Previous Article | Next Article ![]()
Infection and Immunity, May 2001, p. 3190-3196, Vol. 69, No. 5
Centre for Medical Parasitology at Department
of Infectious Diseases, Copenhagen University Hospital (Rigshospitalet)
and Institute for Medical Microbiology and Immunology, University of
Copenhagen, Copenhagen, Denmark1;
Department of Child Health, Korle-Bu Teaching Hospital,
Accra,2 and Immunology Unit, Noguchi
Memorial Institute for Medical Research,
Legon,3 Ghana; and Unité
d'Immunologie Moléculaires des Parasites, CNRS URA
1960,4 and Unité de Biologie
Moleculaire du Gene,5 Institut
Pastéur, Paris, France
Received 29 December 2000/Returned for modification 10 February
2001/Accepted 20 February 2001
Human T cells express antigen
receptors associated in a molecular complex to CD3. In the majority of
T cells, these heterodimer antigen receptors are composed by
disulfide-linked Episodes of clinical Plasmodium falciparum malaria in adults
with little or no previous malaria exposure have been reported to
induce increased levels of Based on the above observations, the present study was undertaken as a
detailed examination of the Donors.
Children (3 to 10 years old) admitted to the
Department of Child Health at Korle-Bu Teaching Hospital with P. falciparum malaria were studied during the peak malaria season,
June to August. The general inclusion criteria were asexual P. falciparum parasitemia (>10,000/ml), axillary temperatures that
were >37.5°C, and negative sickling (HbS) test (metabisulfite
method). In addition, only children with strictly defined cerebral
malaria (CM) or uncomplicated malaria (UM) are included in the present
report. The specific inclusion criteria for these categories have been
described in detail previously (34). Children with severe
malarial anemia were specifically excluded, since our previous studies
have shown that transfusion affects both frequencies and absolute
numbers of T cells in the peripheral blood (27).
Clinically healthy and age-matched children from a nearby community
(Dodowa, Ghana) were included as control donors.
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.5.3190-3196.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Perturbation and Proinflammatory Type Activation of
V
1+ 
T Cells in African Children with
Plasmodium falciparum Malaria
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

T cells have variously been implicated in the protection
against, and the pathogenesis of, malaria, but few studies have examined the 
T-cell response to malaria in African children, who
suffer the large majority of malaria-associated morbidity and
mortality. This is unfortunate, since available data suggest that
simple extrapolation of conclusions drawn from studies of nonimmune
adults ex vivo and in vitro is not always possible. Here we show that
both the frequencies and the absolute numbers of 
T cells are
transiently increased following treatment of Plasmodium
falciparum malaria in Ghanaian children and they can constitute
30 to 50% of all T cells shortly after initiation of antimalarial
chemotherapy. The bulk of the 
T cells involved in this
perturbation expressed V
1 and had a highly activated phenotype.
Analysis of the T-cell receptors (TCR) of the V
1+ cell
population at the peak of their increase showed that all expressed V
chains were used, and CDR3 length polymorphism indicated that the
expanded V
1 population was highly polyclonal. A very high proportion
of the V
1+ T cells produced gamma interferon, while
fewer V
1+ cells than the average proportion of all
CD3+ cells produced tumor necrosis factor alpha. No
interleukin 10 production was detected among TCR-
+
cells in general or V
1+ cells in particular. Taken
together, our data point to an immunoregulatory role of the expanded
V
1+ T-cell population in this group of semi-immune
P. falciparum malaria patients.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
and
chains (39), while a minority
instead employ receptors composed of
and
chains
(8). The latter population, which in healthy Caucasians
normally constitutes less than 5% of peripheral T cells, can be
subdivided into two largely nonoverlapping subsets (32, 37). The former of these subsets usually comprises more than two-thirds of all the 
T cells and is characterized by
disulfide-linked V
9 and V
2 chains, whereas the other, smaller
subset uses a V
I gene product non-disulfide linked to
products of V
genes other than V
9
(12, 47, 48). In contrast, among healthy individuals in
Africa, particularly children, the average frequency of
TCR-
+ cells may be as high as 10% or more and
dominated by V
1+ cells rather than V
9+
cells (25).

T cells, often persisting for several
weeks (23, 44, 45). The V
9 subset of 
T cells was
found to dominate the in vivo 
T-cell response in those studies,
and several studies of nonexposed donors have shown preferential outgrowth of V
9+ cells following malaria antigen
stimulation in vitro (3, 15). In contrast, studies from
areas where malaria is endemic have failed to confirm both the
V
9+ cell dominance of the TCR-
+
response to malaria (16, 49) and persistent in vivo
increases in the frequency of TCR-
+ cells
(26). Preliminary data obtained during the latter study rather suggested the presence of very transient but pronounced 
T-cell perturbations immediately following the patient's admission to
a hospital.

