Previous Article | Next Article ![]()
Infection and Immunity, May 2001, p. 3164-3174, Vol. 69, No. 5
Division of Microbiology, Faculty of Pharmaceutical
Sciences, Chiba University, Chiba 263-8522,1
Department of Bacteriology, Hirosaki University School of
Medicine, Hirosaki 036-8562,2 Center for
Basic Research, The Kitasato Institute, Tokyo
108-8642,3 and Department of
Infectious Diseases, Kyorin University School of Medicine, Mitaka
181-8611,4 Japan
Received 4 December 2000/Returned for modification 8 January
2001/Accepted 9 February 2001
The enteric pathogen Salmonella enterica serovar
Typhimurium, similar to other facultative intracellular pathogens, has
been shown to respond to the hostile conditions inside macrophages of
the host organism by producing a set of stress proteins that are also
induced by various environmental stresses. The stress-induced ClpXP
protease is a member of the ATP-dependent proteases, which are known to
be responsible for more than 90% of all proteolysis in
Escherichia coli. To investigate the contribution of the
ClpXP protease to the virulence of serovar Typhimurium we initially cloned the clpP and clpX operon from the
pathogenic strain serovar Typhimurium Salmonellae are facultative
intracellular parasites responsible for a variety of disease syndromes,
ranging from acute gastroenteritis to systemic infections like typhoid
fever. Salmonella enterica serovar Typhimurium, which
generally causes gastroenteritis in humans, can establish systemic
infections in mouse that closely resemble typhoid fever in humans.
Though many factors required for the virulence of salmonellae have been
studied, the molecular mechanisms by which salmonellae cause disease
are only beginning to be elucidated. Two major contributors to serovar
Typhimurium virulence are encoded within the pathogenicity islands
SPI-1 (46) and SPI-2 (26, 53), located at 63 and 30 centisomes on the chromosome, respectively, that code for a type
III secretion system. SPI-1 is required for efficient invasion of the
intestinal epithelium, suggesting a role in early infection, and SPI-2
is needed for survival and growth within macrophages, indicating a role
in systemic infection (25, 26, 53). Besides the genes
found within SPI-1 and SPI-2, molecular genetic approaches involving
random or gene-targeted mutagenesis have identified many other
bacterial genes associated with virulence in various animals and in
vitro model systems, such as cultured macrophage cells and epithelial
cells from various sources (1, 16, 26, 38). These
mutations can be roughly classified according to their assigned gene
functions, such as auxotrophy (e.g., aroA, aroC, aroD, purA,
and purE), regulation of gene expression (e.g., cya,
crp, rpoS, rpoE, and phoP), or secretion
(ompR) (10, 13, 14, 26, 27, 29, 45, 52).
Stress response genes encode a group of proteins collectively referred
to as stress proteins (for a review, see reference 47),
which are induced in response to hostile environments. They have been
studied by focusing on their potential roles in the virulence of
various facultative intracellular bacteria, including serovar
Typhimurium. During the complex multistage pathogenesis, bacteria are
exposed to a variety of environmental stress conditions such as sudden
elevated temperature, high osmolarity, oxidative damage, nutrient
depletion, and bactericidal mechanisms associated with the host immune
system (17). To successfully colonize the host organism
and to avoid clearance by the immune system, a large number of general
stress response systems as well as specific virulence factors would be
required. The hypothesis that a global stress response plays an
important role in the successful colonization and expression of
virulence was initially based on indirect evidence, such as induction
of the DnaK and GroEL homologues during intracellular growth of serovar
Typhimurium within macrophages (5). DnaK and GroEL are
major stress proteins that bind to unfolded polypeptides and function
as molecular chaperones in cells (47). These chaperones stabilize the unfolded structure, protecting it from aberrant folding
and nonspecific interactions with other proteins. In response to the
intracellular stress associated with phagocytosis, induced levels of
chaperones would be required to cope with the accumulation of partially
unfolded or denatured proteins in the cell. Direct evidence for the
essential role of stress proteins in bacterial virulence was originally
demonstrated by insertional mutation of the stress protein gene
htrA, which resulted in the inability of serovar Typhimurium
to grow inside macrophages (30). The htrA gene
encodes a periplasmic serine protease which is necessary for the
degradation of abnormally folded proteins transported into the
periplasmic space (61). Salmonellae maintain long-term residence in host phagocytic cells with bactericidal mechanisms, suggesting that intracellular bacteria experience a considerable amount
of protein misfolding and damage within this compartment. It is
proposed that HtrA functions as a stress protein to protect the
extracytoplasmic component from damage. The essential role of the
htrA homologue as a virulence factor has also been
demonstrated in other facultative intracellular pathogens, such as
Yersinia enterocolitica (69) and Brucella
melitensis (55).
ATP-dependent proteolysis is involved in more than 90% of all cell
protein turnover in Escherichia coli and appears to be essential for the rapid breakdown of abnormal protein
(42). Most ATP-dependent proteolysis in E. coli
has been attributed to two well-characterized proteases, Lon and Clp,
which are also stress-induced proteins (for a review, see reference
17). Two types of Clp protease exist in E. coli, ClpP and ClpQ (or HslV). The ClpP proteolytic component
associates with either of two ATPases, ClpA or ClpX (21,
43), whereas the ClpQ proteolytic subunit associates with the
ClpY (or HslU) ATPase (32, 58). ClpP and ClpQ are not
related in either amino acid structure or mode of proteolysis. The ClpP
subunits form a cylindrical heptameric particle possessing the
catalytic core of a serine protease (36, 43). Substrate
specificity is determined by either ClpA or ClpX as a regulatory ATPase.
Though the disruption of clpP in E. coli creates
no obvious phenotype and the bacteria appear to grow normally
(43), the ClpP protease has a more important and diverse
role in gram-positive bacteria. The disruption of the clpP
gene in Bacillus subtilis causes pleiotropic effects. The
B. subtilis clpP deletion mutant is highly filamentous and
nonmotile (48) and cannot grow under several stress
conditions, being most severely affected by starvation (67) and high temperature (48). ClpP is also
required for sporulation in B. subtilis (48).
The inactivation of the clpP gene in Lactococcus
lactis results in significant loss of cell viability
(18), indicating a major role for ClpP in basic cell metabolism. Streptomyces coelicolor contains at least two
clp genes, clpP1 and clpP2. Disruption
of the clpP1 gene in S. coelicolor blocks
differentiation at the substrate mycelium step (12). The
importance of ClpP has been also demonstrated in connection with
bacterial pathogenesis. In Yersinia enterocolitica, a
gastrointestinal pathogen in humans and animals, ClpP proteolysis
modulates ail gene expression (54). Ail is a
17-kDa cell surface protein that confers resistance to serum killing
and the ability to attach and invade cells in vitro (4).
In Listeria monocytogenes, a gram-positive facultative
intracellular pathogen responsible for infrequent but often serious
opportunistic infections in humans and animals, ClpP plays a crucial
role in intracellular parasitism and virulence (19). In
S. enterica serovar Typhimurium, the clpP gene
was detected in a pool of transposon-tagged mutants with attenuated
virulence (26), but the mutant has not been precisely characterized.
