Previous Article | Next Article 
Infection and Immunity, May 2001, p. 3150-3158, Vol. 69, No. 5
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.5.3150-3158.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Attenuated Shigella flexneri 2a
guaBA Strain CVD 1204 Expressing Enterotoxigenic
Escherichia coli (ETEC) CS2 and CS3 Fimbriae as a Live
Mucosal Vaccine against Shigella and ETEC
Infection
Zeev
Altboum,
Eileen M.
Barry,*
Genevieve
Losonsky,
James E.
Galen, and
Myron
M.
Levine
Center for Vaccine Development, University of
Maryland School of Medicine, Baltimore, Maryland 21201
Received 20 October 2000/Returned for modification 21 November
2000/Accepted 21 February 2001
 |
ABSTRACT |
To construct a prototype hybrid vaccine against
Shigella and enterotoxigenic Escherichia coli
(ETEC), the genes encoding the production of ETEC CS2 and CS3 fimbriae
were isolated and expressed in attenuated Shigella flexneri
2a guaBA strain CVD 1204. The CS2 cotA to
-D genes, isolated from ETEC strain C91F, and the CS3
cstA to -H genes, subcloned from plasmid
pCS100, were cloned into ~15-copy-number-stabilized pGA1 behind the
osmotically regulated ompC promoter, resulting in high
expression of both fimbriae. Under nonselective in vitro growth
conditions, pGA1-CS2 and pGA1-CS3 were stable in CVD 1204, exhibiting a
plasmid loss of only approximately 1% per duplication. Expression of
CS2 and CS3 reduced the invasiveness of Shigella for HeLa
cells and slowed the intracellular growth rate. Guinea pigs immunized
intranasally with CVD 1204(pGA1-CS2) or CVD 1204(pGA1-CS3), or with a
mixture of these strains, developed secretory immunoglobulin A (IgA) in
tears and serum IgG antibodies against Shigella
lipopolysaccharide, CS2, and CS3 antigens. Moreover, the animals were
protected against keratoconjunctivitis following conjunctival challenge
with virulent S. flexneri 2a strain 2457T. Animals
immunized with Shigella expressing CS2 or CS3 developed serum antibodies that agglutinated Shigella as well as an
ETEC strain bearing the homologous fimbriae, whereas animals immunized with combined CVD 1204(pGA1-CS2) and CVD 1204(pGA1-CS3) developed antibodies that agglutinated all three test strains. These observations support the feasibility of a multivalent vaccine against shigellosis and ETEC diarrhea consisting of multiple Shigella live
vectors expressing relevant ETEC antigens.
 |
INTRODUCTION |
Two bacterial enteric pathogens that
have been identified by the World Health Organization as constituting
important targets for the development of vaccines are enterotoxigenic
Escherichia coli (ETEC) and Shigella (35,
38). In developing countries, ETEC is a major cause of diarrheal
dehydration in infants (4), whereas Shigella is
the main agent of bacillary dysentery in young children
(35). Both pathogens contribute in a major way to the mortality burden attributable to enteric pathogens (4,
35). ETEC is also the most frequent etiologic agent associated
with traveler's diarrhea (3, 14, 29, 51), whereas in many studies Shigella is often the second most incriminated
pathogen (14, 29). Traveler's diarrhea caused by
Shigella tends to be clinically more severe and debilitating
than that caused by ETEC. Both ETEC and Shigella are deemed
to be worthy targets for immunoprophylaxis of travelers from
industrialized countries who visit developing regions of the world
(45).
Among the promising candidate vaccines against Shigella are
parenteral O polysaccharide-carrier protein conjugates (7, 8), intranasally administered proteosomes consisting of outer membrane protein vesicles of group B Neisseria meningitidis
to which Shigella lipopolysaccharide is noncovalently bound
(47, 48), and attenuated strains of Shigella
used as live oral vaccines (9, 34). Within the four
Shigella species (also referred to as groups), 39 main
serotypes and subtypes are recognized (15, 35), and
epidemiologic and experimental observations indicate that immunity is
group-specific and, in many instances, serotype-specific (21,
22). Consequently, initial success with prototype vaccines will
have to be followed by the development of a final vaccine formulation
that incorporates a strategy for conferring broad-spectrum protection
against the epidemiologically most important Shigella serotypes (35, 53).
In recent years, candidate human vaccines against ETEC have been
prepared that are based on stimulating intestinal antibodies against
the colonization factor fimbriae by which ETEC attaches to enterocytes
and on stimulating antitoxin to neutralize heat-labile enterotoxin (LT)
(1, 19, 41, 43, 61, 66, 67). Antigens to stimulate
anticolonization immunity have included inactivated fimbriated ETEC
whole bacteria (1, 16, 19, 60), purified ETEC fimbriae
administered in native form (18, 43) or contained within
polylactide-polyglycolide microspheres (67), and live oral
vaccines consisting of either fimbriated nontoxigenic ETEC strains
(36, 37) or of attenuated Shigella or
Salmonella enterica serovars Typhi or Typhimurium live
vectors expressing ETEC fimbriae and mutant LT or the LT B subunit
(26, 31, 42, 54, 55). ETEC vaccines must also address the
considerable antigenic heterogeneity among ETEC strains that cause
human diarrheal disease (24, 39, 42). It is widely agreed
that an ETEC vaccine should include colonization factor antigen I
(CFA/I) and coli surface antigens 1 to 6 (CS1 to CS6) fimbrial antigens
(42). The candidate ETEC vaccine that is furthest along in
clinical trials consists of an oral formulation containing a mixture of
inactivated, fimbriated ETEC strains that express CFA/I and CS1-6,
coadministered in combination with the cholera toxin B subunit (CT-BS)
(60, 61). CT and CT-BS elicit cross-reacting antibodies
that can neutralize the LT variant found in ETEC strains in humans
(LTh) (46, 65); CT-BS, by itself, has conferred short-term
protection (for several months) against diarrhea caused by LT-producing
ETEC (6, 56).
We have embarked on a long-term project to develop a multivalent hybrid
vaccine to prevent both Shigella dysentery and ETEC diarrhea
caused by the epidemiologically most important serotypes and antigenic
types (34, 39, 53). The approach consists of engineering
five attenuated Shigella strains (representing five
epidemiologically and immunologically critical serotypes), each
expressing two separate ETEC fimbrial antigens and an antigen to elicit
antibodies against LTh (31, 39, 55). Towards this goal, we
have prepared improved Shigella vaccine candidates by introducing a deletion mutation in the guaBA operon (which
encodes two enzymes involved in the synthesis of guanine nucleotides) in wild-type S. flexneri 2a, resulting in vaccine strain CVD
1204 as a basis of further derivatives (34, 54). This
serotype is used as a model because of its epidemiologic importance,
the presence in its chromosome of a pathogenicity island that includes Shigella enterotoxin 1 (20, 52), and extensive
experience with this serotype in experimental challenge studies in
volunteers (11-13, 32, 33). The effect of introducing
additional attenuating mutations into CVD 1204, such as deletions in
virG (also referred to as icsA, encoding a
protein involved with intracellular and intercellular spread of
Shigella), resulting in CVD 1205 (54), and in
the genes encoding Shigella enterotoxins 1 and 2 (
set1A,
sen), resulting in CVD 1207, have
been evaluated (34).
We have previously reported cloning the genes necessary for the
expression of CFA/I by CVD 1204 and the ability of that live vector to
elicit both anti-S. flexneri 2a and anti-CFA/I antibodies (31). The research reported herein describes the
expression of rigid CS2 fimbriae and flexible CS3 fibrillae by
attenuated S. flexneri 2a strain CVD 1204; an estimation of
the stability of the expression plasmids in CVD 1204; the suitability
of the osmolarity-activated ompC promoter in promoting
fimbrial expression; the ability of the live vector to elicit
antibodies to each fimbrial antigen individually and to both fimbriae
simultaneously, in addition to S. flexneri O antigen; and,
finally, a demonstration that expression of ETEC fimbriae by the live
vector does not diminish its ability to protect against virulent
S. flexneri 2a in a challenge model.
 |
MATERIALS AND METHODS |
Strains and medium.
