site.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
PLOTSIMILARITY profiles of nucleotide sequence
variability in msp2 expression sites show greatest
variability in the central region of the msp2 gene. (a) The
7 different populations from the Oklahoma strain of A. marginale described in Fig. 1 are compared; (b) Florida, Idaho,
and Oklahoma strain acute bloodstream populations are compared. A
similarity score of 1.0 indicates identical sequence in a sliding
window of 10 nucleotides; a decreasing score from 1.0 to 0.0 indicates
increasing variation.
|
|
MSP2 is encoded on a polycistronic transcript in A. marginale from tick salivary glands.
To demonstrate whether
or not this genomic site encoded an msp2-containing mRNA
transcript in tick salivary gland stages of A. marginale,
RT-PCR was used to amplify a fragment that contained linked
msp2, orf2, orf3, and orf4
genes. The expected fragment of 2.1 kbp was amplified from total RNA
prepared from salivary glands of both D. variabilis and
D. andersoni infected with A. marginale (Fig.
3). No PCR products were detected in
control reactions without reverse transcriptase. Sequencing of the
cloned 2.1-kbp RT-PCR product (Fig. 3) revealed that it contained the
expected linked regions containing msp2, orf2, orf3, and
orf4. Hence, this genomic site appears to be transcribed
into msp2 mRNA in A. marginale isolated from
infected tick salivary glands, as has been shown previously for
bloodstream stages (4). As in Florida and Idaho strains of
A. marginale, there were multiple copies of the
msp2 gene in Oklahoma strain genomic DNA. Only a single band
was detected, however, when using DNA probes containing
orf2, orf3, and orf4 (Fig.
4). The multiple msp2 copies
were polymorphic between the different strains, and only the
msp2 copy derived from the expression site also contained
contiguous coding sequence for orf2, orf3, and
orf4 (Fig. 4). Therefore, the other msp2 copies
could not be expressed as a polycistronic mRNA containing all 4 open
reading frames without recombination.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 3.
A polycistronic RNA transcript containing the
msp2 gene is present in A. marginale-infected
salivary glands from D. variabilis and D. andersoni ticks. RT-PCR analysis of isolated RNA from infected
salivary glands with AB198 as the RT primer, AB765 and AB766 as primary
PCR primers, and AB192 and AB783 as secondary (nested) PCR primers. A
2.1-kbp product was specifically amplified in reactions containing
reverse transcriptase enzyme (+) but was not present in control
reactions without reverse transcriptase ( ). This 2.1-kbp band
hybridized to an orf2 probe (arrow). Cloning and sequencing
of the 2.1-kbp product demonstrated that it contained sequence from
msp2, orf2, orf3, and orf4.
Low-molecular-weight hybridizing bands are also present in RNA (lanes
labeled +), which may represent amplified products from partially
degraded A. marginale RNA.
|
|

View larger version (87K):
[in this window]
[in a new window]
|
FIG. 4.
Structure of msp2 and orf2 to
orf4 in genomic DNA of Florida, South Idaho, and Oklahoma
strains of A. marginale. Southern blots of Florida (F),
South Idaho (I), Oklahoma acute erythrocyte stage (Oe), or
culture stage (Oc) genomic DNA digested with the
restriction enzyme FspI and hybridized with probes specific
for either msp2, orf2, orf3, or orf4 (probe is
shown at bottom of figure). FspI cleaves 41 nucleotides 5'
to orf4 and 268 nucleotides 3' to msp2 to release
a fragment of 3.76 kbp that contains the complete polycistronic
msp2 expression site sequence (see Fig. 2) from all genomic
DNAs. Molecular size standards (Std) are shown in the left lane of each
blot. Multiple msp2-related sequences are present in genomic
DNA of all strains; only msp2 sequences located in the
expression site are contiguous with orf2, orf3,
and orf4.
|
|
Polymorphism in the msp2 hypervariable region in
cyclically transmitted rickettsiae.
Three to five different
variants were found in each A. marginale population. Some of
these variants were shared between different populations; therefore, a
total of 24 different variants of this msp2 expression site
were identified in the 49 clones examined. The amino acid sequences of
the different MSP2 hypervariable regions found in each life cycle stage
of A. marginale are shown aligned in Fig.
5. They differ from one another by
multiple insertions, deletions, and substitutions, with some sequences
appearing to be "mosaics" of others, e.g., Ok407per2VarC is
identical to Ok407acVarB in the first part of the MSP2 hypervariable
region but identical to Ok407per2VarB in the last part. These
differences among the variants suggest that templated intragenic
recombination may be occurring between the multiple genomic
msp2 copies and the polycistronic expression site.