Recently, we cloned the clpP clpX operon of S. enterica serovar Typhimurium pathogenic strain Bacterial strains, plasmids, and growth conditions.
The
bacterial strains and plasmids used in this study are shown in Table
1. Bacteria were routinely grown in
L-broth and L-agar (Difco Laboratories, Detroit, Mich.). When
necessary, the media were supplemented with ampicillin (50 µg/ml),
kanamycin (25 µg/ml), chloramphenicol (25 µg/ml), and/or nalidixic
acid (25 µg/ml).
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.5.3164-3174.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Disruption of the Genes for ClpXP Protease in Salmonella
enterica Serovar Typhimurium Results in Persistent Infection in
Mice, and Development of Persistence Requires Endogenous Gamma
Interferon and Tumor Necrosis Factor Alpha
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
3306 and then created
insertional mutations in the clpP and/or clpX
gene. The
clpP and
clpX mutants were used
to inoculate BALB/c mice by either the intraperitoneal or the oral route and found to be limited in their ability to colonize organs of
the lymphatic system and to cause systemic disease in the host. A
variety of experiments were performed to determine the possible reasons
for the loss of virulence. An oxygen-dependent killing assay using
hydrogen peroxide and paraquat (a superoxide anion generator) and a
serum killing assay using murine serum demonstrated that all of the
serovar Typhimurium
clpP and
clpX mutants
were as resistant to these killing mechanisms as the wild-type strain. On the other hand, the macrophage survival assay revealed that all
these mutants were more sensitive to the intracellular environment than
the wild-type strain and were unable to grow or survive within peritoneal macrophages of BALB/c mice. In addition, it was revealed that the serovar Typhimurium ClpXP-depleted mutant was not completely cleared but found to persist at low levels within spleens and livers of
mice. Interferon gamma-deficient mice and tumor necrosis factor
alpha-deficient mice failed to survive the attenuated serovar Typhimurium infections, suggesting that both endogenous cytokines are
essential for regulation of persistent infection with serovar Typhimurium.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
3306,
constructed insertional mutations in the operon, assayed their
pathogenicities in an animal system, and found that disruption of the
clpP and clpX genes results in persistent
infection with serovar Typhimurium rather than loss of virulence in
BALB/c mice. In this report, we demonstrate that the depletion of ClpXP
protease in serovar Typhimurium results in inability to survive and
multiply within peritoneal macrophages, inability to cause systemic
infection, and ability to cause persistent infection in BALB/c mice. In
addition, we show evidence that endogenous gamma interferon (IFN-
)
and tumor necrosis factor alpha (TNF-
) are required for development
of a persistent infection with serovar Typhimurium in mouse.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Bacterial strains and plasmids used in this study
Animals.
The mice used in this study were all 5 to 8 weeks
of age and included BALB/c, C57BL/6, IFN-
-deficient
(IFN-
/
) mice from a C57BL/6 × Sv129 cross
(64), and TNF-
-deficient (TNF-
/
)
mice from a C57BL/6 × Sv129 cross (65).
DNA isolation and manipulation, and PCR amplification and
sequencing.
DNA purification, ligation, restriction analysis, and
gel electrophoresis were carried out as described by Sambrook et al. (59). Restriction enzymes, T4 DNA ligase, and Klenow
enzyme were products of Takara Shuzo (Ohtsu, Japan). The DNA fragments of the clpP region were amplified using genomic DNA of
S. enterica serovar Typhimurium strains
3306, CS2007,
CS2016, and CS2018 as a template by PCR using primers S66
(5'TAAGCGTCGTGTAGTTGTCG), S529
(5'CCGTCCATCAGGTTACAATC), S589
(5'ATGTCATACAGCGGAGAACG), A1110
(5'AGATTGACCCGTATGATGCG), A1211
(5'CAATTACGATGGGTCAAAAT), and A2828
(5'TTTCCCACACATTCAACGGC). Southern blotting was done basically as described before (69), and hybridizations
using the ECL direct nucleic acid labeling and detection system
(Amersham Pharmacia Biotech, Buckinghamshire, United Kingdom) were
performed according to the manufacturer's instructions. Sequencing was
carried out with Sequenase (USB, Cleveland, Ohio) and synthetic primers.
Insertional inactivation of clpP and clpX
in strain
3306.
Plasmid pTKY320 was cleaved at the
EcoRV sites situated at nucleotide (nt) 682 and nt 802 (see
Fig. 1) and ligated to the chloramphenicol (Cm) resistance gene block
generated from the BamHI-digested and filled-in pNK2884. The
resultant plasmid, pTKY323, was cleaved at the MluI site
situated at nt 138 and HindIII in the vector plasmid,
and the overhanging ends were filled in with Klenow enzyme. The
generated clpP:Cm fragment was ligated to the filled-in
EcoRI site of pTKY229, which is a transferable suicide vector previously constructed by us (70). A suicide
feature of pTKY229 is based on one of the replication origins of R6K, ori
, which is functional only in a host when the
protein is encoded by the pir gene. The resulting mutator
plasmid, pTKY349, carrying clpP:Cm was introduced into
strain SM10
pir, which can mobilize the plasmid by the
conjugative function provided in trans from the RP4
integrated chromosome. Conjugative crosses with serovar Typhimurium
3306 were carried out as previously reported (70). The
chromosomal clpP was replaced by the clpP:Cm
construct by double recombination. The clpP mutant was
selected by resistance to chloramphenicol and nalidixic acid. Allelic
exchange was checked by Southern blot analysis and direct sequencing of
the clpP:cat region in the resultant strain (CS2007) mutant
amplified by PCR.
pir, harboring the resulting mutator plasmid pTKY368
with clpP:Km, was mobilized into serovar Typhimurium
3306 by conjugation. The chromosomal clpP was replaced by the
clpP:Km construct by double recombination. The
clpP mutant was selected by resistance to kanamycin and
nalidixic acid. Allelic exchange was checked by Southern blot analysis
and direct sequencing of the clpP:Km region in the resultant
strain (CS2016) amplified by PCR.
To insert a mutation into the clpX gene, pTKY367 was cleaved
at ClaI site situated at nt 2020 and then ligated to the
cat gene block prepared from pNK2884. The resulting plasmid,
pTKY369, was partially digested with EcoRI and at the
generated clpX:Cm of the EcoRI site of suicide
vector pTKY229. The chromosomal clpX was replaced in the
same way used to construct the clpP:Cm mutant. Allelic
exchange was checked by Southern blot analysis and direct sequencing of
the clpP:Cm region in the resulting strain (CS2018) amplified by PCR.