The following strains were used in this
work: wild-type S. flexneri 2a 2457T, originally isolated
from a patient in Japan (11); CVD 1204
guaBA, a guanine-dependent strain derived from S. flexneri 2a strain 2457T by targeting a specific deletion that inactivates the purine metabolic pathway enzymes IMP dehydrogenase and
GMP synthetase (54); S. flexneri 2a CVD
1204(pGA1), which contains the expression vector pGA1 (this work), and
S. flexneri 2a CVD 1204(pGA1-CS2), expressing ETEC CS2
fimbriae (this work); S. flexneri 2a CVD 1204(pGA1-CS3)
expressing ETEC CS3 fibrillae (this work); ETEC strain C91f
(O6:K15:H16, biotype C), isolated from a patient with diarrhea in
Ethiopia (2), was used for isolation of the CS2-encoding
genes (23); and ETEC E9034A (O8:H9), a CS3-producing
strain (44). E. coli DH5
was the host strain for plasmid constructions. E. coli HS (O9:H4), a
nonpathogenic smooth human commensal organism, was used as a control
strain in the immunization of guinea pigs (40).
Shigella strains were grown on Trypticase soy agar (TSA)
supplemented with 0.1% Congo red dye (Sigma Chemical Co., St. Louis,
Mo.) and guanine (10 µg/ml). For expression of CS antigens, the ETEC
strains were grown on CFA agar plates (17). Luria-Bertani
(LB) broth and LB agar containing 50 µg of carbenicillin (Sigma
Chemical Co.) per ml were used for cloning and plasmid amplification in
E. coli DH5
. To induce fimbria formation in
Shigella, the strains were grown in TS broth (Tryptone, 1.5%; Soytone, 0.5%) supplemented with NaCl at different concentrations.
Plasmid constructions.
Synthesis of the 7-nm-diameter
rod-like CS2 fimbriae requires four contiguous chromosomal genes,
cotB, cotA, cotC, and cotD, which encode the
structural and assembly proteins as deduced by homology to CooD and
CfaE (5, 23). CotA is the 16.5-kDa major fimbrial subunit
protein (63). CotD is a minor fimbrial protein of 38.9 kDa
found at the fimbrial tip. In CS1 and CFA/I fimbriae, the tip proteins
encoded by cooD and cfaE, respectively, are
essential for fimbria-mediated hemagglutination and for adherence of
ETEC to intestinal cells (58). CotB (24.8 kDa) and CotC
(94.6 kDa) proteins are responsible for the assembly of the fimbriae on
the cell surface. By homology to CS1, CotB is a periplasmic protein that manifests chaperone-like activity that may prevent the misfolding and degradation of the synthesized fimbrial proteins. The CotC outer
membrane protein is believed to be involved in secretion of the
fimbrial proteins from the periplasm across the outer membrane (59).
CS3, which is encoded by the cstA to -H gene
cluster, is a thin, flexible, wiry thread, 2 nm in diameter. CstH, the
major fimbrial protein, is produced as a 17.5-kDa precursor
(69). Removal of either 15 or 22 N-terminal amino acids
results in two proteins of 15.5 and 14.5 kDa (44). The
remaining genes, cstA to -G, encode the assembly
cassette: cstA encodes a 27-kDa protein with homology to the
fimbrial chaperones; cstB encodes a 104-kDa protein that is
homologous to the outer membrane usher proteins (30, 49,
69).
The genes encoding CS2 and CS3 were cloned in pGA1 (Fig.
1A), which was derived from pGEN91
(25) by replacing gfp with an 84-bp synthetic
DNA fragment that contains multiple cloning sites (MCS) for
BssHI, KpnI, PstI, EcoRV,
HindIII, SalI, EagI,
BamHI, BglII, SphI, XhoI,
and NheI. The linker was synthesized by overlapping PCR
using the following four primers: ZA3,
GGGTCGCGAGCGCGCGGTACCCTGCAGGATATCAAGCTTGTCGACCGGCCGGGATCCAGATCTGCATGCC; ZA4,
CCCGCTAGCCTCGAGGCATGCAGATCTGGATCCCGGCCGGTCGACAAGCTTGATATCCTGCAGGGTACCG; ZA5, GGGTCGCGAGCGCGCGGTACC; and ZA6,
CCCGCTAGCCTCGAGGCATGC. The PCR fragment was cleaved with
NruI and NheI enzymes and ligated to pGEN91 that
was digested with EcoRV/NheI to construct plasmid pGA1.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 1.
Maps of CS2 and CS3 fimbria-expressing plasmids. (A) Map
of the cloning vector pGA1, derived from pGEN91 by replacing
gfp with a synthetic linker containing multiple cloning
sites. (B) Map of pGA1-CS2, constructed by cloning 5,696 bp of the CS2
operon into pGA1. (C) Map of pGA1-CS3, constructed by cloning 4,746 bp
of the CS3 operon into pGA1.
|
|
The plasmid contains the ori15A region (which maintains the
copy number at approximately 15 per cell), an osmotically regulated ompC promoter that is located 40 bp upstream of the MCS, two
transcription termination sites (trpA and T1, which are
located immediately and 665 bp downstream of the MCS, respectively),
and bla, which encodes
-lactamase production and
carbenicillin resistance.
Cloning of CS2 operon.
The chromosomal CS2 operon consists
of four genes, cotA to -D (23).
Based on analysis of the DNA sequence (NCBI accession number Z47800),
the total genomic DNA of strain C91f was digested with the restriction
enzymes PstI (a site located 422 bp upstream of the ATG
codon in CotA) and EcoRV (a site 150 bp downstream of the
stop codon for CotD). DNA fragments between 5 and 8 kb were gel
purified and cloned in pBluescript KS (Stratagene, La Jolla, Calif.).
DH5
transformants were picked into 96-well microtiter plates, and
pools of colonies were analyzed by PCR by using specific DNA primers
that amplified a DNA fragment of 1,333 bp from the CS2 operon. The
primers used were CS2a, 5'-CACTGTAACTGCTAGC GTTGATCCAAC-3', and the reverse primer CS2b, 5'-ATCGGGTTAAC
ATAACGGTTACTGGCGATG-3'. Individual colonies from positive pools
were further analyzed by PCR. Approximately 2% of 900 screened
colonies were positive in the PCR assay and were further analyzed for
fimbria production by agglutination tests using rabbit antiserum
against purified CS2 fimbriae. The genes encoding CS2 were further
subcloned as an EcoRV/PstI fragment into pGA1 to
generate the 8,587-bp CS2 fimbria-expressing plasmid pGA1-CS2 (Fig.
1B).
Cloning of CS3 operon.
The genes encoding CS3
(cstA to -H) were isolated from pCS100 as a
4,746-bp HindIII fragment (26, 55) and
cloned in pGA1, resulting in the 7,628-bp pGA1-CS3 (Fig. 1C).
Expression of CS3 fibrillae in DH5
transformants was confirmed by
bacterial agglutination using rabbit antiserum against purified CS3
(44).
Transformation of Shigella strains.
Electroporation of competent S. flexneri 2a strain CVD 1204 was accomplished by growing the bacteria in L broth supplemented with
guanine to an optical density at 600 nm (OD600) of 0.6. The cells were precipitated, washed twice with cold H2O and
once with cold 10% glycerol, and resuspended to 1/100 of the original
volume. A mixture containing 150 µl of bacteria plus plasmid DNA was
electroporated in 0.2-cm cuvettes in a Gene Pulser (Bio-Rad
Laboratories, Hercules, Calif.) using 2.5 kV, 200
, and 25 µF.
Transformants were selected on TSA plates supplemented with
carbenicillin, guanine, and Congo red.
Plasmid stability tests.
CVD 1204 strains that express ETEC
CS2 or CS3 fimbriae were grown for 24 h in LB broth plus guanine.
