Previous Article | Next Article 
Infection and Immunity, May 2001, p. 3398-3409, Vol. 69, No. 5
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.5.3398-3409.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Molecular Basis for Immunoglobulin M Specificity to Epitopes in
Cryptococcus neoformans Polysaccharide That Elicit
Protective and Nonprotective Antibodies
Antonio
Nakouzi,1
Philippe
Valadon,2
Joshua
Nosanchuk,1
Nancy
Green,3 and
Arturo
Casadevall1,4,*
Division of Infectious Diseases, Department
of Medicine,1 and Departments of
Pediatrics3 and Microbiology and
Immunology,4 Albert Einstein College of
Medicine, Bronx, New York 10461, and Sidney Kimmel Cancer
Center, San Diego, California 921212
Received 22 December 2000/Returned for modification 24 January
2001/Accepted 7 February 2001
 |
ABSTRACT |
The protective efficacy of antibodies (Abs) to Cryptococcus
neoformans glucuronoxylomannan (GXM) is dependent on Ab fine
specificity. Two clonally related immunoglobulin M monoclonal Abs
(MAbs) (12A1 and 13F1) differ in fine specificity and protective
efficacy, presumably due to variable (V)-region sequence differences
resulting from somatic mutations. MAb 12A1 is protective and produces
annular immunofluorescence (IF) on serotype D C.
neoformans, while MAb 13F1 is not protective and produces
punctate IF. To determine the Ab molecular determinants responsible for
the IF pattern, site-directed mutagenesis of the MAb 12A1 heavy-chain V
region (VH) was followed by serological and functional
studies of the various mutants. Changing two selected amino acids in
the 12A1 VH binding cavity to the corresponding residues in
the 13F1 VH altered the IF pattern from annular to
punctate, reduced opsonic efficacy, and abolished recognition by an
anti-idiotypic Ab. Analysis of the binding of the various mutants to
peptide mimetics revealed that different amino acids were responsible
for GXM binding and peptide specificity. The results suggest that
V-region motifs associated with annular binding and opsonic activity
may be predictive of Ab efficacy against C. neoformans.
This has important implications for immunotherapy and vaccine design
that are reinforced by the finding that GXM and peptide reactivities
are determined by different amino acid residues.
 |
INTRODUCTION |
The protective efficacy of
antibodies (Abs) to the human-pathogenic fungus Cryptococcus
neoformans depends on the Ab isotype and specificity (reviewed in
references 3 and 46). The evidence that Ab
specificity is critical for protective efficacy comes from studies of
two clonally related immunoglobulin M (IgM) monoclonal Abs (MAbs) known
as 12A1 and 13F1 (3, 31, 39, 46). Although these MAbs
originated from the same B-cell precursor and use the same variable
(V)-region genes, they differ in specificity as a result of V-region
somatic mutations that translate into 12 amino acid differences
(31, 39). The differences in specificity are manifested by
differences in the indirect immunofluorescence (IF) binding pattern
such that MAbs 12A1 and 13F1 produce annular and punctate patterns,
respectively, after binding to serotype D C. neoformans
cells (11, 31, 39). The annular binding pattern is
correlated with opsonic efficacy, capsular reaction patterns, and
complement activation kinetics (27) and Ab protection against serotype D organisms (31, 39). Since the MAb pair 12A1 and 13F1 have markedly different biological properties yet differ
in sequence by only a few amino acids, they provide a unique opportunity for the study of Ab specificity.
MAbs to C. neoformans capsular glucuronoxylomannan (GXM)
have been grouped into five classes based on V-region usage and
idiotype and serotype specificity (5). Class II
MAbs include a large set of MAbs that bind to an immunodominant
epitope found in all cryptococcal serotypes and are characterized
by the use of VH7183, JH2,
V
5.1, and J
1 gene
elements and a heavy-chain V (VH) third
complementarity-determining region (CDR3) of 11 amino acids
(5). MAbs 12A1 and 13F1 are class II MAbs
(5). Peptide mimetics which bind to the antigen (Ag)
binding sites of class II MAbs have been described (43,
44), and the crystal structures of the class II MAb 2H1 with and
without a complexed peptide mimetic have been solved (47).
Murine class II MAbs and human Abs to C. neoformans GXM
share sequence similarities (40). The class II MAb 18B7 is
in clinical evaluation for the treatment of cryptococcal meningitis
(4).