Immunoblot analysis. Equivalent numbers of bacterial cells were suspended in sample buffer (35), boiled for 5 min, and subjected to sodium dodecyl sulfate-12.5% polyacrylamide gel electrophoresis. Separated proteins on the gels were transferred onto Immobilon-P polyvinylidene difluoride membranes (Millipore, Bedford, Mass.) as suggested by the manufacturer. Proteins were reacted with rabbit anti-E. coli ClpX (1:25,000) antibody or anti-E. coli Lon antibody (1:25,000), followed by alkaline phosphatase-conjugated anti-rabbit immunoglobulin G as the secondary antibody. The enzymatic reactions were performed in the presence of nitro blue tetrazolium (30 mg/ml) (Dojindo, Kumamoto, Japan) and bromochloroindolylphosphate (Amresco, Solon, Ohio) (15 mg/ml).
Survival and growth of serovar Typhimurium strains in macrophage
cells.
The ability of the different strains of serovar Typhimurium
to survive and grow in macrophage cells was assessed by using resident
peritoneal macrophages prepared from BALB/c mice. The macrophages were
harvested from peritoneal lavage using cold phosphate-buffered saline
(PBS), washed with Hanks' balanced salt solution (HBSS; Sigma, Saint
Louis, Mo.) suspended in Dulbecco's modified Eagle's medium (DMEM;
Gibco, Grand Island, N.Y.) containing 10% fetal calf serum (FCS) and
50 µM
-mercaptoethanol, allowed to adhere to each well of 24-well
plates, and then incubated at 37°C before infection. Bacterial cells
were grown in L-broth at 37°C to the exponential growth phase
(optical density at 600 nm of approximately 0.5), and a portion was
opsonized with 50% fresh normal mouse serum for 15 min at 37°C and
diluted in DMEM. Opsonized bacteria were added to each well at a
multiplicity of infection of 5. The plates were centrifuged for 5 min
at 500 × g to enhance and synchronize infection. The
cells were incubated for 30 min at 37°C to permit phagocytosis, and
the free bacteria were removed by three washes with HBSS warmed at
37°C. DMEM containing 10% FCS and 100 µg of gentamicin per ml was
added, and the cells were incubated for 1.5 h at 37°C. The cells
were washed with the warmed HBSS three times, followed by incubation
with DMEM containing 10% FCS and 10 µg of gentamicin per ml at
37°C. Wells were sampled at various times by aspirating the medium,
three washes with HBSS, and lysing each well with PBS containing 0.1%
sodium deoxycholate. The triplicate samples were plated individually
after appropriate dilutions.
Determination of viable bacteria in organs of mice after infection with serovar Typhimurium. Serovar Typhimurium strains grown in L-broth at 37°C to the late exponential growth phase were diluted in sterile PBS. The actual number of bacteria present was determined by counting viable cells. Mice were challenged either orally or intraperitoneally by injection. The spleens and livers were aseptically removed at indicated times after infection and homogenized in PBS. The numbers of viable bacteria in the organs of infected mice were established by plating serial 10-fold dilutions of organ homogenates on L-agar plates. Colonies were routinely counted 18 to 24 h later.
Nucleotide sequence accession number. The sequence data of the complete operon reported here will appear in the DDBJ/EMBL/GenBank nucleotide sequence database under accession number AB033628.
| |
RESULTS |
|---|
|
|
|---|
Genetic organization of the strain
3306 clpP
locus.
To determine the nucleotide sequence of the clpP
locus of S. enterica serovar Typhimurium
3306, we
initially cloned the 16-kb BamHI fragment prepared from
chromosomal DNA which hybridized to the DNA fragment containing the
E. coli clpP gene from pCLP01 (data not shown). By using
subclones and synthetic oligonucleotides, the sequence of the
clpP locus was determined. A total of 3,540 bp were
sequenced, revealing the presence of four open reading frames (the
region is shown schematically in Fig. 1).
The ClpP protein predicted from the sequence was 99.0% identical to
ClpP of E. coli. Downstream was an open reading frame
encoding a protein 97.6% identical to ClpX of E. coli.
Immediately upstream of the ATG start codon for clpP, a
consensus ribosome-binding site and putative
10 and
35 sequences
were located. There is an intergenic region of 252 bp between the
clpP and clpX genes. No apparent promoter
elements for clpX were found in this region. A consensus ribosome-binding site was identified 9 bp upstream of clpX.
A potential stem-loop structure is located downstream of
clpX, indicating a rho-independent transcriptional
terminator. Downstream of clpX, the sequence is assigned to
a homologue of the E. coli lon gene, which encodes an
ATP-dependent serine protease (8), with a consensus
ribosome-binding site. A consensus heat shock promoter sequence
(9) was also identified upstream of the lon
gene. Upstream of clpP, the sequence is predicted to be a
homologue of the E. coli tig gene, whose product is known to
be a ribosome-associated chaperone, trigger factor (23).
|
Construction of clpP and clpX disruption
mutants of strain
3306.
Since sequence analysis revealed that
the clpP gene exists in an operon with clpX, we
constructed a clpP clpX double mutant, a clpP
mutant, and a clpX mutant. The clpP gene was
insertionally inactivated in vitro by using a Cm resistance cassette,
and this construct was used to create the serovar Typhimurium
3306
clpP:Cm mutant (strain CS2007) by allelic exchange. The
disruption of the clpP gene in CS2007 was confirmed by PCR
and Southern blotting (Fig. 2). To
examine whether the insertion affected the expression of
clpX, which is downstream of clpP, lysates from
the wild-type parent and strain CS2007 were subjected to immunoblot
analysis with anti-ClpX antiserum (Fig.
3A). The absence of the band
corresponding to ClpX suggests that insertion of the cassette in
clpP resulted in a polar mutation in the clpX
gene. Since a lon gene which is downstream of
clpX is preceded by a consensus promoter sequence, it is
unlikely that the insertion of a polar mutation in the clpP gene blocks the expression of the lon gene. This was
confirmed by immunoblot analysis with anti-Lon antiserum (Fig. 3B). The result suggests that the insertion of the Cm cassette in the
clpP gene does not affect the expression of the
lon gene.
|
|
3306 clpP:Km
mutant (strain CS2016), was confirmed by PCR and Southern blotting
(Fig. 2). The immunoblot analysis with anti-ClpX antiserum (Fig. 3A)
suggests that the insertion of the cassette in the clpP gene
does not affect the expression of the clpX gene.
The clpX gene was insertionally inactivated in vitro by
using a Cm resistance cassette, and this construct was used to create the serovar Typhimurium
3306 clpX:cat mutant
(strain CS2018) by in vivo homologous recombination. The disruption of
the clpX gene was confirmed by PCR and Southern analysis of
DNA prepared from the mutant (Fig. 2) and by immunoblot analysis using
anti-ClpX antiserum (Fig. 3A).
Analysis of the role of the ClpXP protease genes in virulence in
mouse.