View larger version (114K):
[in this window]
[in a new window]
|
FIG. 5.
Multiple different msp2 variants are present
in the polycistronic expression site in each population of A. marginale. The major variant type is conserved during passage of
A. marginale between culture, acute erythrocyte stage
infection, and tick salivary glands but is not conserved in persistent
cattle infections. The expression site was amplified by PCR using
primers which annealed 288 bp 3' to the termination codon of
msp2 (AB752) and to the intercistronic sequence between
orf3 and orf4 (AB750) to generate a product of
2.9 kbp from A. marginale genomic DNA that contained
msp2, orf2, and orf3. The PCR product was cloned
in pCR-XL-TOPO vector (Invitrogen), and independent colonies containing
a 2.9-kbp insert were selected for sequencing of cloned plasmid DNA.
The hypervariable region of the msp2 gene was sequenced on
both strands in seven independent clones derived by PCR amplification
from genomic DNA of each of the A. marginale populations
described in Fig. 1. DNA sequences were translated to amino acids, and
the different variant sequences were aligned with PILEUP. The
proportion of each sequence variant in that population is indicated in
brackets; e.g., the major sequence variant detected in cultured
A. marginale was variant A, which was found in three of
seven independent clones of the expression site. Identical amino acids
shared between all variants are indicated by a dash and are shown on
the bottom row of the alignment. Variant types present in different
A. marginale populations are indicated by identical symbols
to the left of the sequence alignments.
|
|
We examined where identical variant sequences were found in the
polycistronic expression site in different
A. marginale
populations
(Fig.
5). A predominant variant found in in vitro-cultured
A. marginale was OkculVarA. The identical MSP2 variant
was also present
in the first (acute) bloodstream rickettsemia of the
animal infected
with these cultures (Ok408acVarA), the ticks that
acquisition
fed during this acute rickettsemia (OksgacVarA), and also
the
first bloodstream rickettsemia of the animal infected by these
ticks (Ok407acVarA). This was the predominant, but not the only
variant
type in each of these
A. marginale populations. Minor
variants were also conserved in the transmission cycle: acute
bloodstream rickettsemia to ticks to acute bloodstream
rickettsemia
(variants Ok408acVarB, OksgacVarB, and Ok407acVarB
are identical).
Despite this conservation of variant types found in the
acute
bovine rickettsemias and in the ticks that fed on them, there
were also minor variants present in an acute rickettsemia not
found
elsewhere. For example Ok408acVarD was quite dissimilar
to the other
three variants in the acute-stage rickettsemia of
animal PA408 and was
not observed again in subsequent
populations.
As the infection progressed in animal PA407 from acute to persistent
relapsing rickettsemias, more diversity was observed
in this
polycistronic
msp2 expression site (Fig.
6). The variants
found were different,
both from those observed in the acute rickettsemias
and from those in
cultured
A. marginale or in the ticks that initiated
the
bovine infections (Fig.
5). This increase in diversity of
the
expression site parallels the increase in diversity of
msp2 mRNA observed previously in persistent infections (
15).
Interestingly,
when ticks acquired infection from a persistent rather
than from
an acute stage of a bovine infection, the variants found in
the
tick salivary glands (Oksgper variants [Fig.
5]) also appeared
similar to the erythrocyte stage variants circulating at the time
of
tick feeding. One of the tick stage variants (OksgperVarB)
was
identical to an erythrocyte stage variant circulating during
tick
acquisition feeding (Ok407per1VarB).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 6.
Msp2 expression site variability increases in
persistent cattle infection. The variability of each population was
calculated over the hypervariable region of the msp2
expression site using the seven independent clones sampled from each of
the seven A. marginale populations in Fig. 1, the sequence
alignment in Fig. 5, and the following formula: number of different
amino acids at a given position/frequency of the most common amino acid
at that position. For example, at position 7 in population okcul there
is H (histidine) in six clones and Y (tyrosine) in one clone of the
msp2 expression site, for a variability of 2/0.857 (=2.3).
Values were obtained similarly for all variable positions in the
alignment and added, to obtain a total population variability for okcul
of 163.8.
|
|
To more closely examine this relationship between the circulating
variants in persistent infection and those acquired and
transmitted by
the tick vector, we performed a second series of
cyclic transmissions.