IgM is an important isotype against fungi in light of evidence that
some IgMs are protective against C. neoformans (17, 32) and Candida albicans
(20), and IgM is common in both the human and mouse
responses to GXM (6, 16, 22). IgM may have an advantage
over IgG in therapy because it is very effective at clearing Ag but
does not elicit lethal toxicity reactions when administered to C. neoformans-infected mice (26). Identification of the
amino acid residues that confer Ab specificity for epitopes associated with protection is important for defining the Ab paratope, or the site that is involved in binding the polysaccharide Ag (19), and the latter is important for immunotherapy and
vaccine design. In this study, we used site-directed mutagenesis to
identify the amino acids responsible for the fine-specificity
difference between MAbs 12A1 and 13F1 and compared the serological and
opsonic properties of the mutated Abs. The fact that punctate and
annular IF patterns reflect differential localization of Ag-Ab
complexes on the C. neoformans capsule (15)
indicates that the binding characteristics of IgM may require valence
or other structural constraints. Therefore, we changed the 12A1
VH to the corresponding residue in the 13F1
VH and expressed the mutated V regions. The results indicate that annular binding is conferred by two
VH amino acid residues that impart major
differences in biological function by coding for two different
epitope specificities.
 |
MATERIALS AND METHODS |
Hybridomas and MAbs.
Hybridomas 12A1 and 13F1 both produce
IgM MAbs (6). Cells were maintained in Dulbecco modified
Eagle (DME) medium containing 10% fetal calf serum (Harlan,
Indianapolis, Ind.), 10% NCTC-109 (Mediatech, Herndon, Va.), and 1%
nonessential amino acid solution (Mediatech). MAb 3E5 is an IgG3 which
competes with MAb 12A1 but not 13F1 (31).
Heavy-chain-nonproducing hybridoma mutants.
The 12A1
heavy-chain-nonproducing hybridoma cells were isolated by soft agar
cloning followed by overlaying the agar with rabbit antiserum to murine
IgM. In this method, colonies that secrete IgM are stained by Ag-Ab
precipitates. Colonies that were not stained were selected and
transferred to 96-well plates containing cell medium, and their
supernatants were tested for IgM and light-chain
secretion by
enzyme-linked immunosorbent assay (ELISA) (see below). Hybridoma cells
that tested negative for IgM and positive for light-chain
were used
in the transfection experiments.
C. neoformans and other yeasts.
Serotype D
strain 24067 was obtained from the American Type Culture Collection
(Manassas, Va.). MAbs 12A1 and 13F1 produce annular and punctate IF
patterns, respectively, upon binding to the 24067 capsule. C. neoformans cells were maintained in glycerol stocks at
80°C
and grown in Sabouraud dextrose broth (Difco Laboratories, Detroit,
Mich.) for 24 h at 30°C with constant shaking at 150 rpm. Before
use, cells were washed three times with sterile phosphate-buffered saline (PBS) and counted using a hemacytometer. Capsular GXM was prepared from supernatants of strain 24067 as described previously (9). Saccharomyces cerevisiae strain 1H170
his3 ade2 and C. albicans strain SC5314 were
gifts from Lorraine Marsh (Bronx, N.Y.) and Mahmoud Ghannoum
(Cleveland, Ohio), respectively.
VH and VL sequences.
Total RNA was
isolated from hybridoma cells using Trizol reagent (Gibco BRL,
Gaithersburg, Md.). cDNA was generated using reverse transcriptase and
the oligonucleotide primer p(dt)15 (Boehringer Mannheim, Indianapolis,
Ind.). DNA containing the VH region was amplified
using the primers 5'-TAAAAAGCTTAGTC CACTCGCCATGGACTTC-3' and 5'-TATATTGCTAGCTGAGGAGACTGTGAGAGTGG-3'. DNA
containing the light-chain V region (VL)
was amplified using the primers GATGTTGTGATGACCCAA and
TGGATGGTGGGAAGATG. The amplified DNA was cloned into the PCR 2.1 vector (Invitrogen, San Diego, Calif.) for sequencing.
Oligonucleotide synthesis and DNA sequencing were done by the
Oligonucleotide Facility of the Cancer Center at Albert Einstein
College of Medicine.
Expression of 12A1 VH.