One estimation of the virulence of serovar Typhimurium is
the ability of the bacteria to establish a lethal systemic infection in
mice. To measure the contribution of the ClpXP protease in serovar
Typhimurium virulence, we determined the abilities of serovar
Typhimurium clpP:Cm, clpP:Km, and
clpX:Cm mutants to grow in the organs of BALB/c mice. As
shown in Fig. 4A, mice that were infected
by intraperitoneal administration with 102 CFU of
3306
had more than 106 bacteria in both the spleen and liver on
day 5 after infection. All five mice infected with
3306 died at day
5. In contrast, mice infected with mutant strain CS2007
(clpP:Cm), CS2016 (clpP:Km), or CS2018
(clpX:Cm) appeared to be much more capable of controlling infection. Mice infected with each mutant strain had approximately 102 bacteria in the spleen and 103 bacteria in
the liver. Unlike mice infected with the wild-type strain
3306,
which colonizes the spleen and liver in large numbers, resulting in
death 5 days after infection, all mice challenged with mutant strain
CS2007, CS2016, or CS2018 survived beyond day 5 after infection,
indicating that these strains had lost the ability to cause a systemic
infection in mice.
|
3306 or CS2007 (clpP:Cm). The number of
bacteria in spleens and livers was assessed on day 5 after challenge
(Fig. 4B). The wild-type strain
3306 colonized the spleen and liver
in large numbers and resulted in death 5 days after infection. Again,
the ClpXP-depleted mutant strain, CS2007, exhibited an impaired ability to cause a systemic infection in mice.
Depletion of the ClpXP protease in strain
3306 impairs survival
in macrophages.
One of the most probable factors contributing to
the reduced virulence of serovar Typhimurium
clpP and
clpX mutants is the reduced capacity to survive
interactions with professional killing cells such as macrophages in
mouse. To address this possibility, we examined the capacity of mutant
strains CS2007 (clpP:Cm), CS2016 (clpP:Km) and
CS2018 (clpX:Cm) to survive and grow in macrophages. It is
known that serovar Typhimurium grown under conditions such as
hyperosmolarity (0.3 M NaCl) or a change in the pH of the medium from
6.0 to 8.0 that allow expression of the type III secretion system
encoded by SPI-1 readily kills cultured macrophages (7, 11). To avoid the cytotoxic effect of expression of the type III
secretion system, bacterial cells were grown in L-broth (pH 7.0) to
infect the macrophages. The resident peritoneal macrophages from BALB/c
mice were cultured and exposed to the different strains for 30 min at a
multiplicity of infection of 5 bacteria per macrophage cell. Bacterial
growth was then monitored for 48 h (Fig.
5). Previous studies with serovar
Typhimurium showed that the rpoE gene encoding an
alternative
factor,
E, is critically involved in
intracellular survival within macrophages (29). To test
the validity of the resident peritoneal macrophages of mice prepared in
the present study, the macrophage cells were challenged with the
opsonized serovar Typhimurium rpoE:Km strain. The number of
viable bacteria was drastically decreased during the first 2 h of
incubation. Between 2 and 48 h, the number of rpoE:Km
bacteria present intracellularly had decreased 10-fold, whereas the
number of the wild-type strain,
3306, had increased 4-fold,
suggesting a valid Salmonella-macrophage interaction system. When macrophages were challenged with strains CS2007, CS2016, and
CS2018, none of the mutants seemed to grow intracellularly. Between 2 and 48 h after infection, the number of mutant bacteria present
within macrophages had decreased ~9-fold. These results suggest that
the ClpXP protease is required for the intracellular survival and
growth of serovar Typhimurium within macrophages.
|
clpP and
clpX mutants were as
resistant to these killing mechanisms as the wild-type strain (data not
shown). Salmonellae are typically resistant to the killing activity of
complement that is present in serum. Since serum resistance is known to
be an important factor for full expression of virulence in serovar
Typhimurium, we examined the effect of
clpP and
clpX mutations on serum sensitivity. Mutant strains CS2007, CS2016, and CS2018 were exposed to normal and heat-inactivated BALB/c mouse serum, and their viability was determined by counting the
CFU for each assay. None of the mutants was sensitive to the killing
action of mouse serum (data not shown).
Depletion of ClpXP protease in strain
3306 results in persistent
infection of BALB/c mice.
To determine whether the loss of
virulence was due to the inability of the mutants to grow in the host,
the number of bacteria in spleens and livers of a group of mice
infected with strain CS2007 (clpP:Cm) was monitored for up
to 35 days after infection (Fig. 6). At 3 days postinfection, a few bacteria were recovered from both organs of
mice infected with the clpP:Cm mutant compared with the
parental strain, whose number increased to approximately 2 × 103 CFU in the spleens and 3 × 104 CFU in
the livers of the infected mice. Unlike mice infected with the wild
type, which resulted in death by 5 days after infection, mice
challenged with the same number (102 CFU) of the
clpP:Cm mutant survived. Beginning at 7 days and continuing
through 35 days postinfection, however, the clpP:Cm mutant
bacteria were not cleared from the mice, but a similar number of the
bacteria were recovered from the spleens and livers even on day 35 after initial infection. The clpP:Cm mutant also persisted
in mice for several weeks following oral challenge with 108
cells (result not shown).
|
3306
using bacteria carrying a few copies of plasmid pHSG422. This plasmid
exhibits defective replication above 37°C and is diluted out during
bacterial growth (24). The use of this plasmid to
differentiate bacterial growth rate has been described previously (3, 22). Bacterial growth at 37°C was monitored for
8 h. As shown in Fig. 7, the
proportions of the population carrying pHGS422 were indistinguishable
between strains
3306 and CS2007 up to 8 h, indicating no
significant differences in growth rate of these strains. Therefore, it
is unlikely that the reduced virulence of the ClpXP-depleted mutant is
attributable to impaired bacterial growth.
|
Effect of endogenous cytokines on persistence of ClpXP-depleted
mutant in mice.
A previous report demonstrated that IFN-
and
TNF-
play an essential role in acquired resistance during the early
phase of serovar Typhimurium infection (49). Therefore, we
assessed the relevance of endogenous cytokines in the establishment and
maintenance of the persistent infection developed by the ClpXP-depleted
mutant by monitoring bacterial growth in IFN-
- and TNF-
-deficient
mice following infection. C57BL/6 mice, IFN-
/
mice,
and TNF-
/
mice were infected with strain
3306 or
mutant strain CS2007 (clpP:Cm), and the number of bacterial
cells in the spleens and livers was determined on day 3 after infection
(Fig. 8). The number of wild-type cells
in both spleens and livers of the IFN-
- and TNF-
-deficient mice
was higher than in C57BL/6 mice. All cytokine-deficient mice died
following infection with the wild-type strain. While no
clpP:Cm bacterial cells were detected in either the spleens or livers of C57BL/6 mice, significant numbers were detected in the
organs of IFN-
- and TNF-
-deficient mice. The number of bacteria in the cytokine-deficient mice infected with the clpP:Cm
mutant was also examined on days 5 and 10 after infection (Fig. 8). In these mice, clpP:Cm bacteria progressively increased to
108 and 107 per organ in the IFN-
- and
TNF-
-deficient mice, respectively, by day 10 postinfection. After
infection with the clpP:Cm mutant, all the
cytokine-deficient mice died on day 10 after infection. Though no
clpP:Cm bacterial cells were detected in either the spleens
or livers of C57BL/6 mice on day 3 postinoculation, significant numbers
were detected in the organs of the mice 5 and 10 days postinoculation
(Fig. 8). Furthermore, we confirmed that the clpP:Cm mutant
persisted in the C57BL/6 mice by monitoring the numbers of bacteria in
the spleens and livers for several weeks (data not shown). These
results suggest that both endogenous IFN-
and TNF-
are necessary
for developing in vivo persistence after infection with the
clpP:Cm mutant.