Since acquisition feeding occurs over 7
days, we sampled the
circulating expression site variants in persistently
infected calf
PA417 before, during, and just after tick feeding,
as well as in tick
salivary glands and the acute transmitted rickettsemia
in calf PA420.
The relationship between the MSP2 hypervariable
region sequences
obtained is shown in the dendrogram in Fig.
7,
with brackets to the right of the
figure indicating identical
variants found in the different rickettsial
populations. The same
circulating variant was observed prior to,
during, and after tick
feeding (ok417-9-13VarA is identical to
ok417-9-20VarG and ok417-9-27VarD)
as well as in the salivary glands of
infected ticks (oksg-VarA)
and in the acute rickettsemia transmitted to
calf PA420 (ok420-VarA).
Five other variant types were also shared
between some, but not
all,
A. marginale populations. These
included variant types shared
in the three samplings of the persistent
infection in PA417 and
also present in tick salivary glands
(ok417-9-13VarC, ok417-9-20VarC,
ok417-9-27VarA, and oksg-VarG), other
variants shared between
circulating bloodstream variants and ticks
(ok417-9-20VarB and
oksg-VarD; ok417-9-27VarG and oksg-VarH), and an
identical circulating
variant in calf PA417 and in the acute
rickettsemia of calf PA420
(ok417-9-20VarA and ok420-VarD).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 7.
Circulating msp2 expression site variants in
persistently infected cattle are those transmitted by ticks to naive
cattle. Ten independent clones of the msp2 expression site
were sampled from each of five different populations of A. marginale. These populations were derived from persistently
infected calf PA417 just prior to tick feeding (ok417-9-13 variants),
during tick feeding (ok417-9-20 variants), and just after tick feeding
(ok417-9-27 variants) and also from salivary glands of D. variabilis that acquired infection from calf PA417 (oksg variants)
and from the acute bloodstream rickettsemia that was transmitted by
those ticks to calf PA420 (ok420 variants). The 50 clones were
sequenced over the hypervariable region, translated to amino acids, and
compared using PILEUP as explained in Fig. 5. The figure is the
dendrogram output from PILEUP that shows the clustering of similar and
identical sequences in the different A. marginale
populations. Brackets to the right identify identical variants in
different A. marginale populations; e.g., variant type
ok417-9-13VarA was found in 50% (5 of 10) of the expression site
clones sampled from calf PA417 prior to tick feeding. Identical variant
types were found in other samplings of calf PA417 during and after tick
feeding, in salivary glands of ticks that acquired infection from calf
PA417, and in the acute rickettsemia that was transmitted to calf
PA420. The asterisk indicates that three of ten expression site clones
from tick salivary gland stages of A. marginale had changes
that would lead to synthesis of truncated MSP2. In two of ten
(oksg-VarB) clones the change was the same base substitution that
introduced a termination codon into the hypervariable region; in
oksg-VarC it was a single base deletion that changed the reading frame
leading to termination shortly after the deletion. We cannot exclude
the possibility that these changes are due to PCR and/or cloning
errors; it is also possible that one result of recombination mechanisms
can be variant types with truncated MSP2.
|
|
It is necessary to evaluate the artifactual contribution to sequence
diversity in the above data that could result from PCR
and sequencing
errors. Previously, it was demonstrated that major
and minor
msp2 hypervariable region sequences observed in genomic
clones of the polycistronic expression site corresponded to those
found
in
msp2 mRNA in the same sample (
4). However,
some sequence
changes could result from PCR-derived mutations. To
assess this
possibility we analyzed
msp2 sequence in the
conserved region
of the polycistronic expression site upstream of the
hypervariable
region. In 15 independent clones of the expression site
from different
A. marginale populations, comparing 239 bp
per clone of upstream
sequence, there were base changes at four
positions. At two of
these positions there was an identical base
substitution in 7
of 15 clones; therefore, this change probably
represents a true
sequence polymorphism. At the other two positions
there was a
base substitution unique to 1 of 15 clones; therefore,
these may
represent artifactual changes. This gives a potential error
rate
of 2 of 3,585 bp or potentially a 1-bp change for every four or
five hypervariable region sequences. This error rate cannot explain
the
extensive base substitutions, insertions, and deletions observed
in the
hypervariable region of the
msp2 expression site in the
different rickettsial populations (Fig.
5).
Similar variants are present in salivary glands of different tick
species acquisition fed on the same bloodstream rickettsemia.