T-cell response to P. falciparum malaria in an area where malaria is endemic.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Blood samples.
Samples (250 to 400 µl) of
EDTA-anticoagulated blood were obtained from the patients at admission
(day 0) and subsequently on days 1, 2, 4, and 21 or once only (4 to 5 ml; day 2) for the analysis of cytokine production and of V
chain
usage and CDR3 length polymorphism of V
1+ T cells. A
single 4- to 5-ml sample was obtained from the healthy control
children. Thick and thin Giemsa-stained blood smears were prepared from
each sample, and hematological analysis was done using an automatic
hematology analyzer (Beckman Coulter, Fullerton, Calif.) before further
processing. Analysis of CDR3 length polymorphism was done using
peripheral blood mononuclear cells (PBMC) isolated by density
centrifugation and cryopreserved in liquid nitrogen as described
previously (25).
Monoclonal antibodies.
Monoclonal antibodies (MAb) directed
against the following determinants were used in this study: CD3 (UCHT1;
DAKO, Glostrup, Denmark), CD4 (MT310; DAKO), CD8 (DK25; DAKO), CD69
(Leu-23; BD PharMingen, San Diego, Calif.), CD45RA (4KB5; DAKO), CD45R0
(UCHL1; DAKO), TcR-
(11F2; BD PharMingen), V
2,3,4 (23D12;
Beckman Coulter), V
3,5 (56.3; a kind gift from Dieter Kabelitz,
Hamburg, Germany), V
4 (4A11; BIOAdvance, Emerainville, France),
V
8 (R4.5; Beckman Coulter), V
9 (7A5; Endogen, Woburn, Mass.),
V
1-J
1 (
TCS1; Endogen), and HLA-DR (G46-6; BD PharMingen).
Appropriate isotype control antibodies were always included. Most MAb
were used as direct conjugates to fluorescein isothiocyanate (FITC),
phycoerythrin, or Cy5. In the remaining cases, biotinylated or
unconjugated primary antibody was used and labeled with
FITC-streptavidin (DAKO), FITC-F(ab')2 (DAKO), or
RPE-Cy5-F(ab')2 (DAKO) as second-step reagents.
Cell phenotyping. The plasma was removed following centrifugation, and the cell pellet was resuspended to its original volume in phosphate-buffered saline (PBS). Fifty-microliter aliquots were subsequently labeled (20 min; room temperature) with directly conjugated MAb or appropriate nonspecific isotype control antibodies, followed by lysis of erythrocytes (fluorescence-activated cell sorter lysing solution; BD PharMingen). Samples were then washed twice in PBS and analyzed on a FACScan flow cytometer (BD PharMingen). All samples were live gated by forward and side scatter on lymphocytes, and 5,000 to 10,000 events were collected.
Intracellular cytokine detection.
One-milliliter aliquots of
whole blood were incubated with monensin (1.5 µM; Sigma, St. Louis,
Mo.), ionomycin (1 µM) and phorbol myristate acetate (50 µg/ml) for
90 min. Following surface staining (CD3, CD8, TCR-
) and
erythrocyte lysis, the cells were washed twice in a freshly made
saponin buffer (PBS-bovine serum albumin-NaN3 containing
0.1% [wt/vol] saponin [Sigma]) and finally incubated with
anticytokine (gamma interferon [IFN-
] tumor necrosis factor alpha
[TNF-
], or interleukin 10 [IL-10]; BD PharMingen) antibody for
30 min in the dark (4°C). Following cytokine labeling, the cells were
washed twice in saponin buffer and twice in staining buffer,
resuspended in the same buffer, and analyzed by flow cytometry as
described above.
CDR3 size polymorphism analysis.
Total mRNA was prepared
from 1 × 106 to 5 × 106
RNAzol-preserved PBMC according to the manufacturer's instructions
(Bioprobe Systems, Montreuil, France). Single-stranded cDNA was
subsequently synthesized using the superscript inverse transcriptase
(Gibco-BRL, Gaithersburg, Md.). The analysis of the CDR3 size
distribution of the V
1-C
rearrangements was done according to the
protocol already described (7). The V
1- and
C
-specific primers used, oriented 5' to 3', were V
1
(CTGTCAACTTCAAGAAAGCAGCGAAATC) and C
-fam
(ACGGATGGTTTGGTAGAGGCTGA). To compare the V
1 CDR3
profiles obtained from patient and control PBMC, we used a clonality
index derived from the Nei diversity index (33). This
index measures the probability that two randomized V
1 T cells have
the same CDR3 length. For each sample, the frequency of TV
1 cells
with a given CDR3 length is expressed as xi,
corresponding to the fluorescence intensity of peak number i
divided by the sum of the fluorescence intensities of all peaks
(n). The index of clonality (I) of the TV
1 cells is then
calculated as I =
(xi)2.