|
| |
DISCUSSION |
|---|
|
|
|---|
ClpP proteases have been identified not only in a wide range of bacteria but also in plants and animals (56). In E. coli, the ClpP protein is a cylindrical heptameric particle, forming the catalytic core of the protease, which associates with one of two ATPases, ClpA or ClpX, thus determining the substrate specificity (21, 36, 43). A hexamer of the Clp ATPase is located on the ClpP rings. The sequence analysis of the serovar Typhimurium clpP-clpX operon cloned in the present study revealed that these homologues show high identity with the equivalent E. coli proteins. The functional regions in both proteins are also conserved between serovar Typhimurium and E. coli. In ClpP, these include Ser-111 and His-136, which are required for proteolytic activity, and the 14-amino-acid precursor peptide, which is processed to produce the active form of ClpP (43). An ATP-binding motif, two tail motifs, and a zinc finger motif (21) are also found in the serovar Typhimurium ClpX homologue. The genetic organization of the clpP region in serovar Typhimurium, tig-clpP-clpX-lon, is also identical to that of E. coli (21).
The inactivation of clpP in E. coli results in no obvious phenotype, and clpP mutants appear to grow normally (43). However, as clpP genes from other organisms have been identified, it has become increasingly apparent that the ClpP protease performs more important and diverse roles in other bacteria. The inactivation of the clpP gene in L. lactis results in significant loss of cell viability, suggesting a major role for ClpP proteolysis in basic cell metabolism (18). Similarly, depletion of ClpP in B. subtilis causes pleiotropic effects such as filamentation, nonmotility, and impaired growth under certain stress conditions, starvation and high temperature (48). In the green alga Chlamydomonas reinhardtii, ClpP is essential for cell growth (28).
Here we have extended the study of the
clpP and
clpX mutants by comparing their virulence to that of the
parental strain, serovar Typhimurium
3306. The virulence assay in
the mouse model demonstrated that the ability of the
clpP
and
clpX mutants to cause systemic infection was
apparently decreased (Fig. 4). During the course of infection in mice,
serovar Typhimurium, which colonizes many different organs, including
the Peyer's patches of the small intestine, mesenteric lymph nodes,
spleen, and liver, is found in both extracellular and intracellular
locations (16, 57). The ability of serovar Typhimurium to
multiply inside professional phagocytic cells has been linked to
virulence in mice (11, 37). Pleiotropic regulators of
Salmonella virulence have been identified and characterized
in the mouse model and in the cultured macrophage cell model as well.
Mutations in any of these regulators render salmonellae avirulent.
These include mutations in two-component regulator systems
(phoP/phoQ and ompR/envZ) (13, 45),
the heat shock protein htrA (30), and sigma
factors (rpoS and rpoE) (14, 29).
The rpoS product,
s, which regulates gene
expression in response to nutrient deprivation during stationary phase,
is known to also regulate the spv genes carried on a plasmid
essential for Salmonella virulence (34). Though
serovar Typhimurium rpoS mutants are avirulent, they
replicate normally inside macrophages (50). On the
contrary, the mutant of rpoE encoding
E,
which is involved in the gene expression for several extracytoplasmic proteins, was severely defective in its ability to survive in macrophages and highly attenuated in mice (29).
To gain a better understanding of why the
clpP and
clpX mutants have lost the ability to cause systemic
disease, we examined the ability of these mutants to replicate inside
macrophages using an in vitro assay with resident peritoneal
macrophages from BALB/c mice and found that none of these mutants could
survive or grow within the peritoneal macrophages of mice (Fig. 5).
While the rates of survival of the
clpP and
clpX mutants were only four- to ninefold lower than that
of the wild-type strain over a 48-h period, the disparity could explain
the reduced growth rate of the mutants in the spleen and liver over the
entire mouse infection period. We cannot explain definitively why the
clpP and
clpX mutants are unable to
replicate intracellularly and are attenuated in mice at present. This
is probably due to the combination of defects generated from the
depletion of the ClpXP protease. The activity would be required to cope
with the accumulation of partially unfolded or denatured protein in
bacteria exposed to various killing mechanisms associated with the host
defense system during infection. Furthermore, the ClpXP protease could
be involved in the expression of virulence genes and/or the turnover of
virulence factors. One virulence gene known to be regulated by ClpP,
rpoS, is also modulated by DksA (68) and MviA
(2) in connection with serovar Typhimurium virulence. DksA
appears to positively regulate the expression of rpoS at the
level of translation. The decreased virulence of a dksA
mutant can be explained, at least partially, by the effect of DksA on
the expression of rpoS, which is required for virulence (14, 50). However, it is probable that
s is
overproduced in serovar Typhimurium
clpP and
clpX mutants, because the ClpXP protease rapidly degrades
s in exponentially growing E. coli
(60). MviA is also known to affect
s
production posttranslationally via proteolysis (2).
Therefore, at present, it is not clear why mutations
(clpP/clpX and mviA) that cause increases in
s levels also attenuate Salmonella virulence.
It would appear that the bacteria need to modulate
s
activity as they encounter areas of high and low stress within the host
during pathogenesis. Alternatively, it is possible that ClpXP directly
modulates the levels of the major contributors for virulence specified
by the SPI-1 and SPI-2 regions on the serovar Typhimurium chromosome.
Of further interest is the finding that the ClpXP-depleted mutant
persists in the mouse for long periods of time without causing an
overwhelming systemic infection. The ability of the ClpXP-depleted mutant to survive and grow within the lymphatic environment of the
mouse was examined by monitoring colonization in the spleens and livers
of mice for up to 35 days. The monitoring revealed that there was
persistence and net growth of serovar Typhimurium with a moderate
growth rate in both organs for 35 days. It is clear that the mice,
while not able to eliminate the ClpXP-depleted mutant organisms, were
able to control growth of the bacterial strain in the lymphatic organs
and survive. Most salmonellae in the spleens and livers of the infected
mice are localized within the phagocytes present in the focal lesions
(57). TNF-
, IFN-
, and nitric acid derivatives appear
to be required for the suppression of Salmonella growth in
the reticuloendothelial system (39, 49, 66). TNF-
is
required for the recruitment of mononuclear cells in the tissues and
for granuloma formation (41) and IFN-
activates
macrophages to kill salmonellae (31). We therefore examined whether the endogenous cytokines TNF-
and IFN-
are necessary for the development of a persistent infection by the serovar
Typhimurium ClpXP-depleted mutant by monitoring bacterial growth
in TNF-
- and IFN-
-deficient mice following infection. In the
organs of these mice, the ClpXP-depleted mutant colonized and
progressively grew, resulting in bacterial counts in the spleens and
livers of the cytokine-deficient mice that were 100- to 1,000-fold higher than normally observed in C57BL/6 mice. These mice did not
survive beyond 10 days postinfection (Fig. 8).