DNA containing MAb 12A1
VH was excised from the PCR 2.1 vector using
NheI and HindIII (Promega, Madison, Wis.) and
cloned into a murine cDNA IgM expression vector (28). The
plasmid was then transfected into heavy-chain-nonproducing 12A1
hybridoma cells by electroporation using conditions of 200
, 960 µF, and 450 V. The same recipient cell line deficient in heavy-chain
production was used to generate all mutant Abs. Approximately 3 × 106 cells were washed with cold PBS, mixed with
10 to 15 µg of plasmid in 1.0 ml of PBS, placed in a Gene Pulser
cuvette (Bio-Rad Laboratories, Hercules, Calif.), and incubated on ice
for 10 min before transfection. Following electroporation, cells were
incubated on ice for 10 min and then washed with DME medium. Cells were
then plated at a density of 104 cells/well in a
96-well plate (Becton Dickinson Labware, Franklin Lakes, N.J.) for
24 h in feeding medium. Cells expressing the transfected plasmid
were selected with 1.5 mg of neomycin (Geneticin; Gibco BRL)/ml in DME
medium with 20% fetal calf serum (Harlan), 10% NCTC-109 (Mediatech),
and 1% nonessential amino acid solution (Mediatech). To identify
high-producing clones, the cells were cloned in soft agar with an
overlay of rabbit Ab to mouse IgM. Colonies with strong Ag-Ab staining
were selected. Transfected cells produced 10 to 150 ng of IgM/ml in
cell culture supernatants after 24 h of incubation.
Site-directed mutagenesis.
Amino acid changes were
introduced into the MAb 12A1 VH by
oligonucleotide-directed PCR mutagenesis using a QuickChange
site-directed mutagenesis kit (Stratagene, La Jolla, Calif.). The
oligonucleotides (5'
3') for mutagenesis were as follows: N31S,
GCCTCTGGATTTACTTCCAGTAGCTATTTCATGTCTTGGG and
CCCAAGACATGAAATAGCTACTGAAAGTGAATCCACAGGC; F33Y,
CACTTTCAGTAACTATTACATGTCTTGGG and
CCCAAGACATGTAATAGTTACTGAAAGTG; M50A,
GAG GCTGGAATTGGTCGGAGCCATTAATATTAATGGTGATAACACC and
GGTGTTATCACCATTAATATTAATGGCTGCGACCAATTCCAGCCTC; I53S,
GGCTGGAATTGGTCGCAATGATTAATAGTAATGGTGATAACACCTAC and
TATCCGGATAGTAGGTGTTATCACCATTACTATTAATCATTGCGACCAATTCCAGCC; N56G, GGTCGCAATGATTAATATTAATGGTGGTAACACCTACTATCCA and
GTCTGGATAGTAGGTGTTACCACCATTAATATTAATCATTGCGACC; N57S,
ATTAATGGTGATAGCACC TACTATCCAGAC and GTCTGGATAGTAGGTGCTATCACCATTAAT; D80Y,
GCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTG and
CACACTGCTCATTTGCAGGTACAGGGTGTTCTTGGC; and G103Y,
GCAAGACGAGACGGCACCTACGGAAACTACTTTGACTAC and
GTAGTCAA AGTAGTTTCCGTAGGTGCCGTCTCGTCTTGC. The oligonucleotide
primers, each complementary to opposite strands of the vector, extend
during temperature cycling by means of Pfu DNA polymerase.
On incorporation of the oligonucleotide primers, a mutated plasmid
containing staggered nicks is generated. Following temperature cycling,
the PCR product was treated with DpnI, an endonuclease
specific for methylated and hemimethylated DNAs that digests the
parental DNA template and selects for molecules containing the
mutation. The DNA was then used to transform Escherichia
coli supercompetent cells and make purified DNA for
electroporation experiments. Despite multiple attempts, we were not
able to generate a 12A1 variant expressing the G103Y mutation. All
mutations were confirmed by sequence analysis.
ELISAs.
Ab concentrations were determined by ELISA.
Polystyrene plates were coated with goat anti-mouse IgM, blocked with
1% bovine serum albumin (BSA) in PBS, and incubated with the
IgM-containing solution. Bound IgM was detected using alkaline
phosphatase-conjugated goat anti-mouse IgM, and the IgM concentration
was determined relative to isotype-matched IgM standards (Southern
Biotechnology, Birmingham, Ala.). IgM binding to GXM was studied by
ELISA as described previously (7). Briefly, polystyrene
plates were coated with a GXM solution (1 µg/ml) and blocked with 1%
BSA in PBS. IgM-containing solutions were then added, and bound IgM was detected using alkaline phosphatase-conjugated goat anti-mouse IgM.