D. andersoni and D. variabilis ticks were allowed
to acquire A. marginale by feeding at the same time on an
acute rickettsemia in calf PA411. The sequence of the msp2
hypervariable region was determined in seven independent clones of the
polycistronic msp2 expression site from salivary gland DNA
isolated from both D. andersoni and D. variabilis. Of the seven expression site clones from D. andersoni, five encoded the same MSP2 hypervariable region sequence and this was identical to a sequence found in two expression site clones from D. variabilis DNA. A second variant
sequence was present in three expression site clones from D. variabilis DNA and also in one clone from D. andersoni
DNA. Two other variant types were unique to D. variabilis,
and one was unique to D. andersoni. These data do not
support any substantial differences in elaboration of msp2
expression site variants in these different tick species.
 |
DISCUSSION |
The sequence data reveal conservation in overall structure of a
polycistronic expression site for the msp2 gene in different strains and life cycle stages of A. marginale. In infections
of both tick cells and mammalian erythrocytes the expression site contains three genes 5' to msp2. DNA containing these three
genes and msp2 is transcribed into a polycistronic RNA in
tick salivary gland and erythrocyte stages and in all strains of
A. marginale examined. msp2 and the three
upstream genes are predicted to encode outer membrane proteins. Unlike
msp2, multiple hybridizing copies of the three upstream
genes are not found in A. marginale genomic DNA. The
sequence of the three upstream genes and 5' and 3' flanking regions are
conserved between different strains and stages, with the exception of
some amino acid substitutions between strains, particularly in the
polypeptide encoded by orf4. Greater polymorphism is found
within the msp2 coding region itself, both between strains and between different stages in the life cycle of a single strain. This
polymorphism is largely confined to a central hypervariable region of
the msp2 gene in the polycistronic site encoding about 100 amino acids. Many variant forms of this hypervariable region exist in
single populations of A. marginale, whether derived from culture, infected tick salivary glands, or infected bovine
erythrocytes. The variant forms differ from one another by multiple
insertions, deletions, and substitutions. Analysis of variant forms
present in populations of A. marginale derived by cyclical
transmission between culture, cattle, and ticks reveals most diversity
in this expression site during persistent infections in the bovine host.
The above data and other published data on variation of MSP2 epitopes
during persistent infection (14, 15) are consistent with
the following hypothetical model for antigenic variation of A. marginale. The complete and incomplete genes encoding MSP2 (4, 23) may be silent until recombined into the
polycistronic expression site containing the three upstream genes and
promoter region. The recombination events introduce gene segments
encoding the MSP2 hypervariable region into the expression site,
probably via gene conversion employing flanking conserved sequences.
This generates complex mosaics of sequence in the expression site which encode epitopes that are exposed on the surface of A. marginale. These epitopes are targeted by T and B cells
(8) which results in the elimination of some variant
types, the selection of other variants, and the sequential peaks of
rickettsemia that are observed in persistent cattle infections
(19). Immune selection based on MSP2 does not operate in
ticks or in naive cattle prior to the first peak of acute rickettsemia.
If there is a constant rate of msp2 recombination affecting
a minority of the A. marginale population at any time, one
may not detect substantial changes in MSP2 variants until there is
immune selection.
Features of this model have similarities to antigenic variation in
other organisms. In African trypanosomes, gene conversion of a
polycistronic expression site by pseudogenes encoding a surface glycoprotein generates new antigenic variants in chronic infections (3, 26). In the family Picomaviridae, a virus
population may consist of a swarm of slightly different individual
genomes, and distinct repertoires of antigenic variants are observed in the presence and absence of immune selection (7). Similar
molecular evasion mechanisms may have evolved in different organisms to allow persistent infections and onward transmission.
It has been proposed that, no matter which bloodstream variants of MSP2
are ingested by the tick, there is reversion to expression of a small
number of specific "tick stage" sequence variants of MSP2 on
transmission (27). These tick stage variants were the major variants present in tick salivary glands and in the first rickettsemia peak of cattle infected with a South Idaho strain of
A. marginale (27). We did not obtain evidence
for reversion in the present study. In contrast, our data are most
consistent with the presence of a large number of different variants in
persistent infections and transmission of the circulating bloodstream
variants through ticks to naive cattle. That more shared variants were not observed in both PA417 and PA420 erythrocyte stage infections as
well as in infected tick salivary glands is probably due to the sample
size, i.e., the sequencing of only 10 independent clones of the
msp2 expression site from each population. Possible
explanations for differences from the results of Rurangirwa et al.
(27) are the use of splenectomized calves in the present
study, expression of tick stage MSP2 variants from a different
expression site, or strain differences in msp2 expression.