Ten-fold dilutions of the bacterial cultures were plated on LB guanine
plates, and after 24 h single colonies were replica plated on LB
guanine agar plates with and without carbenicillin. Colonies that
failed to grow on the antibiotic-containing plates were scored for loss
of the plasmid.
Detection of fimbrial synthesis.
CVD 1204 strains that
expressed CS2 or CS3 were cultured in TS broth containing 0, 50, 150, or 300 mM NaCl until the logarithmic phase of growth. The bacteria were
assayed for fimbria production by either dot immunoassays (DIAs) of
whole bacteria or by immunoblotting of cell extracts. For the DIAs, the
bacterial cultures were serially diluted in phosphate-buffered saline
(PBS); 5 µl of each dilution was spotted on a 0.45-µm
nitrocellulose filter (Micron Separations Inc., Westboro, Mass.) and
blocked with PBS containing 2% bovine serum albumin and 0.05% Tween
20. After washing in PBS-Tween buffer, rabbit anti-CS2 or anti-CS3 was
added to the blocking buffer for 60 min at room temperature. After five
washings, the second antibody, goat anti-rabbit immunoglobulin G (IgG)
labeled with alkaline phosphatase (Gibco BRL, Grand Island, N.Y.), was
added for 30 min. After five washings, the positive dots were detected
with phosphatase substrate (Kirkegaard & Perry Laboratories,
Gaithersburg, Md.) reagent. The highest dilution with a positive signal
was determined. For immunoblotting experiments, the bacterial cultures were adjusted to an OD600 of 10 and boiled for 10 min in
Laemmli sample buffer (Bio-Rad). The cell extract proteins were
separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(15%), transferred to nitrocellulose (MSI) or 0.2 µm polyvinylidene
fluoride (Bio-Rad) filters, and probed with rabbit antiserum against
purified CS2 or CS3 fimbriae. The protein bands on the polyvinylidene
fluoride membrane were developed by adding chemiluminescent substrate
(Immun-Star; Bio-Rad) and exposing the filter to X-ray film.
Invasion assays.
HeLa cells (~2 × 105
cells/ml) in 24-well plates were inoculated with ~107
bacteria grown on TSA-Congo red-guanine plates. The infected cells were
incubated for 90 min in antibiotic-free Dulbecco's modified Eagle's
medium containing guanine and 10% calf serum, washed with Hanks
balanced salt solution buffer containing 100 µg of gentamicin (Gibco
BRL) per ml, and incubated in Dulbecco's modified Eagle's medium
containing gentamicin for 30 min (time zero) or 4 h. At 30 min or
4 h, the infected cells were washed with Hanks balanced salt
buffer and lysed with PBS containing Triton X-100 (0.5%), and the free
bacteria were plated on TSA plates containing Congo red, guanine, and carbenicillin.
Immunization.
Guinea pigs anesthetized subcutaneously with
ketamine HCl (40 mg/kg of body weight) and xylazine (5 mg/kg) were
inoculated intranasally on days 1 and 15 with ~2 × 109 bacteria that were grown on TSA-Congo red-guanine
plates and harvested in PBS. Five groups of animals were inoculated:
group 1 was immunized with CVD 1204; group 2 received CVD
1204(pGA1-CS3); group 3 received CVD 1204(pGA1-CS2); group 4 received a
mixture of CVD 1204(pGA1-CS3) plus CVD 1204(pGA1-CS2); and group 5, serving as a placebo control, received 2 × 1010 CFU
of E. coli HS. Groups 1 to 4 contained 5 animals each,
whereas group 5 had 15 guinea pigs. Sera were obtained on days 0, 14, and 30 by anterior vena cava puncture of anesthetized animals. Tears
were collected on the same days by lacrimal stimulation with flakes of
Capsicum bacatum, as described previously (54).
Protective efficacy.
In order to assess the protective
efficacy of immunization with CVD 1204 expressing CS2 or CS3, or of
immunization with a mixture of both live vector constructs, in
preventing Shigella keratoconjunctivitis, the "Sereny"
test was performed (62). Control animals were immunized
with E. coli HS. The guinea pigs were challenged 21 days
following the second dose with 10 µl containing 108 CFU
of wild-type S. flexneri 2a 2457T in the conjunctival sac. The animals were examined daily for 4 days, and their inflammatory responses were graded as follows: 0 = normal eye indistinguishable from the contralateral nonchallenged eye; 1 = lacrimation or
eyelid edema; 2 = 1 plus mild conjuctival hyperemia; 3 = 2 plus slight exudate; and 4 = full purulent keratoconjuctivitis
(54).
Antibodies.
The sera and tears from immunized animals were
assayed for antibodies by serum agglutination using Shigella
and ETEC strains and by enzyme-linked immunosorbent assay using
purified Shigella lipopolysaccharide (LPS) and CS2 and CS3
fimbriae as antigens. Secretory IgA (sIgA) antibodies were determined
in guinea pig tears using rabbit anti-guinea pig IgA
chain-specific
antibody (Bethyl Lab., Montgomery, Tex.) followed by
phosphatase-conjugated goat anti-rabbit IgG antibody (Kirkegaard & Perry Laboratories). Serum IgG antibodies were determined using a goat
anti-guinea pig IgG (Kirkegaard & Perry Laboratories) conjugate.
The starting dilution of samples was 1:40 for tears and 1:25 for sera.
Under these conditions, the preimmune sera were negative to the tested antigens. The final dilution considered positive had an OD value that
was higher than two standard deviations above the mean OD values
obtained from unimmunized animals.
Antigens.
S. flexneri 2a LPS was prepared from
strain 2457T by the hot-water-phenol method (68). CS2 and
CS3 fimbriae were purified from strains C91f and E9034A, respectively,
by a method that involved shearing, differential centrifugation, gel
filtration, and density-gradient ultracentrifugation (28,
44).
 |
RESULTS |
Cloning cotA to -D.
The
cotA to -D cluster that encodes the CS2 fimbria
was cloned from ETEC strain C91f chromosomal DNA as a 5.7-kb
PstI/EcoRV DNA fragment. The entire CS2 operon
was cloned into pBluescript KS and subsequently into pGA1 (Fig. 1A),
downstream from the ompC promoter (Fig. 1B). Transformation
of E. coli DH5
and S. flexneri 2a CVD 1204 with pKS-CS2 or pGA1-CS2 resulted in the synthesis of CS2 fimbriae.
Fimbria formation was confirmed by positive colony agglutination with
rabbit anti-CS2 antisera. Western immunoblotting of whole-cell lysates
of CVD 1204(pGA1-CS2) probed with rabbit antiserum against purified CS2
further validated the expression of CS2. As shown in Fig.
2, a unique 16.5-kDa band, corresponding to the CS2 major fimbrial subunit, was visible in CVD 1204(pGA1-CS2) but not in CVD 1204(pGA1) containing the vector alone.

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 2.
Sodium dodecyl sulfate-polyacrylamide gel
electrophoresis gel and Western blots of CS2- and CS3-expressing CVD
1204. (A) Fast-Page BluPrint satin; (B) Western blot probed with
anti-CS3 polyclonal antibody; (C) Western blot probed with anti-CS2
polyclonal antibody. Lane 1, CVD 1204(pGA1-CS3); lane 2, CVD
1204(pGA1); lane 3, purified CS3 pili; lane 4, CVD 1204(pGA1-CS2); lane
5, CVD 1204(pGA1); lane 6, purified CS2 pili.
|
|
Cloning cstA to -H.
The
cstA to -H cluster, which is located on plasmids
in ETEC that encode CS3, was previously cloned as a 4.7-kb
HindIII DNA fragment (26, 55). The
cstA to -H cluster was subcloned into vector pGA1
downstream of the ompC promoter (Fig. 1C), and CS3 fibrillae
were expressed in both E. coli DH5
and S. flexneri 2a CVD 1204. CS3 expression was verified by bacterial
agglutination assays, dot immunoassays (see Table 2), and Western
immunoblotting assays of bacterial lysates probed with rabbit antiserum
against purified CS3. The CS3 major fimbrial subunit is produced as a precursor protein; removal of either 22 or 7 amino acids from its
signal peptide gives rise to two proteins of approximately 15.5 and
14.5 kDa (44). These two subunit species were seen in CVD
1204(pGA1-CS3) (Fig. 2).