Competition ELISAs were done to determine whether MAb 3E5 (IgG3) could
inhibit the binding of the mutagenized MAb 12A1 derivatives to GXM as
described previously (31). For this ELISA, variable amounts of the Ab in question were mixed with a constant amount of MAb
3E5 (2 µg/ml) and allowed to react with GXM absorbed on a polystyrene
plate. Binding of IgG3 was detected by isotype-specific alkaline
phosphatase-conjugated goat anti-mouse reagents. Reactivity with the
anti-idiotypic MAb 7B8 was also measured by ELISA. Briefly, plates were
coated with 1 µg of goat anti-mouse IgM/ml, blocked with 1% BSA in
PBS, incubated with the IgM MAb, and then incubated with MAb 7B8
(IgG1), and binding was detected with goat anti-mouse IgG1 followed by
addition of p-nitrophenyl phosphate substrate. MAb 7B8 binds
to the Ag-combining sites of some class II MAbs, such as 12A1
(38).
Peptide ELISA.
Microtiter plates were coated with 1 µg of
streptavidin/ml and then incubated with 1 µg of biotinylated peptide
mimetics/ml and then with parental and variant MAbs. The peptides were
PA1 (LQYTPSWMLV), P601.E (SYSWMYE), 206.1 (FGGETFTPDWMMEVAIDNE), and PM14
(CGLQWLWEWPRT), which are described in reference
1. The binding of the MAbs was detected with alkaline
phosphatase-conjugated goat anti-mouse IgM, and the plates were
developed with p-nitrophenyl phosphate (Sigma, St. Louis,
Mo.). All incubations were carried out at 37°C for 1 h.
IF.
IgM MAbs were added to a suspension of
106 C. neoformans cells at a
concentration of 10 µg/ml in blocking solution (1% BSA, 0.5% horse
serum) and incubated at 37°C for 30 min. The cells were then washed
twice with blocking solution, incubated with 10 µg of fluorescein
isothiocyanate-labeled goat anti-mouse IgM (Southern Biotechnology)/ml
for 30 min at 37°C in the dark, washed again with blocking solution,
and finally suspended in mounting medium (0.1 M n-propyl
gallate in PBS) (Sigma). The slides were then viewed with an AX70
microscope (Olympus, Melville, N.Y.) equipped with a standard
fluorescein isothiocyanate filter.
Phagocytosis assay.
The opsonic efficacies of MAbs 12A1 and
13F1 and the 12A1 mutants were evaluated in J774 macrophage-like cells
as described previously (34). A macrophage cell line was
used because macrophages are the major phagocytic cells for C. neoformans in vivo (14). Briefly, gamma interferon-
and lipopolysaccharide-stimulated J774 cells were incubated with
C. neoformans in the presence and absence of 10 µg of Ab.
After incubation for 2 h, the monolayer was washed to remove
unbound yeast and the J774 cells were fixed with methanol and stained
with Giemsa stain (Sigma). Phagocytosis was determined by counting the
numbers of attached and ingested yeast cells using a microscope.
Ingested and attached C. neoformans cells can be readily
distinguished by light microscopy. The phagocytic index was defined as
the number of ingested C. neoformans cells divided by the
number of macrophages.
Measurement of zeta potential.
The zeta potential (
) is a
measurement of cellular charge (in millivolts) that is defined as the
potential gradient that develops across the interface between a
boundary liquid in contact with a solid and the mobile diffuse layer in
the body of the liquid (41). It is derived from the
equation
= 4
m/D, where
D is the dielectric constant of the medium,
is the
viscosity, and m is the electrophoretic mobility of the
particle (41). Cells grown in Sabouraud broth (SAB)
were collected and washed three times in 0.01 M NaCl (pH 7.0). The zeta
potentials of suspensions of 106 cells/ml were
measured using a Zeta-Meter (Staunton, Va.) 3.0+ instrument, which
determines the zeta potentials of individual suspended cells. The zeta
potentials of 10 randomly selected C. neoformans cells were
measured for each MAb tested. Similar methods have previously been used
to measure cellular charge for C. neoformans in the presence
and absence of Ab (36).
Scanning electron microscopy.
C. neoformans cells
were grown in SAB, the cells were collected and washed three times with
PBS, and aliquots of 106 cells/ml were incubated
with 10 µg of each MAb/ml for 1 h at room temperature. The cells
were washed three times in PBS and then incubated in 2.5%
glutaraldehyde for 1 h at room temperature. Samples were then
applied to a polylysine-coated coverslip and serially dehydrated in
alcohol. The samples were fixed in a critical-point drier (Samdri-790;
Tousimis, Rockville, Md.), coated with gold-palladium (Desk-1; Denton
Vacuum, Inc., Cherry Hill, N.J.), and viewed using a JSM-6400 (JEOL
USA, Peabody, Mass.) scanning electron microscope. At least 20 cells
were imaged for each MAb tested, and representative photographs were
taken. This methodology has previously been used to study the effects
of MAbs to C. neoformans (12).