The infection of splenectomized calves with the Oklahoma strain results
in microscopically visible relapsing peaks of rickettsemia which are
easily monitored as a source of organisms and DNA. Although the type
and extent of MSP2 expression site diversity between different
bloodstream populations was similar in this study to that observed
previously with spleen-intact calves (4), it is possible
that the diversity of bloodstream variants observed can be influenced
by splenectomy. Arguing against a different locus for MSP2 expression
in the tick are, firstly, RT-PCR data showing that a polycistronic RNA
encoding MSP2 is transcribed from the same genomic locus in A. marginale from tick salivary glands as erythrocyte stages.
Secondly, the tick stage variants SGV1 and SGV2, identified in South
Idaho strain A. marginale (27), utilized the
same polycistronic expression site as described in this study
(4). This suggests a similar mechanism of expression of
tick stage SGV1 and SGV2 variants to other bloodstream variants. In
contrast to their first results, substantial diversity in tick stage
antigenic types was found by Rurangirwa et al. using two other strains
of A. marginale (28). They suggested that there may be strain-specific selection for certain MSP2 variants in ticks. It
is possible that we did not find restriction of MSP2 variants because
the progenitor population of A. marginale (okcul) was
already selected by growth in tick cell culture.
It is unlikely that a vaccine could be developed based on MSP2 variants
present in tick salivary glands and conserved in the first rickettsemia
peak as was initially proposed (27). Our analysis of
salivary gland stages and acute bloodstream rickettsemias within a
single strain of A. marginale identified numerous sequence variants in this polycistronic expression site. There is some basis for
development of "region-specific" vaccines, as variants of one
strain tended to group together in multiple alignment profiles (data
not shown). This perhaps relates to observations made with different
anaplasmosis vaccines that have been tested against field challenge,
with less protection generally afforded to animals by immunization with
geographically heterologous strains of A. marginale
(22). Any optimism in this regard must be counterbalanced by consideration of the >20 msp2 expression site variants
found (Fig. 5) in a few transmissions with one strain. A greater
possibility for vaccine development may be to identify exposed T- and
B-cell epitopes on other outer membrane proteins. Those epitopes
encoded by the more conserved orf234 represent potential
vaccine targets.
In conclusion, analysis of a polycistronic msp2 expression
site in A. marginale from culture, tick salivary glands, and
acutely or persistently infected cattle reveals sequence conservation between these stages of the Oklahoma strain throughout most of this
expression site, including 5' and 3' flanking regions. The exception is
in the expression site region encoding the central hypervariable region
of MSP2. This region of the expression site is very polymorphic within
individual populations of A. marginale. Although
polymorphic, the major sequence variants present did not change on
passage of A. marginale between culture, acute-stage erythrocyte infections, and tick salivary glands but did change during
persistent infections of the bovine host. The sequence variants found
in tick salivary glands most closely resembled those present in the
blood at the time of acquisition of infection, whether infection was
acquired from an animal with an acute or a persistent rickettsemia.
These variations in structure of an expression site for a major,
immunoprotective outer membrane protein have important implications for
vaccine development against A. marginale and related
ehrlichial pathogens. The data on msp2 variation suggest an
unusual flexibility in the small 1.2-Mb genome (1) that
may be employed in adaptation to and persistence in different host environments.
 |
ACKNOWLEDGMENTS |
This investigation was supported by USDA grant 9802528, National
Institutes of Health grant AI45580, project 1669 of the Oklahoma Agriculture Experiment Station, and the endowed chair in Food Animal
Research, College of Veterinary Medicine (K. M. Kocan).
We thank J. D. De La Fuente for helpful discussions.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pathobiology, College of Veterinary Medicine, P.O. Box 110880, Gainesville, FL 32611-0880. Phone: (352) 392-4700, ext. 5819. Fax:
(352) 392-9704. E-mail: barbeta{at}mail.vetmed.ufl.edu.
Editor:
J. M. Mansfield
 |
REFERENCES |
| 1.
|
Alleman, A. R.,
S. M. Kamper,
N. Viseshakul, and A. F. Barbet.
1993.
Analysis of the Anaplasma marginale genome by pulsed-field electrophoresis.
J. Gen. Microbiol.
139:2439-2444[Abstract/Free Full Text].
|
| 2.
|
Andrew, H. R., and R. A. Norval.
1989.
The carrier status of sheep, cattle and African buffalo recovered from heartwater.
Vet. Parasitol.
34:261-266[CrossRef][Medline].
|
| 3.
|
Barbet, A. F., and S. M. Kamper.