Data presentation and statistical analysis. Summary statistics are given as means and standard errors of the means (SEM). Comparison of patient groups at individual time points was done by two-factor analysis of variance (F) supplemented with the Student-Newman-Keuls test. Indices of clonality were compared by the Mann-Whitney test (T).
| |
RESULTS |
|---|
|
|
|---|
Initiation of antimalarial therapy causes a rapid, but transient,
increase in frequencies and absolute numbers of 
T cells in the
peripheral circulation.
In healthy Caucasians, less than 5% of
circulating CD3+ cells express T-cell receptor (TCR)-
(17, 36), but the average frequency of
TCR-
+ cells may be as high as 10% in some African
populations (25). It is well established that 
T
cells from nonexposed donors respond to stimulation by malaria antigen
preparations in vitro (3, 14, 15), but few studies from
areas where malaria is highly endemic have examined malaria-induced
changes in 
T cells in vivo (26). In the present
study, about 15% of circulating CD3+ cells from P. falciparum malaria patients carried TCR-
at the time of the
patient's admission to a hospital prior to initiation of chemotherapy
(day 0) (Fig. 1, upper panels, and Fig.
2, left panels). This value is only
slightly higher than the steady-state levels found in healthy,
age-matched children in the same area (25, 26). However,
within the next few days, the proportion of 
T cells rapidly
rose, peaking in most cases around day 2 (P [F] < 0.001),
before returning to steady state within 1 week following admission. The
increase in the frequency of TCR-
+ cells was more
pronounced with children with CM (Fig. 1, upper left panel, and Fig. 2)
than with children with UM (Fig. 1, upper right panel), but this
difference was not significant (P [F] = 0.15). In a few CM
patients, more than 50% of the CD3+ cells present in the
peripheral blood on day 2 expressed TCR-
. Examination of absolute
peripheral blood cell numbers showed that the 
T-cell
perturbation persisted longer in CM patients than in UM patients (Fig.
1, lower panels).
|
|
The acquired 
T-cell response is dominated by V
1 cells,
with negligible involvement of other 
T-cell subsets.
While
V
9+ is by far the dominant 
T-cell subset in
healthy Caucasians, this is not the case in healthy individuals living in areas where malaria is endemic (16, 25). Furthermore,
increased proportions of both the V
9+ subset and the
largely complementary V
1+ subset have been reported
following P. falciparum malaria in patients from areas where
malaria is endemic (23, 49). Only the former of these
subsets responds to malaria antigen stimulation in vitro (3,
15). As shown in Fig. 1 and 2, V
1+ cells
dominated among TCR-
+ cells at all time points,
whether expressed as fractions of CD3+ cells or as absolute
numbers of cells. Furthermore, essentially all the disturbances in the
proportions and numbers of TcR-
+ cells that were
observed in the patients within the first week after admission were due
to perturbations within the V
1 subset (Fig. 1 and 2) (P [F] < 0.001 [between days]; P [F] = 0.10 [between patient categories]).
The 
T cells present in the peripheral circulation initially
have an activated phenotype.
We have previously hypothesized that
the rapid therapy-induced correction of the lymphopenia in malaria
patients reflects the emergence of T cells into the peripheral
circulation from sites of disease-induced sequestration and
proliferation (11, 27-29). Since T-cell adhesion is a
consequence of previous activation, and since our data suggest that

T cells are released very rapidly following treatment, we
proceeded to examine the level of expression of activation markers on
the 
T cells at various time points. A large proportion of
TCR-
+ cells, and in particular the V
1+
subset of these cells, obtained at various time points after initiation
of therapy expressed the early (CD69) and late (HLA-DR) markers of
activation (Fig. 3). There was no marked
difference in the level of 
T-cell activation between CM and UM
patients, and in Fig. 3 the data from all donors are shown together.
The expression of CD69 and HLA-DR on TCR-
+ cells and
on T cells in general was similar (not shown), with the exception of
V
1+ cells which showed a much higher level of expression
of both markers (Fig. 3).
|
V
1+ T cells use all expressed V
chains.
The
very high frequencies and absolute numbers of V
1+ cells
around day 2 after initiation of therapy prompted us to examine the TCR
usage of these cells in more detail. As seen in Fig.
4, V
1+ cells expressing
all V
gene products could be identified in all children
examined this way at day 2, without marked differences between UM and
CM patients. The most common phenotype among the V
1+
cells was cells labeled by MAb 23D12, which reacts with cells expressing V
2, V
3, or V
4, but all expressed V
chains were identified among the V
1+ cells, as observed previously
(25). The data did not suggest expansion of
V
1+ cells bearing particular V
chains. Cocktails of
all the V
antibodies labeled only about 85% of the
V
1+ cells, in contrast to experiments done in parallel
on healthy children, where essentially all V
1+ cells
were labeled by the antibody cocktail. The reason for this difference
is unclear and is under investigation.
|
The high proportion of V
1+ cells is not caused by
conventional antigen-driven proliferation.