Stability of cloned cotA to -D and
cstA to -H genes.
The stability of pGA1,
pGA1-CS2, and pGA1-CS3 in CVD 1204 was tested by growing the strains in
antibiotic-free medium. The results, presented in Table
1, indicate that 86% of CVD
1204(pGA1-CS2) cells and 93% of CVD 1204(pGA1-CS3) cells maintained
the plasmid during 7 and 13 duplications, respectively; 100% of CVD
1204(pGA1) cells retained the plasmid during 7 duplications.
Induction of fimbria formation by increased osmolarity.
Since
the ompC promoter from E. coli is osmotically
regulated, the induction of fimbrial synthesis was assayed by growing CVD 1204(pGA1-CS2) and CVD 1204(pGA1-CS3) in medium that contained increasingly higher concentrations of NaCl (0, 50, 150, and 300 mM).
Fimbrial expression was tested by DIA and immunoblotting experiments.
DIA results (Table 2) indicated that
growth in 150 mM NaCl led to a 16-fold induction of synthesis of CS2
fimbriae and a 4-fold induction of CS3. NaCl concentrations of 300 mM
had an inhibitory effect on production of both CS2 and CS3 fimbriae. Immunoblotting of cell extracts of CVD 1204(pGA1-CS2) and CVD 1204(pGA1-CS3) (Fig. 3) confirmed the DIA
results. Salt concentrations of up to 150 mM NaCl induced fimbrial
synthesis, while higher concentrations had an inhibitory effect. No
fimbriae were detected in CVD 1204(pGA1).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
DIA test for CS2 and CS3 fimbriae produced by CVD 1204 strains containing the cotA to -D and
cstA to -H genes induced by NaCl
|
|

View larger version (125K):
[in this window]
[in a new window]
|
FIG. 3.
Induction of fimbrial expression by salt concentration.
(A) Western blot probed with anti-CS2 polyclonal antibody. Lane 1, purified CS2 pili; lanes 2 to 5, CVD 1204(pGA1-CS2) grown in the
indicated NaCl concentrations (millimolar). (B) Western blot probed
with anti-CS3 polyclonal antibody. Lane 1, purified CS3 pili; lanes 2 to 5, CVD 1204(pGA1-CS3) grown in the indicated NaCl concentrations.
|
|
Invasion and replication in HeLa cells.
The strains were
tested to ascertain whether the expression of CS2 or CS3 fimbriae in
CVD 1204 interfered with the ability of the Shigella vaccine
strain to invade HeLa cells and to maintain intracellular growth
thereafter. CVD 1204(pGA1-CS2) and CVD 1204(pGA1-CS3) were more than
100-fold less invasive, and CVD 1204(pGA1) was approximately 10-fold
less invasive than CVD 1204 (Table 3). Following invasion, the strains maintained their ability to grow intracellularly, albeit to a somewhat diminished degree compared to the
host: CVD 1204(pGA1-CS2) demonstrated two replications and CVD
1204(pGA1-CS3) exhibited three replications, compared to the four to
five replications achieved by CVD 1204 during 4 h of growth in
HeLa cells.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Invasion and replication of CVD 1204 strains carrying
plasmids harboring cotA to -D and cstA
to -H operons and producing CS2 and CS3 fimbriae in HeLa
cells
|
|
Immunization of guinea pigs.
The immunogenicity and protective
efficacy induced by CVD 1204(pGA1-CS2) and CVD 1204(pGA1-CS3) were
tested in guinea pigs. The animals were immunized with two intranasal
administrations of live bacterial cultures. Serum, as a source of IgG,
and tears, as a source of sIgA, were collected 1 day prior to the first
dose and 14 days following each dose.
Bacterial agglutination assays performed with sera obtained 2 weeks
after the second immunization showed that all of the animals immunized
with either CVD 1204 alone, CVD 1204(pGA1-CS2), or CVD 1204(pGA1-CS3)
developed antibodies capable of agglutinating wild-type S. flexneri 2a (Table 4). Animals
immunized with CVD 1204 expressing CS3 or CS2 fimbriae developed
antibodies which agglutinated the wild-type ETEC strain bearing the
corresponding fimbriae. Moreover, animals immunized with the mixture of
CVD 1204(pGA1-CS2) and CVD 1204(pGA1-CS3) produced antibodies that
agglutinated both fimbriated wild-type ETEC strains.
View this table:
[in this window]
[in a new window]
|
TABLE 4.
Agglutination of Shigella, ETEC strain C91f
(CS2+), and ETEC strain E9034A (CS3+) by
postimmunization sera from guinea pigs immunized with various vaccines
|
|
Specific immune responses to each fimbria and the Shigella
vector itself were quantitated by enzyme-linked immunosorbent assay. All animals immunized with CVD 1204(pGA1-CS3) alone (group 2) or as a
mixture (group 4) responded with high levels of both mucosal IgA and
serum IgG anti-CS3 following a single dose (Fig. 4B
and E). These titers were boosted to even
higher levels following the second dose. Anti-CS3 IgG titers ranged in
group 2 from 51,200 to 204,800 and in group 4 from 12,800 to 204,800.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 4.
Production of sIgA and serum IgG antigen-specific
antibodies in guinea pigs immunized with Shigella strains
expressing CS2 and CS3 fimbriae. The immunized groups were as follows:
group 1, CVD 1204; group 2, CVD 1204(pGA1-CS3); group 3, CVD
1204(pGA1-CS2); and group 4, a mixture of CVD 1204(pGA1-CS3) and CVD
1204(pGA1-CS2). Antibody titers were determined in preimmune sera,
following a single immunization (day 14) and following two
immunizations (day 28). Antibodies elicited against Shigella
LPS, CS2, and CS3 antigens were quantitated. The titers of tear sIgA
are presented in panels A (LPS), B (CS3), and C (CS2); the titers of
serum IgG are presented in panels D (LPS), E (CS3), and F (CS2).
|
|
All animals immunized with CVD 1204(pGA1-CS2) (groups 3 and 4)
developed anti-CS2 mucosal IgA and serum IgG following a single dose
(Fig. 4C). Two immunizations were required to elicit anti-CS2 serum IgG
responses in all animals (Fig. 4F). Antifimbrial titers were comparable
in groups receiving a single strain or a mixture of strains. Anti-CS2
IgG titers ranged in group 3 from 100 to 1,600 and in group 4 from 100 to 1,600.
All animals in every group responded to the vector strain itself with
anti-Shigella LPS mucosal IgA and serum IgG following two
doses, with comparable titers in all groups (Fig. 4A and D). Following
a single dose of any CVD 1204 inoculum, half of the animals responded
with anti-Shigella LPS mucosal IgA, whereas three-fourths of
the animals responded with anti-Shigella LPS serum IgG.
Anti-Shigella LPS IgG titers ranged in group 1 from 400 to
1,600, in group 2 from 800 to 3,200, in group 3 from 400 to 3,200, and
in group 4 from 100 to 200.
Protective efficacy.
Upon Sereny test challenge with wild-type
S. flexneri 2a, all 15 animals vaccinated intranasally with
the placebo strain of E. coli HS developed severe
keratoconjunctivitis (Table 5). In contrast, none of the animals (5 per group) immunized with either native CVD 1204 or CVD 1204 expressing ETEC fimbriae developed severe
keratoconjunctivitis (P = 0.000064 for each comparison; Fisher's exact test). One animal in the group immunized with CVD 1204(pGA1-CS2) had a score of 1 on day 3. One animal in the group immunized with CVD 1204(pGA1-CS3) had a score of 2 on days 3 and 4.
View this table:
[in this window]
[in a new window]
|
TABLE 5.