Mice infected with salmonellae become hyper-susceptible to endotoxin. A previous study reported that interleukin-12 neutralization prevented the death of infected mice following subcutaneous injection of lipopolysaccharide (40). It is therefore possible that interleukin-12 is also required to control the persistence of the serovar Typhimurium ClpXP-depleted mutant in mice. The abilities to control growth and persist in the lymphatic organs of the host are considered important in the development of a live vaccine strain. Attenuated Salmonella mutants present potential live vaccine candidates to protect against infection or to deliver heterologous antigen to the mammalian immune system. The present results show that such an attenuated strain may cause severe infections, but only in animals with serious and persistent immunological defects.
Several other serovar Typhimurium strains that cause persistent
infections in mice have been described. These include a purE derivative (52), an ompR mutant
(13), an aroA mutant (6), an
htrA mutant (62), an agfA mutant
(62), and an surA mutant (63).
Whereas these mutants have been well characterized for their potential
usefulness as vaccines against virulent Salmonella infection
and carriers expressing foreign protein antigens derived from unrelated
pathogens, the specific involvement of these genes in persistent
infection has not been demonstrated. Persistent infection is the result
of balance between virulence and host immunity. Though the inability of
the
clpP and
clpX mutants to cause systemic
infection could be explained by the loss of ability to survive or grow
inside macrophages, the conclusion that the mutation somehow
specifically associates with the persistent infection in mice cannot be
definitively reached on the present results.
Systemic infection by serovar Typhimurium in mice closely resembles typhoid fever in humans caused by infection with Salmonella enterica serovar Typhi. It is well known that, in certain persons, S. enterica serovar Typhi persists in the gall bladder and that these persons can shed bacteria in their feces for years as chronic carriers. The ClpXP-depleted mutant in the present study will be useful for resolving the mechanisms by which chronic infection with salmonellae is established and developed, in combination with further studies on the fundamental mechanisms of immunity to salmonellosis.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to R. Curtiss III for sending strain
3306. We
are indebted to M. Zylicz and T. Ogura for their gifts of anti-ClpX antiserum and anti-Lon antiserum, respectively. We thank Y. Hachiman, Y. Ukyo, and A. Tokumitsu for technical assistance. We thank D. Ang for
critical reading of the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Division of Microbiology, Faculty of Pharmaceutical Sciences, Chiba University, 1-33 Yayoi-cho, Inage-ku, Chiba 263-8522, Japan. Phone: 81-43-290-2928. Fax: 81-43-290-2929. E-mail: tomoko-y{at}p.chiba-u.ac.jp.
Editor: A. D. O'Brien
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Baumler, A. J.,
J. G. Kusters,
I. Stojiljkovic, and F. Heffron.
1994.
Salmonella typhimurium loci involved in survival within macrophages.
Infect. Immun.
62:1623-1630 |
| 2. | Benjamin, W. H., Jr., J. Yother, P. Hall, and D. E. Briles. 1991. The Salmonella typhimurium locus mviA regulates virulence in ltys but not ltyr mice: functional mviA results in avirulence; mutant (nonfunctional) mviA results in virulence. J. Exp. Med. 174:1043-1083. |
| 3. | Benjamin, W. H., Jr., P. Hall, S. J. Roberts, and D. E. Briles. 1990. The primary effect of the Ity locus is on the rate of growth of Salmonella typhimurium that are relatively protected from killing. J. Immunol. 144:3143-3151[Abstract]. |
| 4. |
Bliska, J., and S. Falkow.
1992.
Bacterial resistance to complement killing mediated by Ail protein of Yersinia enterocolitica.
Proc. Natl. Acad. Sci. USA
89:3561-3565 |
| 5. |
Buchimeier, N. A., and F. Heffron.
1990.
Induction of Salmonella stress proteins upon infection of macrophages.
Science
248:730-732 |
| 6. | Chatfield, S. N., K. Strahan, D. Pickard, I. G. Charles, C. E. Hormaeche, and G. Dougan. 1992. Evaluation of Salmonella typhimurium strains harbouring defined mutations in htrA and aroA in the murine salmonellosis model. Microb. Pathog. 12:145-151[CrossRef][Medline]. |
| 7. | Chen, L. M., K. Kaniga, and J. E. Galán. 1996. Salmonella spp. are cytotoxic for cultured macrophages. Mol. Microbiol. 21:1101-1115[CrossRef][Medline]. |
| 8. |
Chung, C. H., and A. L. Goldberg.
1981.
The product of the lon (capR) gene in Escherichia coli is the ATP-dependent protease La.
Proc. Natl. Acad. Sci. USA
78:4931-4935 |
| 9. |
Cowing, D. W.,
J. C. A. Bardwell,
E. A. Craig,
C. Woolford,
R. W. Hendrix, and C. Gross.
1985.
Consensus sequence of Escherichia coli heat-shock gene promoters.
Proc. Natl. Acad. Sci. USA
82:2679-2683 |
| 10. |
Curtiss, R., III, and S. M. Kelly.
1987.
Salmonella typhimurium deletion mutants lacking adenylate cyclase and cyclic AMP receptor protein are avirulent and immunogenic.
Infect. Immun.
55:3035-3043 |
| 11. | Daefler, S. 1999. Type III secretion by Salmonella typhimurium does not require contact with a eukaryotic host. Mol. Microbiol. 31:45-51[CrossRef][Medline]. |
| 12. | de Crecy-Lagard, V., P. Servant-Moisson, J. Viala, C. Grandvalet, and P. Mazodier. 1999. Alteration of the synthesis of the Clp ATP-dependent protease affects morphological and physiological differentiation in Streptomyces. Mol. Microbiol. 32:505-517[CrossRef][Medline]. |
| 13. |
Dorman, C. J.,
S. Chatfield,
C. F. Higgins,
C. Hayward, and G. Dougan.
1989.
Characterization of porin and ompR mutants of a virulent strain of Salmonella typhimurium: ompR mutants are attenuated in vivo.
Infect. Immun.
57:2136-2140 |
| 14. |
Fang, F. C.,
S. J. Libby,
N. A. Buchmeier,
P. C. Loewen,
J. Switala,
J. Harwood, and D. G. Guiney.
1992.
The alternative sigma factor katF (rpoS) regulates Salmonella virulence.
Proc. Natl. Acad. Sci. USA
89:11978-11982 |
| 15. |
Field, P. I.,
R. V. Swanson,
C. G. Haidaris, and F. Heffron.
1986.
Mutants of Salmonella typhimurium that cannot survive within the macrophages.