Locations of mutations in protein structure.
The X-ray
structure of the Ab 2H1 in complex with the peptide PA1 is deposited in
the Protein Data Bank under accession number 2H1P
(47). Mutated amino acid positions in the 12A1
VH were analyzed on the 2H1 structure using the
program RASTOP (42), which is available as free software
at http://www.bernstein-plus-sons.com/software/rastop.
Nucleotide sequence accession numbers.
The 12A1 and 13F1
VH sequences are deposited in GenBank under
accession numbers AF052834 and AF052835, respectively. The
VL sequences of the two MAbs are deposited in
GenBank under accession numbers AF071060 and AF071061, respectively.
 |
RESULTS |
Sequences of 12A1 and 13F1.
Prior studies had reported partial
VH and VL sequences of MAbs
12A1 and 13F1 obtained by direct sequencing of mRNA
(29). For both MAbs the VH and
VL sequences were completed, and we also determined the complete constant (C)-region sequence for each IgM. The
rationale for determining the C-region sequence was to exclude the
unlikely possibility that the serological differences in the binding of
these MAbs to GXM were the result of Fc-region differences. For both
MAbs, the IgM C regions were identical and corresponded to the IgM(b)
sequence (24). The 12A1 and 13F1 VH
sequences differ at eight amino acid positions (Fig.
1). The VH and
VL amino acid sequences for MAbs 12A1 and 13F1
and other MAbs used in this study are shown in Fig. 1.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 1.
VH and VL amino acid sequences
for MAbs 2D10, 12A1, and 13F1 and the 12A1 VH mutants.
Boxes indicate the amino acid residues shared by the three MAbs which
produce a punctate binding pattern.
|
|
Generation and characterization of 12A1
13F1 mutants by
site-directed mutagenesis.
Expression of the 12A1
VH in hybridoma 12A1 heavy-chain-loss mutant
cells expressing the 12A1 VL
(12A1VH-12A1VL) yielded an Ab that produced, as expected, an annular pattern on C. neoformans cells, like that of the parent MAb 12A1. Expression of
the 12A1 VH in hybridoma 13F1 heavy-chain-loss
mutant cells expressing the 13F1 VL
(12A1VH-13F1VL) also
resulted in an Ab that produced an annular IF pattern, strongly
suggesting that the differences in IF patterns were attributable to
differences in VH sequences. To investigate the
contribution of each of the eight amino acid residues that constitute
the difference between the VHs of MAbs 12A1 and
13F1, we used site-directed mutagenesis to change the 12A1
VH residues that were different into the
corresponding 13F1VH residue (12A1
13F1
mutants). The changes made to the 12A1 VH are shown in Fig. 1. Figure 2 shows the
locations of the induced mutations on a three-dimensional
representation of the MAb 12A1 binding site. All 12A1
13F1 mutants
bound to GXM as determined by ELISA (Table
1).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 2.
Three-dimensional representation of the Ag binding site
of MAb 12A1 with van der Waals surface. The model is based on the 2H1
structure in complex with the peptide PA1 (47). CDR
surfaces are shown colored pale blue (VH) and light green
(VL). The amino acid positions of MAb 12A1 which were
mutagenized are shown in yellow, except for position 80 in magenta,
located in the VH framework, and positions 33 and 57 corresponding to the double mutation. Amino acids at these positions
for MAbs 2H1, 12F1, and 13F1, respectively, are as follows: 31, S, N,
and S; 33, F, F, and Y; 50, M, M, and A; 53, S, I, and N; 56, D, N, G;
57, K, N, and S; 80, L, D, and Y; and 103, A, F, and Y.
|
|
All MAb 12A1 V
H variants with single mutations
produced an annular IF pattern upon binding strain 24067 (some are
shown in
Fig.
3). However, there were
some differences in the location
and intensity of each variant such
that none were identical to
the IF pattern produced by the parent MAb
12A1 (data not shown).
Scanning electron microscopy revealed
differences in capsule binding
for some of the variants (Fig.