Protection of immunized guinea pigs against
conjunctivitis following challenge with wild-type S. flexneri 2a
|
|
 |
DISCUSSION |
Shigella and ETEC are important human pathogens that
cause diarrheal disease in children in developing countries and in
travelers. One of the daunting obstacles that faces vaccine developers
of both Shigella and ETEC vaccines is that multiple
antigenic types of these pathogens cause disease in humans, and so for
each a multivalent vaccine will be necessary to provide broad-spectrum protection. It is the contention of our group that a multivalent Shigella vaccine containing five serotypes could confer
broad protection. The serotypes should include Shigella
dysenteriae 1 (the cause of severe epidemic Shiga dysentery in the
least-developed countries of the world) (35); S. flexneri 2a, S. flexneri 3a, and S. flexneri
6 (which together bear group- or type-specific antigens that are shared
with the other 12 S. flexneri types and subtypes and
demonstrate cross-protection against them in guinea pig challenge
studies [53]); and Shigella sonnei (the main
cause of traveler's shigellosis and of persisting foci of disease in endemic areas in industrialized countries) (29, 35).
Similarly, ETEC strains associated with human diarrheal disease exhibit
an array of colonization fimbriae, of which the most common are CFA/I,
the CFA/II family, and the CFA/IV family. CFA/I strains consist of a
single antigenic moiety (37, 42). In contrast, all CFA/II
strains produce CS3 but, in addition, may coexpress either CS1 or CS2.
Similarly, CFA/IV strains express CS6, either alone or together with
CS4 or CS5 fimbriae (24, 42, 50).
Since Shigella and ETEC are two of the most important
bacterial enteric pathogens targeted for immunoprophylaxis, we have embarked on a long-term program to develop a multivalent hybrid vaccine
against both pathogens that consists of attenuated Shigella strains of the above-mentioned five serotypes, each expressing different fimbrial antigens and an antigen (either mutant LTh or LTh B
subunit) to stimulate LT antitoxin. The results described herein,
relating further progress in the development of this complex multivalent live oral vaccine, communicate the construction of a
prototype combined vaccine consisting of an attenuated
guaBA S. flexneri 2a strain expressing either CS2 or CS3 fimbriae. The fimbriae are expressed from a circa 15-copy-number plasmid and, as
shown in Table 1, both pGA1-CS2 and pGA1-CS3 exhibited a high degree of
stability upon in vitro culture in the absence of selective antibiotic.
In vivo, plasmids sometimes are less stable than might be predicted by
in vitro data. Therefore, future constructs that are currently in
preparation will involve inserting the cloned CS2 and CS3 gene
sequences reported herein onto the highly stabilized plasmid expression
vectors recently described by Galen et al. (25).
High-level expression of CS2 and CS3 was achieved under the direction
of the osmotically activated promoter, ompC (Table 2).
Carriage of plasmids by CVD 1204 diminishes HeLa cell invasiveness
10-fold. However, the expression of CS2 or CS3 fimbriae decreased
invasiveness an additional 10-fold, presumably by sterically preventing
the Shigella invasion plasmid antigens from coming in
contact with the surface of the eukaryotic cells. In practical terms,
this diminished invasiveness would be expected to further attenuate the
Shigella vaccine strain for humans. Shigella
bacteria that were internalized underwent several replications (Table
3). Although the Shigella live vectors expressing CS2 or CS3
had 100-fold-diminished invasiveness for cells in tissues culture, the
live vector vaccines were nevertheless highly immunogenic in eliciting
both anti-Shigella and anti-ETEC fimbrial antibodies in
mucosal secretions (tears) and in the blood. Particularly important is
the observation that concomitant mucosal immunization with a mixture of
pGA1-CS2 and pGA1-CS3 bacteria resulted in strong antibody responses to
both CS2 and CS3 antigens. There was no diminution in responses to either fimbria when coadministered with the other. It is known that
antifimbrial antibodies can prevent ETEC strains bearing the homologous
fimbria from attaching to intestinal mucosa and thus prevent diarrhea
(10, 18, 27, 37, 57, 67). Since responses against two
fimbria types were accomplished with a mixture of two strains, we are
highly encouraged to proceed in future studies with the administration
of a mixture containing multiple Shigella live vector
strains expressing different fimbrial antigens.
Another important observation made in this study is that the live
vectors that elicited anti-CS antibodies in guinea pigs still conferred
upon those guinea pigs protection against challenge with virulent
Shigella in the Sereny test (62). These
findings constitute additional encouraging preclinical data that will
help to advance the project towards proof-of-principle clinical trials in humans with further improved prototype live vector constructs. Next
steps will include studies with live vectors carrying further-modified stabilized plasmids carrying a kanamycin resistance gene rather than an
ampicillin or carbenicillin resistance gene (which is more acceptable
to regulatory agencies) and cloned CS operons with mutant LTh (e.g.,
K63) or the LTh B subunit.
 |
ACKNOWLEDGMENTS |
These studies were supported by grant ROI AI 29471 from NIAID and
grants from Chiron Corporation and the Rockefeller Foundation (M. M. Levine, principal investigator).
We gratefully acknowledge Dave R. Maneval for the antigen production.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Center for
Vaccine Development, University of Maryland School of Medicine, 685 West Baltimore St., Baltimore, MD 21201. Phone: (410) 706-5328. Fax: (410) 706-6205. E-mail: ebarry{at}medicine.umaryland.edu.
Editor:
D. L. Burns
 |
REFERENCES |
| 1.
|
Ahren, C.,
M. Jertborn, and A. M. Svennerholm.
1998.
Intestinal immune responses to an inactivated oral enterotoxigenic Escherichia coli vaccine and associated immunoglobulin A responses in blood.
Infect. Immun.
66:3311-3316[Abstract/Free Full Text].
|
| 2.
|
Back, E.,
R. Mollby,
B. Kaijser,
G. Stintzing,
T. Wadstrom, and D. Habte.
1980.
Enterotoxigenic Escherichia coli and other gram-negative bacteria of infantile diarrhea: surface antigens, hemagglutinins, colonization factor antigen, and loss of enterotoxigenicity.
J. Infect. Dis.
142:318-327[Medline].
|
| 3.
|
Black, R. E.
1986.
Pathogens that cause travelers' diarrhea in Latin America and Africa.
Rev. Infect. Dis.
8:S131-S135.
|
| 4.
|
Black, R. E.,
M. H. Merson,
I. Huq,
A. R. M. A. Alim, and M. Yunus.
1981.
Incidence and severity of rotavirus and Escherichia coli diarrhoea in rural Bangladesh.
Lancet
i:141-143.
|
| 5.
|
Caron, J.,
L. M. Coffield, and J. R. Scott.
1989.
A plasmid-encoded regulatory gene, rns, required for expression of the CS1 and CS2 adhesins of enterotoxigenic Escherichia coli.
Proc. Natl. Acad. Sci. USA
86:963-967[Abstract/Free Full Text].
|
| 6.
|
Clemens, J. D.,
D. A. Sack,
J. R. Harris,
J. Chakraborty,
P. K. Neogy,
B. Stanton,
N. Huda,
M. U. Khan,
B. A. Kay,
M. R. Khan,
M. Ansaruzzaman,
M. Yunus,
M. R. Rao,
A.-M. Svennerholm, and J. Holmgren.
1988.
Cross-protection by B subunit-whole cell cholera vaccine against diarrhea associated with heat-labile toxin-producing enterotoxigenic Escherichia coli: results of a large-scale field trial.
J. Infect. Dis.
158:372-377[Medline].
|
| 7.
|
Cohen, D.,
S. Ashkenazi,
M. Green,
Y. Lerman,
R. Slepon,
G. Robin,
N. Orr,
D. N. Taylor,
J. C. Sadoff,
C. Chu,
J. Shiloach,
R. Schneerson, and J. B. Robbins.
1996.
Safety and immunogenicity of investigational Shigella conjugate vaccines in Israeli volunteers.
Infect. Immun.
64:4074-4077[Abstract].
|
| 8.
|
Cohen, D.,
S. Ashkenazi,
M. S. Green,
M. Gdalevich,
G. Robin,
R. Slepon,
M. Yavzori,
N. Orr,
C. Block,
I. Ashkenazi,
J. Shemer,
D. N. Taylor,
T. L. Hale,
J. C. Sadoff,
D. Pavliakova,
R. Schneerson, and J. B. Robbins.
1997.