Proc. Natl. Acad. Sci. USA
83:5189-5193 |
| 16. | Finlay, B. B. 1994. Molecular and cellular mechanisms of Salmonella pathogenesis. Curr. Top. Microbiol. Immunol. 192:163-185[Medline]. |
| 17. | Foster, J. W., and M. P. Spector. 1995. How Salmonella survive against the odds. Annu. Rev. Microbiol. 49:145-174[CrossRef][Medline]. |
| 18. | Frees, D., and H. Ingmer. 1999. ClpP participates in the degradation of misfolded protein in Lactococcus lactis. Mol. Microbiol. 31:79-88[CrossRef][Medline]. |
| 19. | Gaillot, O., E. Pellegrini, S. Bregeholt, S. Nair, and P. Berche. 2000. The ClpP serine protease is essential for the intracellular parasitism and virulence of Listeria monocytogenes. Mol. Microbiol. 35:1286-1294[CrossRef][Medline]. |
| 20. | Gottesman, S. 1996. Proteases and their targets in Escherichia coli. Annu. Rev. Genet. 30:465-506[CrossRef][Medline]. |
| 21. |
Gottesman, S.,
W. P. Clark,
V. de Crecy-Lagard, and M. R. Maurizi.
1993.
ClpX, an alternative subunit for the ATP-dependent Clp protease of Escherichia coli.
J. Biol. Chem.
268:22618-22626 |
| 22. | Gulig, P. A., T. J. Doyle, M. J. Clare-Salzler, R. L. Maiese, and H. Matsui. 1997. Systemic infection of mice by wild-type but not Spv 2 Salmonella typhimurium is enhanced by neutralization of gamma interferon and tumor necrosis factor alpha. Infect. Immun. 65:5191-5197[Abstract]. |
| 23. |
Guthrie, B., and W. Wickner.
1990.
Trigger factor depletion or overproduction causes defective cell division but does not block protein export.
J. Bacteriol.
172:5555-5562 |
| 24. | Hashimoto-Gotoh, T., F. C. H. Franklin, A. Nordheim, and K. N. Timmis. 1981. Specific purpose plasmid cloning vectors. I. Low copy number, temperature-sensitive, mobilization-defective pSC101-derived containment vectors. Gene 16:227-235[CrossRef][Medline]. |
| 25. | Hensel, M., J. E. Shea, B. Raupach, D. Monack, S. Falkow, C. Gleeson, and D. W. Holden. 1997. Functional analysis of ssaJ and the ssaK/U operon, 13 genes encoding components of the type III secretion apparatus of Salmonella pathogenicity island 2. Mol. Microbiol. 24:155-167[CrossRef][Medline]. |
| 26. |
Hensel, M.,
J. E. Shea,
C. Gleeson,
M. D. Johrns,
E. Dalton, and D. W. Holden.
1995.
Simultaneous identification of bacterial virulence genes by negative selection.
Science
269:400-403 |
| 27. | Hoiseth, S. K., and B. A. D. Stocker. 1981. Aromatic-dependent Salmonella typhimurium are non-virulent and effective as live vaccines. Nature 291:238-240[CrossRef][Medline]. |
| 28. | Huang, C., S. Wang, L. Chen, C. Lemieux, C. Otis, M. Turmel, and X. Q. Lue. 1994. The Chlamydomonas chloroplast clpP gene contains translated large insertion sequences and is essential for cell growth. Mol. Gen. Genet. 244:151-159[Medline]. |
| 29. |
Humphreys, S.,
A. Stevenson,
A. Bacon,
A. B. Weinhardt, and M. Roberts.
1999.
The alternative sigma factor, E, is critically important for the virulence of Salmonella typhimurium.
Infect. Immun.
67:1560-1568 |
| 30. | Johnson, K., I. Charles, G. Dougan, D. Pickard, P. O'Gaora, G. Costa, T. Ali, I. Miller, and C. Hormaeche. 1991. The role of a stress-response protein in Salmonella typhimurium virulence. Mol. Microbiol. 5:401-407[Medline]. |
| 31. |
Kagaya, K.,
K. Watanabe, and Y. Fukazawa.
1989.
Capacity of recombinant gamma interferon to activate macrophages for Salmonella-killing activity.
Infect. Immun.
57:609-615 |
| 32. | Kessel, M., M. R. Maurizi, B. Kim, E. Kocsis, B. Trus, S. K. Singh, and A. C. Steven. 1995. Homology in structural organization between E. coli ClpAP protease and the eukaryotic 26S proteasome. J. Mol. Biol. 250:587-594[CrossRef][Medline]. |
| 33. | Kleckner, N., J. Bender, and S. Gottesman. 1991. Uses of transposons, with emphasis on Tn10. Methods Enzymol. 204:139-180[Medline]. |
| 34. |
Kowarz, L.,
C. Coynault,
V. Robbe-Saule, and F. Norel.
1994.
The Salmonella typhimurium katF (rpoS) gene: cloning, nucleotide sequence, and regulation of spvR and spvABCD virulence plasmid gene.
J. Bacteriol.
176:6852-6860 |
| 35. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685[CrossRef][Medline]. |
| 36. | Larsen, C. N., and D. Finley. 1997. Protein translocation channels in the proteasome and other proteases. Cell 91:431-434[CrossRef][Medline]. |
| 37. |
Leung, K. Y., and B. B. Finlay.
1991.
Intracellular replication is essential for the virulence of Salmonella typhimurium.
Proc. Natl. Acad. Sci. USA
88:11470-11474 |
| 38. |
Mahan, M. J.,
J. M. Strauch, and J. J. Mekalanos.
1993.
Selection of bacterial virulence genes that are specifically induced in host tissue.
Science
259:686-688 |
| 39. |
Mastroeni, P.,
A. Arena,
G. B. Costa,
M. C. Liberto,
L. Bonina, and C. E. Hormaeche.
1991.
Serum TNF- in mouse typhoid and enhancement of a Salmonella infection by anti-TNF- antibodies on a Salmonella infection in the mouse model.
Microb. Pathog.
14:473-480.
|
| 40. |
Mastroeni, P.,
J. A. Harrison,
J. H. Robinson,
S. Clare,
S. Khan,
D. J. Maskell,
G. Dougan, and C. E. Hormaeche.
1998.
Interleukin-12 required for control of the growth of attenuated aromatic-compound-dependent salmonellae in BALB/c mice: role of gamma interferon and macrophage activation.
Infect. Immun.
66:4767-4776 |
| 41. | Mastroeni, P., J. N. Skipper, and C. E. Hormaeche. 1995. Effect of anti-tumor necrosis factor alpha antibodies on histopathology of primary Salmonella infections. Infect. Immun. 63:3674-3682[Abstract]. |
| 42. | Maurizi, M. R. 1992. Proteases and protein degradation in Escherichia coli. Experientia 48:178-200[CrossRef][Medline]. |
| 43. |
Maurizi, M. R.,
W. P. Clark,
Y. Katayama,
S. Rudikoff, and J. Pumphrey.
1990.
Sequence and structure of ClpP, the proteolytic component of the ATP-dependent Clp protease of Escherichia coli.
J. Biol. Chem.
265:12536-12545 |
| 44. | Menard, R., and P. J. Sansonetti. 1994. Isolation of noninvasive mutants of gram-negative pathogens. Methods Enzymol. 236:493-509[Medline]. |
| 45. |
Miller, S. I.,
A. M. Kakral, and J. J. Mekalanos.
1989.
A two-component regulatory system (phoP phoQ) controls Salmonella typhimurium virulence.