4). Hence, mutational analysis
of
the 12A1 V
H revealed that although single amino
acid changes
were not sufficient to alter the IF pattern from annular
to punctate,
some of the changes produced subtle differences in the
binding
to the capsule as measured by IF and scanning electron
microscopy.
Maintenance of the IF pattern in variants with one amino
acid
change suggested that more than one change would be needed to
alter the IF pattern. Faced with the fact that a complete analysis
of
this system would require an overwhelming effort in the form
of
constructing the many combinations possible given the amino
acid
differences between 12A1 and 13F1, we opted for a targeted
evaluation.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 3.
IF patterns produced by parental MAbs 12A1 (a) and 13F1
(b) and variants 12A1VH-12A1VL (c), M50A (d),
D80Y (e), and the F33Y N57Y double mutant (f). Magnification, ×250.
|
|

View larger version (143K):
[in this window]
[in a new window]
|
FIG. 4.
Scanning electron micrographs of yeast cells coated with
MAbs 12A1VH-12A1VL (a), 13F1 (b), F33Y (c), and
the F33Y N57Y double mutant (d). Bar, 10 µm. For each Ab at least 15 to 20 cells were imaged, and representative yeast cells are shown.
|
|
Another IgM (21D2) had been shown to also produce a punctate IF on
strain 24067 and not to be protective (
39). MAb 21D2
is a
class II MAb that was generated from a mouse with
C. neoformans infection and recognizes a different epitope than
MAb 12A1 on
the basis that it can bind to de-O-acetylated GXM.
Comparison
of the MAb 13F1 and 21D2 sequences revealed that they shared
two
amino acids at positions 33 and 57 that were not found in the
protective IgMs that produced annular IF (Fig.
1). On the basis
of this
similarity, we constructed a 12A1 V
H with the
amino acid
changes F33Y and N57S, and this V
H
produced a punctate pattern
when assembled with the 12A1
V
L (Fig.
3). Thus, introduction of
two amino acid
changes corresponding to those in MAb 13F1 converted
the MAb 12A1 IF
from annular to
punctate.
As a second measure for specificity we carried out competition assays
with MAb 3E5, which competes with MAb 12A1 but not 13F1
for GXM binding
by ELISA (
31). Like the parent MAb 12A1, all
12A1

13F1
mutants displaying single amino acid changes were inhibited
by MAb 3E5
(Table
1). However the mutant having two amino acid
changes at F33Y and
N57S was not inhibited by MAb 3E5 (Fig.
5).
MAb 21D2 was also not
inhibited by MAb 3E5 (data not shown). Hence,
introduction of two amino
acids changed the specificity of MAb
12A1 to one that is
indistinguishable from that of MAb 13F1 by
this assay.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 5.
Competition ELISA between Abs 12A1, 13F1,
12A1VH-12A1VL, and the F33Y N57Y double mutant
with the IgG3 MAb 3E5. At increasing concentrations
of MAbs 12A1 and 12A1VH-12A1VL the binding of
MAb 3E5 is inhibited. In contrast, no significant inhibition of MAb 3E5
binding is produced by either MAb 13F1 or the F33Y N57Y double
mutant. AP-GAM-IgG3, alkaline phosphatase-conjugated anti-mouse
IgG3.
|
|
Reactivities of MAbs 12A1 and 13F1 and 12A1
13F1 mutants with
peptide mimotopes of MAb 2H1.
The crystal structures of MAb 2H1
with and without a peptide mimotope in the binding site are available
(47). Since MAbs 12A1 and 13F1 use V-region genes of the
same family, share the 2H1 idiotype, and have very similar serological
characteristics (5), we analyzed their reactivities with
peptide mimotopes of GXM recognized by MAb 2H1 (Table
2). Neither MAb 12A1 nor MAb 13F1 showed
significant reactivity with peptide PA1, 601, or 206.1, which are
mimotopes of GXM that bind strongly to MAb 2H1 and the other class II
Abs, such as MAb 2D10. Interestingly, the
12A1VH-13F1VL hybrid
reacted with peptide 206.1 despite no reactivity by their parent MAbs.
The 12A1
13F1 mutants I53S, N56G, and N57S each reacted strongly with
peptide 206.1. Hence, the introduction of single mutations into the 5'
region of the 12A1 VH CDR altered the specific
ability of MAb 12A1 to recognize a GXM peptide mimetic even when no
change in IF pattern after binding C. neoformans was
apparent.
Phagocytosis assays.