Double-blind vaccine-controlled randomised efficacy trial of an investigational Shigella sonnei conjugate vaccine in young adults.
Lancet
349:155-159[CrossRef][Medline].
|
| 9.
|
Coster, T. S.,
C. W. Hoge,
L. L. VanDeVerg,
A. B. Hartman,
E. V. Oaks,
M. M. Venkatesan,
D. Cohen,
G. Robin,
A. Fontaine-Thompson,
P. J. Sansonetti, and T. L. Hale.
1999.
Vaccination against shigellosis with attenuated Shigella flexneri 2a strain SC602.
Infect. Immun.
67:3437-3443[Abstract/Free Full Text].
|
| 10.
|
De la Cabada, F. J.,
D. G. Evans, and D. J. Evans, Jr.
1981.
Immunoprotection against enterotoxigenic Escherichia coli diarrhea in rabbits by peroral administration of purified colonization factor antigen I (CFA/I).
FEMS Microbiol. Lett.
11:303-307.
|
| 11.
|
DuPont, H. L.,
R. B. Hornick,
A. T. Dawkins,
M. J. Snyder, and S. B. Formal.
1969.
The response of man to virulent Shigella flexneri 2a.
J. Infect. Dis.
119:296-299[Medline].
|
| 12.
|
DuPont, H. L.,
R. B. Hornick,
M. J. Snyder,
J. P. Libonati,
S. B. Formal, and E. J. Gangarosa.
1972.
Immunity in shigellosis. II. Protection induced by oral live vaccine or primary infection.
J. Infect. Dis.
125:12-16[Medline].
|
| 13.
|
DuPont, H. L.,
M. M. Levine,
R. B. Hornick, and S. B. Formal.
1989.
Inoculum size in shigellosis and implications for expected mode of transmission.
J. Infect. Dis.
159:1126-1128[Medline].
|
| 14.
|
DuPont, H. L.,
J. Olarte,
D. G. Evans,
L. K. Pickering,
E. Galindo, and D. J. Evans.
1976.
Comparative susceptibility of Latin American and United States students to enteric pathogens.
N. Engl. J. Med.
285:1520-1521.
|
| 15.
|
Edwards, P., and W. Ewing.
1972.
Identification of Enterobacteriaceae.
Burgess Publishing Co., Minneapolis, Minn.
|
| 16.
|
Evans, D. G.,
D. J. Evans, Jr.,
A. Opekun, and D. Y. Graham.
1988.
Non-replicating whole cell vaccine protective against enterotoxigenic Escherichia coli (ETEC) diarrhea: stimulation of anti-CFA (CFA/I) and anti-enterotoxin (anti-LT) intestinal IgA and protection against challenge with ETEC belonging to heterologous serotypes.
FEMS Microbiol. Lett.
47:117-125[CrossRef].
|
| 17.
|
Evans, D. G.,
D. J. Evans, Jr.,
W. S. Tjoa, and H. L. DuPont.
1978.
Detection and characterization of colonization factor of enterotoxigenic Escherichia coli isolated from adults with diarrhea.
Infect. Immun.
19:727-736[Abstract/Free Full Text].
|
| 18.
|
Evans, D. G.,
D. Y. Graham,
D. J. Evans, Jr., and A. Opekun.
1984.
Administration of purified colonization factor antigens (CFA/I, CFA/II) of enterotoxigenic Escherichia coli to volunteers.
Gastroenterology
87:934-940[Medline].
|
| 19.
|
Evans, D. J., Jr.,
D. G. Evans,
A. Opekun, and D. Y. Graham.
1988.
Immunoprotective oral whole cell vaccine for enterotoxigenic Escherichia coli diarrhea prepared by in situ destruction of chromosomal and plasmid DNA with colicin E2.
FEMS Microbiol. Lett.
47:9-18.
|
| 20.
|
Fasano, A.,
F. R. Noriega,
D. R. Maneval, Jr.,
S. Chanasongcram,
R. Russell,
S. Guandalini, and M. M. Levine.
1995.
Shigella enterotoxin 1: an enterotoxin of Shigella flexneri 2a active in rabbit small intestine in vivo and in vitro.
J. Clin. Investig.
95:2853-2861.
|
| 21.
|
Ferreccio, C.,
V. Prado,
A. Ojeda,
M. Cayazzo,
P. Abrego,
L. Guers, and M. M. Levine.
1991.
Epidemiologic patterns of acute diarrhea and endemic Shigella infections in a poor periurban setting in Santiago, Chile.
Am. J. Epidemiol.
134:614-627[Abstract/Free Full Text].
|
| 22.
|
Formal, S. B.,
E. V. Oaks,
R. E. Olsen,
M. Wingfield Eggleston,
P. J. Snoy, and J. P. Cogan.
1991.
Effect of prior infection with virulent Shigella flexneri 2a on the resistance of monkeys to subsequent infection with Shigella sonnei.
J. Infect. Dis.
164:533-537[Medline].
|
| 23.
|
Froehlich, B. J.,
A. Karakashian,
H. Sakellaris, and J. R. Scott.
1995.
Genes for CS2 pili of enterotoxigenic Escherichia coli and their interchangeability with those for CS1 pili.
Infect. Immun.
63:4849-4856[Abstract].
|
| 24.
|
Gaastra, W., and A. M. Svennerholm.
1996.
Colonization factors of human enterotoxigenic Escherichia coli (ETEC).
Trends Microbiol.
4:444-452[CrossRef][Medline].
|
| 25.
|
Galen, J. E.,
J. Nair,
J. Y. Wang,
S. S. Wasserman,
M. K. Tanner,
M. B. Sztein, and M. M. Levine.
1999.
Optimization of plasmid maintenance in the attenuated live vector vaccine strain Salmonella typhi CVD 908-htrA.
Infect. Immun.
67:6424-6433[Abstract/Free Full Text].
|
| 26.
|
Giron, J. A.,
J.-G. Xu,
C. R. Gonzalez,
D. M. Hone,
J. B. Kaper, and M. M. Levine.
1995.
Simultaneous constitutive expression of CFA/I and CS3 colonization factors of enterotoxigenic Escherichia coli by aroC, aroD Salmonella typhi vaccine strain CVD 908.
Vaccine
10:939-946.
|
| 27.
|
Grewal, H. M.,
H. Valvatne,
M. K. Bhan,
L. van Dijk,
W. Gaastra, and H. Sommerfelt.
1997.
A new putative fimbrial colonization factor, CS19, of human enterotoxigenic Escherichia coli.
Infect. Immun.
65:507-513[Abstract].
|
| 28.
|
Hall, R. H.,
D. R. Maneval,
J. H. Collins,
J. L. Theibert, and M. M. Levine.
1989.
Purification and analysis of colonization factor antigen I, coli surface antigen 1, and coli surface antigen 3 fimbriae from enterotoxigenic Escherichia coli.
J. Bacteriol.
171:6372-6374[Abstract/Free Full Text].
|
| 29.
|
Hyams, K. C.,
A. L. Bourgeois,
B. R. Merrell,
R. Rozmahel,
J. Escamilla,
S. A. Thornton,
G. M. Wasserman,
A. Burke,
P. Echeverria,
K. Y. Green,
A. Z. Kapikian, and J. N. Woody.
1991.
Diarrheal disease during Operation Desert Shield.
N. Engl. J. Med.
325:1423-1428[Abstract].
|
| 30.
|
Jalajakumari, M. B.,
C. J. Thomas,
R. Halter, and P. A. Manning.
1989.
Genes for biosynthesis and assembly of CS3 pili of CFA/II enterotoxigenic Escherichia coli: novel regulation of pilus production by bypassing an amber codon.
Mol. Microbiol.
3:1685-1695[CrossRef][Medline].
|
| 31.
|
Koprowski, H., II,
M. M. Levine,
R. J. Anderson,
G. Losonsky,
M. Pizza, and E. M. Barry.
2000.