Proc. Natl. Acad. Sci. USA
86:5054-5058 |
| 46. | Mills, D. M., V. Bajaj, and C. A. Lee. 1995. A 40 kb chromosomal fragment encoding Salmonella typhimurium invasion gene is absent from the corresponding region of the Escherichia coli K-12 chromosome. Mol. Microbiol. 15:749-759[CrossRef][Medline]. |
| 47. | Morimoto, R. I., A. Tissieres, and C. Georgopoulos. 1994. Progress and perspectives on the biology of heat shock proteins and molecular chaperone., p. 1-30. In R. I. Morimoto, A. Tissieres, and C. Georgopoulos (ed.), The biology of heat shock proteins and molecular chaperones. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 48. | Msadek, T., V. Dartois, F. Kunst, M. L. Herbaud, F. Denizot, and G. Rapoport. 1998. ClpP of Bacillus subtilis is required for competence, development, motility, degradative enzyme synthesis, growth at high temperature and sporulation. Mol. Microbiol. 27:899-914[CrossRef][Medline]. |
| 49. |
Nauciel, C., and F. Espinasse-Maes.
1992.
Role of gamma interferon and tumor necrosis factor alpha in resistance to Salmonella typhimurium infection.
Infect. Immun.
60:450-454 |
| 50. | Nickerson, C. A., and R. Curtiss, III. 1997. Role of sigma factor RpoS in initial stages of Salmonella typhimurium infection. Infect. Immun. 65:1814-1823[Abstract]. |
| 51. | Nishikawa, S., T. Miura, S. Sasaki, and A. Nakane. 1996. The protective role of endogenous cytokines in host resistance against an intragastric infection with Listeria monocytogenes in mice. FEMS Immunol. Med. Microbiol. 16:291-298[CrossRef][Medline]. |
| 52. |
O'Callaghan, D.,
D. Maskell,
F. Y. Liew,
C. S. F. Easmon, and G. Dougan.
1988.
Characterization of aromatic- and purine-dependent Salmonella typhimurium: attenuation, persistence, and ability to induce protective immunity in BALB/c mice.
Infect. Immun.
56:419-426 |
| 53. |
Ochman, H.,
F. C. Soncini,
F. Solomon, and E. A. Groisman.
1996.
Identification of a pathogenicity island required for Salmonella survival in host cells.
Proc. Natl. Acad. Sci. USA
93:7800-7804 |
| 54. | Pederson, K. J., S. Carlson, and D. E. Pierson. 1997. The ClpP protein, a subunit of the Clp protease, modulates ail gene expression in Yersinia enterocolitica. Mol. Microbiol. 25:99-107. |
| 55. | Phillips, R. W., P. H. Elzer, and R. M. Roop, II. 1995. A Brucella melitensis high temperature-requirement A (htrA) deletion mutant demonstrates a stress response defective phenotype in vitro and transient attenuation in the BALB/c mouse model. Microb. Pathog. 19:277-284. |
| 56. | Porankiewicz, J., J. Wang, and A. K. Clarke. 1999. New insights into the ATP-dependent Clp protease: Escherichia coli and beyond. Mol. Microbiol. 32:449-458[CrossRef][Medline]. |
| 57. |
Richter-Dahlfors, A.,
A. M. J. Buchan, and B. B. Finlay.
1997.
Murine salmonellosis studied by confocal microscopy: Salmonella typhimurium resides intracellularly inside macrophages and exerts a cytotoxic effect on phagocytosis in vivo.
J. Exp. Med.
186:569-580 |
| 58. |
Rohrwild, M.,
O. Coux,
H. C. Huang,
R. P. Moerschell,
S. J. Yoo,
J. H. Seol,
C. H. Chung, and A. L. Goldberg.
1996.
HslV-HslU: a novel ATP-dependent protease complex in Escherichia coli related to the eukaryotic proteasome.
Proc. Natl. Acad. Sci. USA
93:5808-5813 |
| 59. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 60. |
Schweder, T.,
K. H. Lee,
O. Lomovskaya, and A. Martin.
1996.
Regulation of Escherichia coli starvation sigma factor ( s) by ClpXP protease.
J. Bacteriol.
178:470-476 |
| 61. |
Strauch, K. L.,
K. Johnson, and J. Beckwith.
1989.
Characterization of degP, a gene required for proteolysis in the cell envelope and essential for growth of Escherichia coli at high temperature.
J. Bacteriol.
171:2689-2696 |
| 62. | Sukupolvi, S., A. Edelstein, M. Rhen, S. J. Normark, and J. D. Pfeifer. 1997. Development of a murine model of chronic Salmonella infection. Infect. Immun. 65:838-842[Abstract]. |
| 63. |
Sydenham, M.,
G. Douce,
F. Bowe,
S. Ahmed,
S. Chatfield, and G. Dougan.
2000.
Salmonella enterica serovar Typhimurium surA mutants are attenuated and effective live oral vaccines.
Infect. Immun.
68:1109-1115 |
| 64. |
Tagawa, Y.,
K. Sekikawa, and Y. Iwakura.
1997.
Suppression of concanavalin A-induced hepatitis in IFN-gamma( / ) mice, but not in TNF-alpha( / ) mice: role for IFN-gamma in activating apoptosis of hepatocytes.
J. Immunol.
159:1418-1428[Abstract].
|
| 65. | Taniguchi, T., M. Takata, A. Ikeda, E. Momotani, and K. Sekikawa. 1997. Failure of germinal center formation and impairment of response to endotoxin in tumor necrosis factor alpha-deficient mice. Lab. Investig. 77:647-658[Medline]. |
| 66. | Umezawa, K., T. Akaike, S. Fujii, M. Suga, K. Setoguchi, A. Ozawa, and H. Maeda. 1997. Induction of nitric oxide synthesis and xanthine oxidase and their roles in the antimicrobial mechanism against Salmonella typhimurium infection in mice. Infect. Immun. 65:2932-2940[Abstract]. |
| 67. | Volker, U., S. Engelmann, B. Maul, S. Riethdorf, A. Volker, R. Schmid, M. Hiltraut, and M. Hecker. Analysis of the induction of general stress proteins of Bacillus subtilis. Microbiology 140:741-752. |
| 68. | Webb, C., M. Moreno, M. Wilmes-Riesenberg, R. Curtiss III, and J. W. Foster. 1999. Effects of DksA and ClpP protease on sigma S production and virulence in Salmonella typhimurium. Mol. Microbiol. 34:112-123[CrossRef][Medline]. |
| 69. | Yamamoto, T., T. Hanawa, S. Ogata, and S. Kamiya. 1996. Identification and characterization of the Yersinia enterocolitica gsrA gene, which protectively responds to intracellular stress induced by macrophage phagocytosis and to extracellular environmental stress. Infect. Immun. 64:2980-2987[Abstract]. |
| 70. | Yamamoto, T., T. Hanawa, S. Y. Murayama, and S. Ogata. 1994. Isolation of thermosensitive mutants of Yersinia enterocolitica by transposon insertion. Plasmid 32:238-243[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»