MAb 12A1 is significantly more
opsonic than MAb 13F1 for C. neoformans cells
(11). The 12A1
13F1 mutants each were less opsonic
than the parent MAb 12A1, and mutations F33Y and N57S significantly
reduced the opsonic potential of the Ab (Table 2). The double mutation
at F33Y and N57S resulted in complete loss of opsonic activity to a
level comparable to that observed for MAb 13F1 (Table 2). Hence, the
F33Y N57S double mutant is like MAb 13F1 with respect to opsonization efficacy.
Zeta potential.
C. neoformans cells have a very
high negative charge relative to other yeast cells, which has been
attributed to the polysaccharide capsule (36, 37). Ab
binding to the C. neoformans capsule can result in changes
to the yeast cell charge (36). This phenomenon is not well
understood, but our mutant set provided the opportunity to investigate
whether amino acid changes could alter the zeta potential of C. neoformans cells independent of their effects on Ab charge.
Measurements of zeta potential of C. neoformans cells after
binding MAb 12A1 or 13F1 or the 12A1
13F1 mutants revealed relatively
small changes to the yeast cell charge after Ab binding, even for the
D80Y mutant, which involved replacement of a negatively charged
aspartic acid with a neutral tyrosine (Fig.
6). The largest change was observed for
N56G, which conferred a significantly greater negative charge to
C. neoformans than MAb 12A1 despite involving a replacement
of a neutral asparagine with a neutral glycine (Fig.
7).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
Zeta potentials of C. neoformans cells
coated with MAbs 12A1 and 13F1 and the various 12A1 13F1 mutants.
*, the zeta potential of the N56G variant was significantly
lower (P = 0.017) than that of the parent MAb 12A1.
Error bars indicate standard deviations.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 7.
Reactivities of MAbs 12A1 and 13F1 and various
12A1 13F1 mutants with the anti-idiotypic MAb 7B8 as determined by
ELISA.
|
|
Reactivity with anti-idiotypic Ab.
MAb 7B8 binds to the
Ag-combining sites of some class II MAbs (38). MAb 7B8
binds to Abs 12A1,
12A1VH-12A1VL, and 2D10 but not to 13F1 or the
12A1VH-13F1VL hybrid (Fig.
7). MAb 7B8 reacted with all 12A1
13F1 mutants except the F33Y N57S
double mutant. These results indicate that the idiotypic determinants
recognized by MAb 7B8 reside in both the VH and
VL and at VH positions 33 and 57.
Frequency of Y33 and S57 in the VHs of Abs to GXM and
germ line 7183 genes.
None of the 14 MAbs to GXM that use
VH7183 gene family segments and are protective in
mice have Y33 or S57 (Table 3). Two of 15 VH7183 family gene segments in the genetic
database have Y33, six have S57, and only two
(VH50.1 and VH7183.10) have
both Y33 and S57.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Amino acid usage at positions 33 and 57 for antibodies of
C. neoformans which have been evaluated for
protective efficacy
|
|
 |
DISCUSSION |
Characterization of the amino acids residues responsible for Ab
specificity to C. neoformans polysaccharide is important for understanding the relationship between Ab structure and protective efficacy. This information can also be helpful for preserving fine
specificity of Abs to C. neoformans during Ab engineering and for the ongoing efforts to develop vaccines using
polysaccharide-protein conjugates (6, 13) and peptide
mimotopes (1).
Our results show that changing two amino acids in the binding pocket of
the protective IgM MAb 12A1 VH to the
corresponding residues in the VH of the
nonprotective MAb 13F1 can alter the IF pattern and significantly
reduce the opsonic activity, such that the mutated 12A1 Ab behaves like
MAb 13F1. We were able to target these amino acids because we had
available VH and VL
sequences of four closely related class II IgM MAbs (8,
29), namely, 12A1, 13F1, 2D10, and 21D2, that differed in IF
pattern despite having very similar V-region sequences. We focused our
efforts on analyzing VH rather than
VL differences as the cause of differences in IF
patterns because the MAb 2D10 and 13F1 VLs were
identical yet produced annular and punctate IF patterns, respectively.
This deduction was confirmed by the findings that the
12A1VH-13F1VL hybrid
produced annular IF and that mutations to the 12A1
VH amino acids changed the IF pattern from
annular to punctate. The observation that the 12A1
VH is responsible for the type of pattern
observed is consistent with the proposal that Ab specificity is
frequently determined by the VH
(23).