Attenuated Shigella flexneri 2a vaccine strain CVD 1204 expressing colonization factor antigen I and mutant heat-labile enterotoxin of enterotoxigenic Escherichia coli Infect.
Immun.
68:4884-4892.
|
| 32.
|
Kotloff, K. L.,
G. A. Losonsky,
J. P. Nataro,
S. S. Wasserman,
T. L. Hale,
D. N. Taylor,
J. W. Newland,
J. C. Sadoff,
S. B. Formal, and M. M. Levine.
1995.
Evaluation of the safety, immunogenicity and efficacy in healthy adults of four doses of live oral hybrid Escherichia coli-Shigella flexneri 2a vaccine strain EcSf2a-2.
Vaccine
13:495-502[CrossRef][Medline].
|
| 33.
|
Kotloff, K. L.,
J. P. Nataro,
G. A. Losonsky,
S. S. Wasserman,
T. L. Hale,
D. N. Taylor,
J. C. Sadoff, and M. M. Levine.
1995.
A modified Shigella volunteer challenge model in which the inoculum is administered with bicarbonate buffer: clinical experience and implications for Shigella infectivity.
Vaccine
13:1488-1494[CrossRef][Medline].
|
| 34.
|
Kotloff, K. L.,
F. R. Noriega,
T. Samandari,
M. B. Sztein,
G. A. Losonsky,
J. P. Nataro,
W. D. Picking,
E. M. Barry, and M. M. Levine.
2000.
Shigella flexneri 2a strain CVD 1207, with specific deletions in virG, sen, set, and guaBA, is highly attenuated in humans.
Infect. Immun.
68:1034-1039[Abstract/Free Full Text].
|
| 35.
|
Kotloff, K. L.,
J. P. Winickoff,
B. Ivanoff,
J. D. Clemens,
D. L. Swerdlow,
P. J. Sansonetti,
G. K. Adak, and M. M. Levine.
1999.
Global burden of Shigella infections: implications for vaccine development and implementation of control strategies.
Bull. W. H. O.
77:651-666[Medline].
|
| 36.
|
Levine, M. M.
1983.
Travellers' diarrhoea: prospects for successful immunoprophylaxis.
Scand. J. Gastroenterol. Suppl.
84:121-134[Medline].
|
| 37.
|
Levine, M. M.
1987.
Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent.
J. Infect. Dis.
155:377-389[Medline].
|
| 38.
|
Levine, M. M.
1990.
Modern vaccines. Enteric infections.
Lancet
335:958-961[CrossRef][Medline].
|
| 39.
|
Levine, M. M.
2000.
Immunization against bacterial diseases of the intestine.
J. Pediatr. Gastroenterol. Nutr.
31:336-355[CrossRef][Medline].
|
| 40.
|
Levine, M. M.,
E. J. Bergquist,
D. R. Nalin,
D. H. Waterman,
R. B. Hornick,
C. R. Young,
S. Sotman, and B. Rowe.
1978.
Escherichia coli strains that cause diarrhoea but do not produce heat-labile or heat-stable enterotoxins and are non-invasive.
Lancet
i:1119-1122.
|
| 41.
|
Levine, M. M.,
R. E. Black,
M. L. Clements,
C. R. Young,
C. P. Cheney,
P. Schad,
H. Collins, and E. C. Boedeker.
1984.
Prevention of enterotoxigenic Escherichia coli diarrheal infection by vaccines that stimulate antiadhesion (antipili) immunity, p. 223-244.
In
E. C. Boedeker (ed.), Attachment of organisms to the gut mucosa. CRC Press, Boca Raton, Fla.
|
| 42.
|
Levine, M. M.,
J. A. Giron, and F. Noriega.
1994.
Fimbrial vaccines, p. 255-270.
In
P. Klemm (ed.), Fimbriae: adhesion, biogenics, genetics and vaccines. CRC Press, Boca Raton, Fla.
|
| 43.
|
Levine, M. M.,
J. G. Morris,
G. Losonsky,
E. Boedeker, and B. Rowe.
1986.
Fimbriae (pili) adhesins as vaccines, p. 143-145.
In
D. L. Lark, S. Normark, B. E. Uhlin, and H. Wolf-Watz (ed.), Protein-carbohydrate interactions in biological systems. The molecular biology of microbial pathogenicity. Academic Press, London, England.
|
| 44.
|
Levine, M. M.,
P. Ristaino,
G. Marley,
C. Smyth,
S. Knutton,
E. Boedeker,
R. Black,
C. Young,
M. L. Clements,
C. Cheney, and R. Patnaik.
1984.
Coli surface antigens 1 and 3 of colonization factor antigen II-positive enterotoxigenic Escherichia coli: morphology, purification, and immune responses in humans.
Infect. Immun.
44:409-420[Abstract/Free Full Text].
|
| 45.
|
Levine, M. M., and A.-M. Svennerholm.
2000.
Enteric vaccines: present and future, p. 252-263.
In
H. L. DuPont, and R. Steffen (ed.), Textbook of travel medicine and health. B. C. Decker, New York, N.Y.
|
| 46.
|
Levine, M. M.,
C. R. Young,
R. E. Black,
Y. Takeda, and R. A. Finkelstein.
1985.
Enzyme-linked immunosorbent assay to measure antibodies to purified heat-labile enterotoxins from human and porcine strains of Escherichia coli and to cholera toxin: application in serodiagnosis and seroepidemiology.
J. Clin. Microbiol.
21:174-179[Abstract/Free Full Text].
|
| 47.
|
Lowell, G. H.
1997.
Proteosomes for improved nasal, oral or injectable vaccines, p. 193-206.
In
M. M. Levine, G. C. Woodrow, J. B. Kaper, and G. S. Cobon (ed.), New generation vaccines. Marcel Dekker, New York, N.Y.
|
| 48.
|
Mallett, C. P.,
T. L. Hale,
R. W. Kaminski,
T. Larsen,
N. Orr,
D. Cohen, and G. H. Lowell.
1995.
Intranasal or intragastric immunization with proteosome-Shigella lipopolysaccharide vaccines protects against lethal pneumonia in a murine model of Shigella infection.
Infect. Immun.
63:2382-2386[Abstract].
|
| 49.
|
Manning, P. A.,
K. N. Timmis, and G. Stevenson.
1985.
Colonization factor antigen II (CFA/II) of enterotoxigenic Escherichia coli: molecular cloning of the CS3 determinant.
Mol. Gen. Genet.
200:322-327[CrossRef][Medline].
|
| 50.
|
McConnell, M. M.,
L. V. Thomas,
G. A. Willshaw,
H. R. Smith, and B. Rowe.
1988.
Genetic control and properties of coli surface antigens of colonization factor antigen IV (PCF8775) of enterotoxigenic Escherichia coli.
Infect. Immun.
56:1974-1980[Abstract/Free Full Text].
|
| 51.
|
Merson, M. H.,
G. K. Morris,
D. A. Sack,
J. G. Wells,
J. C. Feeley,
R. B. Sack,
W. B. Creech,
A. Z. Kapikian, and E. J. Gangarosa.
1976.
Travelers' diarrhea in Mexico. A prospective study of physicians and family members attending a congress.
N. Engl. J. Med.
294:1299-1305[Abstract].
|
| 52.
|
Noriega, F. R.,
F. M. Liao,
S. B. Formal,
A. Fasano, and M. M. Levine.
1995.
Prevalence of Shigella enterotoxin 1 among Shigella clinical isolates of diverse serotypes.
J. Infect. Dis.
172:1408-1410[Medline].
|
| 53.
|
Noriega, F. R.,
F. M. Liao,
D. R. Maneval,
S. Ren,
S. B. Formal, and M. M. Levine.
1999.
Strategy for cross-protection among Shigella flexneri serotypes.
Infect. Immun.
67:782-788[Abstract/Free Full Text].
|
| 54.
|
Noriega, F. R.,
G. Losonsky,
C. Lauderbaugh,
F. M. Liao,
M. S. Wang, and M. M. Levine.
1996.