In the absence of
evidence of unusual dominance of particular V
-V
combinations, we
proceeded to investigate whether the high proportion of
V
1+ cells was driven by antigen recognized by V
1
alone. This was done by size spectratyping of the CDR3 antigen
recognition domain of V
1 (43). This analysis was
completed for day-2 samples from 5 UM and 13 CM patients, in addition
to samples from 13 healthy control children, and revealed no obvious
differences between patients and control donors or between patient
groups (Fig. 5). Supplementary clonality
index analysis, taking into consideration both the degree of CDR3
length polymorphism and the percentage of V
1+ cells, did
not show significant differences (P [T] = 0.29) between patients and controls or among patient groups (Fig. 5).
|
V
1+ cells have a cytokine profile different from
that of CD3+ cells in general.
As a final element in
our characterization of the V
1+ cells involved in the
perturbation of this subset following malaria, we evaluated
subset-specific production of three major T-cell cytokines, IFN-
,
TNF-
, and IL-10. Figure 6 shows that
the proportions of cytokine-producing CD3+ cells,
TCR-
+ cells, and V
1+ cells were
significantly different (P [F] < 0.001). Thus,
intracellular IFN-
could be detected in almost twice as many
TCR-
+ cells and V
1+ cells as among
CD3+ cells in general. Conversely, TCR-
+
cells and V
1+ cells produced substantially less TNF-
than CD3+ cells in general (P [F] < 0.001).
We did not detect any IL-10 production by TCR-
+ cells
(not shown).
|
| |
DISCUSSION |
|---|
|
|
|---|

T cells have been implicated in the immune response to
malaria (reviewed in reference 35), but few studies have
examined individuals exposed to malaria parasites in areas where the
disease is endemic. This is problematic, since the limited evidence
available from such studies indicates that a simple extrapolation from
studies of nonexposed individuals may not always be possible (16,
26, 49). Thus, the sustained and
V
9+-cell-dominated responses seen in nonexposed
individuals caused by cells activated by phosphorylated nonpeptide
antigens present in malaria parasites (4) were not seen in
the above-cited studies in Africa.
Here we present evidence that children from areas where malaria
is endemic show a very pronounced, but transient, 
T-cell response during treatment of P. falciparum malaria.
This perturbation peaked around day 2 after initiation of
antimalarial chemotherapy and thus occurred considerably earlier than
the TCR-
lymphopenia-to-lymphocytosis-to-homeostasis sequence reported from the same area (27). It is likely
that the perturbation is induced by a therapy-mediated alleviation of
tissue inflammation and that the transiently increased frequency and
absolute numbers represent cells emerging from sites of malaria-induced sequestration and expansion (reviewed in reference 24).
Subset analysis at the time of peak frequency and the number of
TCR-
+ cells revealed that the peak was totally
dominated by changes in cells using V
1 in their TCR, while only very
minor perturbations were seen among V
1-negative 
T cells. In
contrast to the healthy children that we have previously studied in the
same area (25), the V
1+ cells obtained at
day 2 of treatment from the malaria patients studied here showed marked
evidence of activation. The expanded V
1+ population at
this time was not characterized by particular V
-chain usage and did
not show significant dominance of certain CDR3 lengths. In all these
respects, our patients resemble those from other studies of infectious
diseases, such as HIV infection and autoimmune disorders (6, 10,
21, 38, 41).
The transient increase in circulating V
1+ T cells in the
absence of evidence of conventional antigen-driven expansion of
V
1+ T cells during P. falciparum malaria
raises the question of its cause. In vitro stimulation of T cells from
unexposed donors by crude P. falciparum antigen causes
expansion of V
9+ V
2+ cells but not of
V
1+ cells (3, 15). In line with this, we
did not find a significant relation between in vivo frequencies of
V
1+ cells and asymptomatic parasitemia
(25).
The V
9+ V
2+ T-cell response to
stimulation by P. falciparum preparations is caused by
recognition of nonpeptide phosphorylated antigens found in numerous
bacteria and protozoa, including P. falciparum (4,
9). While the antigens that are recognized by these cells are
thus well characterized, little is known about the antigens recognized
by V
1+ cells (reviewed in reference 40). It
has been proposed that these cells respond to stress- or
infection-induced molecules on a variety of cell types, including
epithelial cells and B cells. Specifically, V
1+ cells
have been reported to recognize the weakly polymorphic major
histocompatibility complex class I-like molecules MICA and MICB
(18, 19). However, the same authors have recently shown that it is NKG2D rather than TCR-
that is the MICA and MICB receptor (2). Other recent work has demonstrated
recognition of CD1c molecules expressed on dendritic cells and B cells
by V
1+ clones expressing various V
chains
(46).