1993.
The importance of mosaic genes to trypanosome survival.
Parasitol. Today
9:63-66[CrossRef][Medline].
|
| 4.
|
Barbet, A. F.,
A. Lundgren,
J. Yi,
F. R. Rurangirwa, and G. H. Palmer.
2000.
Antigenic variation of Anaplasma marginale by expression of MSP2 mosaics.
Infect. Immun.
68:6133-6138[Abstract/Free Full Text].
|
| 5.
|
Barbet, A. F.,
G. H. Palmer,
P. J. Myler, and T. C. McGuire.
1987.
Characterization of an immunoprotective protein complex of Anaplasma marginale by cloning and expression of the gene coding for polypeptide Am105L.
Infect. Immun.
55:2428-2435[Abstract/Free Full Text].
|
| 6.
|
Blouin, E. F.,
A. F. Barbet,
J. Yi,
K. M. Kocan, and J. T. Saliki.
2000.
Establishment and characterization of an Oklahoma isolate of Anaplasma marginale in cultured Ixodes scapularis cells.
Vet. Parasitol.
87:301-313[CrossRef][Medline].
|
| 7.
|
Borrego, B.,
I. S. Novella,
E. Giralt,
D. Andreu, and E. Domingo.
1993.
Distinct repertoire of antigenic variants of foot-and-mouth disease virus in the presence or absence of immune selection.
J. Virol.
67:6071-6079[Abstract/Free Full Text].
|
| 8.
|
Brown, W. C.,
D. Zhu,
V. Shkap,
T. C. McGuire,
E. F. Blouin,
K. M. Kocan, and G. H. Palmer.
1998.
The repertoire of Anaplasma marginale antigens recognized by CD4+ T-lymphocyte clones from protectively immunized cattle is diverse and includes major surface protein 2 (MSP-2) and MSP-3.
Infect. Immun.
66:5414-5422[Abstract/Free Full Text].
|
| 9.
|
Dumler, J. S., and J. S. Bakken.
1998.
Human ehrlichioses: newly recognized infections transmitted by ticks.
Annu. Rev. Med.
49:201-213[CrossRef][Medline].
|
| 10.
|
Dumler, J. S.,
W. L. Sutker, and D. H. Walker.
1993.
Persistent infection with Ehrlichia chaffeensis.
Clin. Infect. Dis.
17:903-905[Medline].
|
| 11.
|
Egenvall, A.,
I. Lilliehook,
A. Bjoersdorff,
E. O. Engvall,
E. Karlstam,
K. Artursson,
M. Heldtander, and A. Gunnarsson.
2000.
Detection of granulocytic Ehrlichia species DNA by PCR in persistently infected dogs.
Vet. Rec.
146:186-190[Abstract/Free Full Text].
|
| 12.
|
Eid, G.,
D. M. French,
A. M. Lundgren,
A. F. Barbet,
T. F. McElwain, and G. H. Palmer.
1996.
Expression of major surface protein 2 antigenic variants during acute Anaplasma marginale rickettsemia.
Infect. Immun.
64:836-841[Abstract].
|
| 13.
|
Eriks, I. S.,
D. Stiller, and G. H. Palmer.
1993.
Impact of persistent Anaplasma marginale rickettsemia on tick infection and transmission.
J. Clin. Microbiol.
31:2091-2096[Abstract/Free Full Text].
|
| 14.
|
French, D. M.,
W. C. Brown, and G. H. Palmer.
1999.
Emergence of Anaplasma marginale antigenic variants during persistent rickettsemia.
Infect. Immun.
67:5834-5840[Abstract/Free Full Text].
|
| 15.
|
French, D. M.,
T. F. McElwain,
T. C. McGuire, and G. H. Palmer.
1998.
Expression of Anaplasma marginale major surface protein 2 variants during persistent cyclic rickettsemia.
Infect. Immun.
66:1200-1207[Abstract/Free Full Text]. (Erratum 66:2400.)
|
| 16.
|
Harrus, S.,
T. Waner,
I. Aizenberg,
J. E. Foley,
A. M. Poland, and H. Bark.
1998.
Amplification of ehrlichial DNA from dogs 34 months after infection with Ehrlichia canis.
J. Clin. Microbiol.
36:73-76[Abstract/Free Full Text].
|
| 17.
|
Iqbal, Z., and Y. Rikihisa.
1994.
Reisolation of Ehrlichia canis from blood and tissues of dogs after doxycycline treatment.