Engineered guaB-A, virG Shigella flexneri 2a strain CVD 1205: construction, safety, immunogenicity and potential efficacy as a mucosal vaccine.
Infect. Immun.
64:3055-3061[Abstract].
|
| 55.
|
Noriega, F. R.,
G. Losonsky,
J. Y. Wang,
S. B. Formal, and M. M. Levine.
1996.
Further characterization of aroA, virG Shigella flexneri 2a strain CVD 1203 as a mucosal Shigella vaccine and as a live vector vaccine for delivering antigens of enterotoxigenic Escherichia coli.
Infect. Immun.
64:23-27[Abstract].
|
| 56.
|
Peltola, H.,
A. Siitonen,
H. Kyrönseppä,
I. Simula,
L. Mattila,
P. Oksanen,
M. J. Kataja, and M. Cadoz.
1991.
Prevention of travellers' diarrhoea by oral B-subunit/whole-cell cholera vaccine.
Lancet
338:1285-1289[CrossRef][Medline].
|
| 57.
|
Rudin, A.,
L. Olbe, and A. M. Svennerholm.
1996.
Monoclonal antibodies against fimbrial subunits of colonization factor antigen I (CFA/I) inhibit binding to human enterocytes and protect against enterotoxigenic Escherichia coli expressing heterologous colonization factors.
Microb. Pathog.
21:35-45[CrossRef][Medline].
|
| 58.
|
Sakellaris, H.,
G. P. Munson, and J. R. Scott.
1999.
A conserved residue in the tip proteins of CS1 and CFA/I pili of enterotoxigenic Escherichia coli that is essential for adherence.
Proc. Natl. Acad. Sci. USA
96:12828-12832[Abstract/Free Full Text].
|
| 59.
|
Sakellaris, H., and J. R. Scott.
1998.
New tools in an old trade: CS1 pilus morphogenesis.
Mol. Microbiol.
30:681-687[CrossRef][Medline].
|
| 60.
|
Savarino, S. J.,
F. M. Brown,
E. Hall,
S. Bassily,
F. Youssef,
T. Wierzba,
L. Peruski,
N. A. El-Masry,
M. Safwat,
M. Rao,
M. Jertborn,
A. M. Svennerholm,
Y. J. Lee, and J. D. Clemens.
1998.
Safety and immunogenicity of an oral, killed enterotoxigenic Escherichia coli-cholera toxin B subunit vaccine in Egyptian adults.
J. Infect. Dis.
177:796-799[Medline].
|
| 61.
|
Savarino, S. J.,
E. R. Hall,
S. Bassily,
F. M. Brown,
F. Youssef,
T. F. Wierzba,
L. Peruski,
N. A. El-Masry,
M. Safwat,
M. Rao,
H. El Mohamady,
R. Abu-Elyazeed,
A. Naficy,
A. M. Svennerholm,
M. Jertborn,
Y. J. Lee, and J. D. Clemens.
1999.
Oral, inactivated, whole cell enterotoxigenic Escherichia coli plus cholera toxin B subunit vaccine: results of the initial evaluation in children. PRIDE Study Group.
J. Infect. Dis.
179:107-114[CrossRef][Medline].
|
| 62.
|
Sereny, B.
1957.
Experimental keratoconjunctivitis shigellosa.
Acta Microbiol. Acad. Sci. Hung.
4:367-376[Medline].
|
| 63.
|
Sjoberg, P. O.,
M. Lindahl,
J. Porath, and T. Wadstrom.
1988.
Purification and characterization of CS2, a sialic acid-specific haemagglutinin of enterotoxigenic Escherichia coli.
Biochem. J.
255:105-111[Medline].
|
| 64.
|
Smyth, C. J.
1982.
Two mannose-resistant hemagglutinins on enterotoxigenic Escherichia coli of serotype 06:H16 or H-isolated from traveller's and infantile diarrhea.
J. Gen. Microbiol.
128:2081-2096[Medline].
|
| 65.
|
Svennerholm, A. M.,
J. Holmgren,
R. Black,
M. Levine, and M. Merson.
1983.
Serologic differentiation between antitoxin responses to infection with Vibrio cholerae and enterotoxin-producing Escherichia coli.
J. Infect. Dis.
147:514-522[Medline].
|
| 66.
|
Svennerholm, A. M.,
J. Holmgren, and D. A. Sack.
1989.
Development of oral vaccines against enterotoxinogenic Escherichia coli diarrhoea.
Vaccine
7:196-198[CrossRef][Medline].
|
| 67.
|
Tacket, C. O.,
R. H. Reid,
E. C. Boedeker,
G. Losonsky,
J. P. Nataro,
H. Bhagat, and R. Edelman.
1994.
Enteral immunization and challenge of volunteers given enterotoxigenic E. coli CFA/II encapsulated in biodegradable microspheres.
Vaccine
12:1270-1274[CrossRef][Medline].
|
| 68.
|
Westphal, O., and K. Jann.
1965.
Bacterial lipopolysaccharides: extraction with phenol-water and further application of procedures.
Methods Carbohydr. Chem.
5:83-91.
|
| 69.
|
Yakhchali, B., and P. A. Manning.
1997.
Epitope analysis of the CS3 fimbrial subunit of human enterotoxigenic Escherichia coli and the construction of novel CS3::ST and CS3::LT-B immunogens.
Behring Inst. Mitt.
98:124-134.
|
Infection and Immunity, May 2001, p. 3150-3158, Vol. 69, No. 5
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.5.3150-3158.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Qadri, F., Svennerholm, A.-M., Faruque, A. S. G., Sack, R. B.
(2005). Enterotoxigenic Escherichia coli in Developing Countries: Epidemiology, Microbiology, Clinical Features, Treatment, and Prevention. Clin. Microbiol. Rev.
18: 465-483
[Abstract]
[Full Text]
-
Ranallo, R. T., Fonseka, C. P., Cassels, F., Srinivasan, J., Venkatesan, M. M.
(2005). Construction and Characterization of Bivalent Shigella flexneri 2a Vaccine Strains SC608(pCFAI) and SC608(pCFAI/LTB) That Express Antigens from Enterotoxigenic Escherichia coli. Infect. Immun.
73: 258-267
[Abstract]
[Full Text]
-
Kotton, C. N., Hohmann, E. L.
(2004). Enteric Pathogens as Vaccine Vectors for Foreign Antigen Delivery. Infect. Immun.
72: 5535-5547
[Full Text]
-
Cersini, A., Martino, M. C., Martini, I., Rossi, G., Bernardini, M. L.
(2003). Analysis of Virulence and Inflammatory Potential of Shigella flexneri Purine Biosynthesis Mutants. Infect. Immun.
71: 7002-7013
[Abstract]
[Full Text]
-
Pasetti, M. F., Barry, E. M., Losonsky, G., Singh, M., Medina-Moreno, S. M., Polo, J. M., Ulmer, J., Robinson, H., Sztein, M. B., Levine, M. M.
(2003). Attenuated Salmonella enterica Serovar Typhi and Shigella flexneri 2a Strains Mucosally Deliver DNA Vaccines Encoding Measles Virus Hemagglutinin, Inducing Specific Immune Responses and Protection in Cotton Rats. J. Virol.
77: 5209-5217
[Abstract]
[Full Text]
-
Altboum, Z., Levine, M. M., Galen, J. E., Barry, E. M.
(2003). Genetic Characterization and Immunogenicity of Coli Surface Antigen 4 from Enterotoxigenic Escherichia coli when It Is Expressed in a Shigella Live-Vector Strain. Infect. Immun.
71: 1352-1360
[Abstract]
[Full Text]
-
Lee, S.-G., Kim, D.-Y., Hyun, B.-H., Bae, Y.-S.
(2002). Novel Design Architecture for Genetic Stability of Recombinant Poliovirus: the Manipulation of G/C Contents and Their Distribution Patterns Increases the Genetic Stability of Inserts in a Poliovirus-Based RPS-Vax Vector System. J. Virol.
76: 1649-1662
[Abstract]
[Full Text]