Finally, it should be noted that although the conditions that have been
described as being characterized by locally or systemically increased
levels of V
1+ T cells are seemingly very heterogeneous,
they all share evidence of polyclonal B-cell activation. This is not
least the case in malaria (1, 13), and it is thus of
interest that activated B cells are an antigenic target of
V
1+ T cells (20, 30, 42). Although T-cell
activation is a general feature of P. falciparum malaria
(11, 29), we found particularly high levels of activation
among V
1+ T cells. The lack of evidence of particular
antigens driving the expansion of V
1+ cells, and their
preponderance in situations where B-cell activation is a major feature,
make it tempting to speculate that they are in fact regulatory cells
responding to self antigens expressed by activated B cells. An
autoregulatory role for 
T cells has been proposed in several
recent reviews (5, 22). The antigens recognized by such
putative B-cell-regulatory V
1+ T cells remain unknown,
but the observation that certain cytotoxic T cells expressing
TCR-
recognize idiotype is intriguing in this context (31,
50). A B-cell-cytotoxic role for the V
1+ T cells
in our malaria patients is consistent with the observed ex vivo
cytokine production profile of these cells, which resembles that of
CD8+ cells, and is furthermore in line with our preliminary
in vitro experiments (unpublished data). We are currently
characterizing a panel of V
1+ 
T-cell clones from
an individual from our study area to pursue this issue further.
In conclusion, we have shown that patients with previous parasite
exposure and who are undergoing treatment for P. falciparum malaria transiently show markedly increased levels of highly activated V
1+ T cells having a proinflammatory cytokine profile.
These cells are not restricted by particular V
chains and do not
appear to expand in response to a specific antigen recognized by a
limited set of V
1+ clones. Taken together, the data
point to an immunoregulatory role of these cells. This is the first
detailed longitudinal study of the 
T-cell response to P. falciparum malaria in children from Africa, i.e., those who suffer
most of the morbidity and essentially all the mortality from this
disease. Our findings are at variance with most previous data from ex
vivo and in vitro studies of nonimmune adults and thus emphasize the
extreme caution necessary when extrapolating from model laboratory
investigations to the situation in the main target population of this
major health problem.
| |
ACKNOWLEDGMENTS |
|---|
We thank Marc M. Addae, Alex Coffie, Abdelrahman Hammond, Enid Owusu, Gitte Pedersen, and John Tsakpo for excellent technical assistance. The cooperation of the donors and their guardians is gratefully acknowledged.
This study received financial support from the ENRECA program of the Danish International Development Assistance (Danida; grant no. 14.Dan.8.L.306), the International Co-operation with Developing Countries (INCO-DC) program of the European Commission (grant no. IC18-CT98-0370), the Danish Medical Research Council (SSVF; grant no. 9802405), and the Danish Research Council for Development Research (RUF; grant no. 90900).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Infectious Diseases M7641, Rigshospitalet, Tagensvej 20, 2200 Copenhagen N, Denmark. Phone: (45) 35 45 79 57. Fax: (45) 35 45 76 44. E-mail: lhcmp{at}rh.dk.
Editor: W. A. Petri Jr.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Banic, D. M., F. S. Viana-Martins, J. M. De Souza, T. D. Peixoto, and C. Daniel-Ribeiro. 1991. Polyclonal B-lymphocyte stimulation in human malaria and its association with ongoing parasitemia. Am. J. Trop. Med. Hyg. 44:571-577. |
| 2. |
Bauer, S.,
V. Groh,
J. Wu,
A. Steinle,
J. H. Phillips,
L. L. Lanier, and T. Spies.
1999.
Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA.
Science
285:727-729 |
| 3. |
Behr, C., and P. Dubois.
1992.
Preferential expansion of V 9V 2 T cells following stimulation of peripheral blood lymphocytes with extracts of Plasmodium falciparum.
Int. Immunol.
4:361-366 |
| 4. |
Behr, C.,
R. Poupot,
M. A. Peyrat,
Y. Poquet,
P. Constant,
P. Dubois,
M. Bonneville, and J. J. Fournie.
1996.
Plasmodium falciparum stimuli for human ![]() T cells are related to phosphorylated antigens of mycobacteria.
Infect. Immun.
64:2892-2896 |
| 5. |
Born, W.,
C. Cady,
J. Jones-Carson,
A. Mukasa,
M. Lahn, and R. O'Brien.
1999.
Immunoregulatory functions of ![]() T cells.
Adv. Immunol.
71:77-144[Medline].
|
| 6. |
Boullier, S.,
M. Cochet,
F. Poccia, and M.-L. Gougeon.
1995.
CDR3-independent ![]() V 1+ T cell expansion in the peripheral blood of HIV-infected persons.