J. Clin. Microbiol.
32:1644-1649[Abstract/Free Full Text].
|
| 18.
|
Kabat, E. A., and T. T. Wu.
1971.
Attempts to locate complementarity-determining residues in the variable positions of light and heavy chains.
Ann. N. Y. Acad. Sci.
190:382-393[Medline].
|
| 19.
|
Kieser, S. T.,
I. S. Eriks, and G. H. Palmer.
1990.
Cyclic rickettsemia during persistent Anaplasma marginale infection of cattle.
Infect. Immun.
58:1117-1119[Abstract/Free Full Text].
|
| 20.
|
McCallon, B. R.
1973.
Prevalence and economic aspects of anaplasmosis, p. 1-3.
In
E. W. Jones (ed.), Proceedings of the 6th National Anaplasmosis Conference. Heritage Press, Stillwater, Okla.
|
| 21.
|
Munderloh, U. G.,
E. F. Blouin,
K. M. Kocan,
N. L. Ge,
W. L. Edwards, and T. J. Kurtti.
1996.
Establishment of the tick (Acari:Ixodidae)-borne cattle pathogen Anaplasma marginale (Rickettsiales:Anaplasmataceae) in tick cell culture.
J. Med. Entomol.
33:656-664[Medline].
|
| 22.
|
Palmer, G. H.
1989.
Anaplasma vaccines, p. 1-29.
In
I. G. Wright (ed.), Veterinary protozoan and hemoparasite vaccines. CRC Press, Boca Raton, Fla.
|
| 23.
|
Palmer, G. H.,
G. Eid,
A. F. Barbet,
T. C. McGuire, and T. F. McElwain.
1994.
The immunoprotective Anaplasma marginale major surface protein 2 is encoded by a polymorphic multigene family.
Infect. Immun.
62:3808-3816[Abstract/Free Full Text].
|
| 24.
|
Palmer, G. H.,
S. M. Oberle,
A. F. Barbet,
W. L. Goff,
W. C. Davis, and T. C. McGuire.
1988.
Immunization of cattle with a 36-kilodalton surface protein induces protection against homologous and heterologous Anaplasma marginale challenge.
Infect. Immun.
56:1526-1531[Abstract/Free Full Text].
|
| 25.
|
Palmer, G. H.,
F. R. Rurangirwa,
K. M. Kocan, and W. C. Brown.
1999.
Molecular basis for vaccine development against the ehrlichial pathogen Anaplasma marginale.
Parasitol. Today
15:281-286[CrossRef][Medline].
|
| 26.
|
Roth, C.,
F. Bringaud,
R. Layden,
T. Baltz, and H. Eisen.
1989.
Active late-appearing variable surface antigen genes in Trypanosoma equiperdum are constructed entirely from pseudogenes.
Proc. Natl. Acad. Sci.
86:9375-9379[Abstract/Free Full Text].
|
| 27.
|
Rurangirwa, F. R.,
D. Stiller,
D. M. French, and G. H. Palmer.
1999.
Restriction of major surface protein 2 (MSP2) variants during tick transmission of the ehrlichia Anaplasma marginale.
Proc. Natl. Acad. Sci. USA
96:3171-3176[Abstract/Free Full Text].
|
| 28.
|
Rurangirwa, F. R.,
D. Stiller, and G. H. Palmer.
2000.
Strain diversity in major surface protein 2 expression during tick transmission of Anaplasma marginale.
Infect. Immun.
68:3023-3027[Abstract/Free Full Text].
|
| 29.
|
Telford, S. R., and J. E. Dawson.
1996.
Persistent infection of C3H/HeJ mice by Ehrlichia chaffeensis.
Vet. Microbiol.
52:103-112[CrossRef][Medline].
|
Infection and Immunity, May 2001, p. 3057-3066, Vol. 69, No. 5
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.5.3057-3066.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Palmer, G. H., Futse, J. E., Leverich, C. K., Knowles, D. P. Jr., Rurangirwa, F. R., Brayton, K. A.
(2007). Selection for Simple Major Surface Protein 2 Variants during Anaplasma marginale Transmission to Immunologically Naive Animals. Infect. Immun.
75: 1502-1506
[Abstract]
[Full Text]
-
Barbet, A. F., Lundgren, A. M., Alleman, A. R., Stuen, S., Bjoersdorff, A., Brown, R. N., Drazenovich, N. L., Foley, J. E.
(2006). Structure of the Expression Site Reveals Global Diversity in MSP2 (P44) Variants in Anaplasma phagocytophilum. Infect. Immun.