J. Immunol.
154:1418-1431[Abstract].
|
| 7. |
Boullier, S.,
G. Dadaglio,
A. Lafeuillade,
T. Debord, and M.-L. Gougeon.
1997.
V 1 T cells expanded in the blood throughout HIV infection display a cytotoxic activity and are primed for TNF- and IFN- production but are not selected in lymph nodes.
J. Immunol.
159:3629-3637[Abstract].
|
| 8. | Brenner, M. B., J. McLean, D. P. Dialynas, J. L. Strominger, J. A. Smith, F. L. Owen, J. G. Seidman, S. Ip, F. Rosen, and M. S. Krangel. 1986. Identification of a putative second T-cell receptor. Nature 322:145-149[CrossRef][Medline]. |
| 9. |
Constant, P.,
F. Davodeau,
M.-A. Peyrat,
Y. Poquet,
G. Puzo,
M. Bonneville, and J.-J. Fournié.
1994.
Stimulation of human ![]() T cells by nonpeptidic mycobacterial ligands.
Science
264:267-270 |
| 10. |
De Maria, A.,
A. Ferrazin,
S. Ferrini,
E. Ciccone,
A. Terragna, and L. Moretta.
1992.
Selective increase of a subset of T cell receptor ![]() T lymphocytes in the peripheral blood of patients with human immunodeficiency virus type 1 infection.
J. Infect. Dis.
165:917-919[Medline].
|
| 11. | Elhassan, I. M., L. Hviid, G. Satti, B. Akerström, P. H. Jakobsen, J. B. Jensen, and T. G. Theander. 1994. Evidence of endothelial inflammation, T cell activation, and T cell reallocation in uncomplicated Plasmodium falciparum malaria. Am. J. Trop. Med. Hyg. 51:372-379. |
| 12. |
Faure, F.,
S. Jitsukawa,
F. Triebel, and T. Hercend.
1988.
Characterization of human peripheral lymphocytes expressing the CD3- / complex with anti-receptor monoclonal antibodies.
J. Immunol.
141:3357-3360[Abstract].
|
| 13. | Freeman, R. R., and C. R. Parish. 1978. Polyclonal B-cell activation during rodent malarial infections. Clin. Exp. Immunol. 32:41-45[Medline]. |
| 14. |
Goerlich, R.,
G. Häcker,
K. Pfeffer,
K. Heeg, and H. Wagner.
1991.
Plasmodium falciparum merozoites primarily stimulate the V 9 subset of human / T cells.
Eur. J. Immunol.
21:2613-2616[Medline].
|
| 15. |
Goodier, M.,
P. Fey,
K. Eichmann, and J. Langhorne.
1992.
Human peripheral blood ![]() T cells respond to antigens of Plasmodium falciparum.
Int. Immunol.
4:33-41 |
| 16. |
Goodier, M.,
M. Krause-Jauer,
A. Sanni,
A. Massougbodji,
B.-C. Sadeler,
G. H. Mitchell,
M. Modolell,
K. Eichmann, and J. Langhorne.
1993.
![]() T cells in the peripheral blood of individuals from an area of holoendemic Plasmodium falciparum transmission.
Trans. R. Soc. Trop. Med. Hyg.
87:692-696[CrossRef][Medline].
|
| 17. |
Groh, V.,
S. Porcelli,
M. Fabbi,
L. L. Lanier,
L. J. Picker,
T. Anderson,
R. A. Warnke,
A. K. Bhan,
J. L. Strominger, and M. B. Brenner.
1989.
Human lymphocytes bearing T cell receptor / are phenotypically diverse and evenly distributed throughout the lymphoid system.
J. Exp. Med.
169:1277-1294 |
| 18. |
Groh, V.,
R. Rhinehart,
H. Secrist,
S. Bauer,
K. H. Grabstein, and T. Spies.
1999.
Broad tumor-associated expression and recognition by tumor-derived ![]() T cells of MICA and MICB.
Proc. Natl. Acad. Sci. USA
96:6879-6884 |
| 19. |
Groh, V.,
A. Steinle,
S. Bauer, and T. Spies.
1998.
Recognition of stress-induced MHC molecules by intestinal epithelial ![]() T cells.
Science
279:1737-1740 |
| 20. |
Hacker, G.,
S. Kromer,
M. Falk,
K. Heeg,
H. Wagner, and K. Pfeffer.
1992.
V 1+ subset of human ![]() T cells responds to ligands expressed by EBV-infected Burkitt lymphoma cells and transformed B lymphocytes.
J. Immunol.
149:3984-3989[Abstract].
|
| 21. |
Halstensen, T. S.,
H. Scott, and P. Brandtzaeg.
1989.
Intraepithelial T cells of the TcR / + CD8 V 1/J 1+ phenotypes are increased in coeliac disease.
Scand. J. Immunol.
30:665-672[CrossRef][Medline].
|
| 22. |
Hayday, A., and L. Geng.
1997.
![]() cells regulate autoimmunity.
Curr. Opin. Immunol.
9:884-889[CrossRef][Medline].
|
| 23. |
Ho, M.,
P. Tongtawe,
J. Kriangkum,
T. Wimonwattrawatee,
K. Pattanapanyasat,
L. Bryant,
J. Shafiq,
P. Suntharsamai,
S. Looareesuwan,
H. K. Webster, and J. F. Elliott.
1994.
Polyclonal expansion of peripheral ![]() T cells in human Plasmodium falciparum malaria.
Infect. Immun.
62:855-862 |
| 24. | Hviid, L. 1995. Peripheral T-cell non-responsiveness in individuals exposed to Plasmodium falciparum malaria. APMIS 103(Suppl. 53):1-46[Medline]. |
| 25. |
Hviid, L.,
B. D. Akanmori,
S. Loizon,
J. A. L. Kurtzhals,
C. H. Ricke,
A. Lim,
K. A. Koram,
F. K. Nkrumah,
O. Mercereau-Puijalon, and C. Behr.
2000.
High frequency of circulating ![]() T cells with dominance of the V 1 subset in a healthy population.
Int. Immunol.
12:797-805 |
| 26. |
Hviid, L.,
J. A. L. Kurtzhals,
D. Dodoo,
O. Rodrigues,
A. Ronn,
J. O. O. Commey,
F. K. Nkrumah, and T. G. Theander.
1996.
The / T-cell response to Plasmodium falciparum malaria in a population in which malaria is endemic.
Infect. Immun.
64:4359-4362 |
| 27. | Hviid, L., J. A. L. Kurtzhals, B. Q. Goka, J. O. Oliver-Commey, F. K. Nkrumah, and T. G. Theander. 1997. Rapid reemergence of T cells into peripheral circulation following treatment of severe and uncomplicated Plasmodium falciparum malaria. Infect. Immun. 65:1090-1093. |
| 28. | Hviid, L., T. G. Theander, N. H. Abdulhadi, Y. A. Abu-Zeid, R. A. Bayoumi, and J. B. Jensen. 1991. Transient depletion of T cells with high LFA-1 expression from peripheral circulation during acute Plasmodium falciparum malaria. Eur. J. Immunol. 21:1249-1253[Medline]. |
| 29. | Hviid, L., T. G. Theander, Y. A. Abu-Zeid, N. H. Abdulhadi, P. H. Jakobsen, B. O. Saeed, S. Jepsen, R. A. L. Bayoumi, and J. B. Jensen. 1991. Loss of cellular immune reactivity during acute Plasmodium falciparum malaria. FEMS Microbiol. Immunol. 76:219-228[CrossRef]. |
| 30. |
Hyjek, E. M.,
J. Bartkowiak,
R. Drozdz,
T. J. Wasik,
M. Jasinski,
Y. Kaneko,
H. W. Lischner, and D. Kozbor.
1997.
Evidence for B cell-mediated activation of V 1+ T lymphocytes during progression of HIV infection.
J. Immunol.
158:464-474[Abstract].
|
| 31. |
Kim, H. T.,
E. L. Nelson,
C. Clayberger,
M. Sanjanwala,
J. Sklar, and A. M. Krensky.
1995.
![]() T cell recognition of tumor Ig peptide.
J. Immunol.
154:1614-1623[Abstract].
|
| 32. |
Krangel, M. S.,
H. Band,
S. Hata,
J. McLean, and M. B. Brenner.
1987.
Structurally divergent human T cell receptor gamma proteins encoded by distinct C genes.
Science
237:64-67 |
| 33. | Krener, A., R. J. Petit, and O. Pons. 1998. Measures of polymorphism within and among populations, p. 301-311. In A. Karp, P. G. Isaac, and D. S. Ingram (ed.), Molecular tools for screening biodiversity. Chapman & Hall, London, England. |
| 34. | Kurtzhals, J. A. L., O. Rodrigues, M. Addae, J. O. O. Commey, F. K. Nkrumah, and L. Hviid. 1997. Reversible suppression of bone marrow response to erythropoietin in Plasmodium falciparum malaria. Br. J. Haematol. 97:169-174[CrossRef][Medline]. |
| 35. |
Langhorne, J.,
M. Goodier,
C. Behr, and P. Dubois.
1992.
Is there a role for ![]() cells in malaria ?
Immunol. Today
13:298-300[CrossRef][Medline].
|
| 36. |
Lanier, L. L.,
J. Ruitenberg,
R. L. Bolhuis,
J. Borst,
J. H. Phillips, and R. Testi.
1988.
Structural and serological heterogeneity of / T cell antigen receptor expression in thymus and peripheral blood.
Eur. J. Immunol.