74: 6429-6437
[Abstract]
[Full Text]
-
Noh, S. M., Brayton, K. A., Knowles, D. P., Agnes, J. T., Dark, M. J., Brown, W. C., Baszler, T. V., Palmer, G. H.
(2006). Differential Expression and Sequence Conservation of the Anaplasma marginale msp2 Gene Superfamily Outer Membrane Proteins.. Infect. Immun.
74: 3471-3479
[Abstract]
[Full Text]
-
Lin, Q., Rikihisa, Y.
(2005). Establishment of Cloned Anaplasma phagocytophilum and Analysis of p44 Gene Conversion within an Infected Horse and Infected SCID Mice. Infect. Immun.
73: 5106-5114
[Abstract]
[Full Text]
-
Kocan, K. M., de la Fuente, J., Guglielmone, A. A., Melendez, R. D.
(2003). Antigens and Alternatives for Control of Anaplasma marginale Infection in Cattle. Clin. Microbiol. Rev.
16: 698-712
[Abstract]
[Full Text]
-
Ohnishi, J., Schneider, B., Messer, W. B., Piesman, J., de Silva, A. M.
(2003). Genetic Variation at the vlsE Locus of Borrelia burgdorferi within Ticks and Mice over the Course of a Single Transmission Cycle. J. Bacteriol.
185: 4432-4441
[Abstract]
[Full Text]
-
Park, J., Choi, K. S., Dumler, J. S.
(2003). Major Surface Protein 2 of Anaplasma phagocytophilum Facilitates Adherence to Granulocytes. Infect. Immun.
71: 4018-4025
[Abstract]
[Full Text]
-
Lohr, C. V., Brayton, K. A., Shkap, V., Molad, T., Barbet, A. F., Brown, W. C., Palmer, G. H.
(2002). Expression of Anaplasma marginale Major Surface Protein 2 Operon-Associated Proteins during Mammalian and Arthropod Infection. Infect. Immun.
70: 6005-6012
[Abstract]
[Full Text]
-
Brown, W. C., McGuire, T. C., Mwangi, W., Kegerreis, K. A., Macmillan, H., Lewin, H. A., Palmer, G. H.
(2002). Major Histocompatibility Complex Class II DR-Restricted Memory CD4+ T Lymphocytes Recognize Conserved Immunodominant Epitopes of Anaplasma marginale Major Surface Protein 1a. Infect. Immun.
70: 5521-5532
[Abstract]
[Full Text]
-
Lin, Q., Zhi, N., Ohashi, N., Horowitz, H. W., Aguero-Rosenfeld, M. E., Raffalli, J., Wormser, G. P., Rikihisa, Y.
(2002). Analysis of Sequences and Loci of p44 Homologs Expressed by Anaplasma phagocytophila in Acutely Infected Patients. J. Clin. Microbiol.
40: 2981-2988
[Abstract]
[Full Text]
-
de la Fuente, J., Garcia-Garcia, J. C., Blouin, E. F., Saliki, J. T., Kocan, K. M.
(2002). Infection of Tick Cells and Bovine Erythrocytes with One Genotype of the Intracellular Ehrlichia Anaplasma marginale Excludes Infection with Other Genotypes. CVI
9: 658-668
[Abstract]
[Full Text]
-
Zhi, N., Ohashi, N., Tajima, T., Mott, J., Stich, R. W., Grover, D., Telford III, S. R., Lin, Q., Rikihisa, Y.
(2002). Transcript Heterogeneity of the p44 Multigene Family in a Human Granulocytic Ehrlichiosis Agent Transmitted by Ticks. Infect. Immun.
70: 1175-1184
[Abstract]
[Full Text]
-
Caspersen, K., Park, J.-H., Patil, S., Dumler, J. S.
(2002). Genetic Variability and Stability of Anaplasma phagocytophila msp2 (p44). Infect. Immun.
70: 1230-1234
[Abstract]
[Full Text]
-
Lohr, C. V., Rurangirwa, F. R., McElwain, T. F., Stiller, D., Palmer, G. H.
(2002). Specific Expression of Anaplasma marginale Major Surface Protein 2 Salivary Gland Variants Occurs in the Midgut and Is an Early Event during Tick Transmission. Infect. Immun.
70: 114-120
[Abstract]
[Full Text]
-
de la Fuente, J., Kocan, K. M.
(2001). Expression of Anaplasma marginale Major Surface Protein 2 Variants in Persistently Infected Ticks. Infect. Immun.
69: 5151-5156
[Abstract]
[Full Text]