18:1985-1992[Medline].
|
| 37. | Littman, D. R., M. Newton, D. Crommie, S. L. Ang, J. G. Seidman, S. N. Gettner, and A. Weiss. 1987. Characterization of an expressed CD3-associated Ti gamma-chain reveals C gamma domain polymorphism. Nature 326:85-88[CrossRef][Medline]. |
| 38. |
Meliconi, R.,
C. Pitzalis,
G. H. Kingsley, and G. S. Panayi.
1991.
/ T cells and their subpopulations in blood and synovial fluid from rheumatoid arthritis and spondyloarthritis.
Clin. Immunol. Immunopathol.
59:165-172[CrossRef][Medline].
|
| 39. | Meuer, S. C., O. Acuto, R. E. Hussey, J. C. Hodgdon, K. A. Fitzgerald, S. F. Schlossman, and E. L. Reinherz. 1983. Evidence for the T3-associated 90K heterodimer as the T-cell antigen receptor. Nature 303:808-810[CrossRef][Medline]. |
| 40. |
Morita, C. T.,
R. A. Mariuzza, and M. B. Brenner.
2000.
Antigen recognition by human ![]() T cells: pattern recognition by the immune system.
Springer Semin. Immunopathol.
22:191-218[CrossRef][Medline].
|
| 41. |
Ohta, M., and N. Sato.
1994.
The cytotoxic analysis of T cell receptor V 1+ T cell lines derived from the synovial fluid of rheumatoid arthritis patients.
Clin. Exp. Immunol.
97:193-199[Medline].
|
| 42. |
Orsini, D. L.,
M. van Gills,
Y. M. Kooy,
L. Struyk,
G. Klein,
P. van-den Elsen, and F. Koning.
1994.
Functional and molecular characterization of B cell-responsive V 1+ ![]() T cells.
Eur. J. Immunol.
24:3199-3204[Medline].
|
| 43. |
Pannetier, C.,
M. Cochet,
S. Darche,
A. Casrouge,
M. Zoller, and P. Kourilsky.
1993.
The sizes of the CDR3 hypervariable regions of the murine T-cell receptor chains vary as a function of the recombined germ-line segments.
Proc. Natl. Acad. Sci. USA
90:4319-4323 |
| 44. |
Roussilhon, C.,
M. Agrapart,
J.-J. Ballet, and A. Bensussan.
1990.
T lymphocytes bearing the ![]() T cell receptor in patients with acute Plasmodium falciparum malaria.
J. Infect. Dis.
162:283-285[Medline].
|
| 45. |
Roussilhon, C.,
M. Agrapart,
P. Guglielmi,
A. Bensussan,
P. Brasseur, and J. J. Ballet.
1994.
Human TcR![]() + lymphocyte response on primary exposure to Plasmodium falciparum.
Clin. Exp. Immunol.
95:91-97[Medline].
|
| 46. |
Spada, F. M.,
E. P. Grant,
P. J. Peters,
M. Sugita,
A. Melián,
D. S. Leslie,
H. K. Lee,
E. Van Donselaar,
D. A. Hanson,
A. M. Krensky,
O. Majdic,
S. A. Porcelli,
C. T. Morita, and M. B. Brenner.
2000.
Self-recognition of CD1 by / T cells: implications for innate immunity.
J. Exp. Med.
191:937-948 |
| 47. |
Triebel, F.,
F. Faure,
M. Graziani,
S. Jitsukawa,
M. P. Lefranc, and T. Hercend.
1988.
A unique V-J-C-rearranged gene encodes a protein expressed on the majority of CD3+ T cell receptor- /![]() circulating lymphocytes.
J. Exp. Med.
167:694-699 |
| 48. |
Triebel, F.,
F. Faure,
F. Mami-Chouaib,
S. Jitsukawa,
A. Griscelli,
C. Genevee,
R. S. Roman, and T. Hercend.
1988.
A novel human V gene expressed predominantly in the Ti A fraction of / + peripheral lymphocytes.
Eur. J. Immunol.
18:2021-2027[Medline].
|
| 49. |
Worku, S.,
A. Björkman,
M. Troye-Blomberg,
L. Jemaneh,
A. Färnert, and B. Christensson.
1997.
Lymphocyte activation and subset redistribution in the peripheral blood in acute malaria illness: distinct ![]() + T cell patterns in Plasmodium falciparum and P. vivax infections.
Clin. Exp. Immunol.
108:34-41[CrossRef][Medline].
|
| 50. |
Wright, A.,
J. E. Lee,
M. P. Link,
S. D. Smith,
W. Carroll,
R. Levy,
C. Clayberger, and A. M. Krensky.
1989.
Cytotoxic T lymphocytes specific for self tumor immunoglobulin express T cell receptor delta chain.
J. Exp. Med.
169:1557-1564 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»