Superposition of the V-region sequence of MAb 12A1 on the crystal
structure of the closely related MAb 2H1 revealed that all of the
mutated amino acid positions with the exception of framework position
80 mapped to the Ag binding site. Nonetheless, the data showed that
single amino acid changes in the sequence of MAb 12A1 to the comparable
residues in MAb 13F1 were insufficient to change the IF pattern or to
affect the outcome of competition experiments with MAb 3E5. However,
when the two amino acids in the 12A1 VH at
positions 33 and 57 were changed to the amino acids found in the 13F1
VH, a punctate pattern was observed. Competition
experiments confirmed that the two mutations conferred a specificity
change, since the parent but not the F33Y N57S double mutant competed for GXM with MAb 3E5.
The punctate and annular IF patterns are considered to be a consequence
of the binding of MAbs 12A1 and 13F1 to different epitopes, because
these MAbs have similar affinities for GXM although they (i) bind to
different places in the capsule of serotype D strains
(15), (ii) bind differently to serotype A and D strains (11), (iii) exhibit differences in binding to peptide
mimetics (43), (iv) react differently with polysaccharides
from the four C. neoformans serotypes (6), and
(v) demonstrate differences in competition experiments
(31). Given that the annular and punctate binding patterns
correlate with protective and nonprotective efficacy, respectively, and
reflect the binding of Abs with different specificities, the
VH positions 33 and 57 define critically
important structural correlates for Ab functional efficacy against
C. neoformans.
The Ab response to GXM is highly restricted in V gene usage, even among
genetically different strains of mice (5, 8, 29, 38, 40,
49). The overwhelming majority of murine MAbs use 7183 VH gene family elements (5, 38). The
F33 and N57 in MAb 12A1 are both found in the consensus
VH sequence from which the 12A1
VH was derived (29). Since only two
7183 VH family genes have both Y33 and S57 in
their germ line sequences, this implies that F33 and N57 are likely to
have arisen from somatic mutations that accrued during the immune
response. Alternatively, they are derived from a germ line
VH7183 family gene element that has not yet been
characterized. Regardless of their origin, the Y33 and S57 residues in
MAb 13F1 appear to have changed the specificity from a GXM epitope
that could mediate protection against serotype D strains to one that
could not. None of the 12 protective MAbs for which sequence data are
available has the Y33 and S57 motif. In contrast, the two nonprotective
class II MAbs for serotype D strains each have Y33 and S57. Analysis of
germ line 7183 gene family sequences in the genetic database (GenBank,
Los Alamos, N.Mex.) indicates that 13% have F33, 40% have N57, and
15% have both F33 and N57. One of two gene elements with the Y33 and
S57 motif is VH50.1, and it is used in the
nonprotective MAb 21D2 in its germ line configuration (8).
These results suggest that nonprotective Abs can be generated either
from germ line sequences or as a consequence of somatic mutation. For
many 7183 VH gene elements, a single somatic
mutation can yield the F33 and N57 motif found in MAb 13F1. The ability
of the mouse genome to code for both protective and nonprotective
specificities may underlie such perplexing observations as the fact
that highly immunogenic polysaccharide-protein conjugate vaccines can
elicit high-titer protective (13) and nonprotective
(18) Ab responses. The implication that germ line residues
in CDRs are critical for the annular IF pattern that is associated with
Ab efficacy is consistent with the proposal that certain
VH genes are required for carbohydrate binding
(45) and the fact that class II Abs to GXM are all derived from the same Ab clan (25).
Our observations demonstrate that a change of IF pattern from annular
to punctate required changes in at least two amino acids located in
each of the CDR1 and CDR2 VH regions. However,
scanning electron microscopy revealed differences in the fibrillar
structure after binding of MAbs 12A1 and 13F1 and the
12A1VH
13F1VH mutants. Previous work has shown that fibrillar capsular structure is different after binding of MAbs 12A1 and 13F1 (12). Thus, each
mutant with a single amino acid change displayed qualitative
alterations in the annular IF pattern after binding to strain 24067. Although caution is always warranted when interpreting or comparing
scanning electron micrographs of polysaccharide capsules
(12), the differences in fibrillar appearance are
consistent with the notion that some amino acid replacements affected
the interaction with the capsule even though the annular IF pattern was
maintained. This raises the possibility that Ab reactivity with
C. neoformans in the punctate pattern reflects a continuum
based on deviations from the consensus and/or germ line motif
found in 12A1, although more work is needed to determine precisely how
certain Abs react with GXM.
The F33Y change occurs at one of five amino acid residues delineating a
cavity at the bottom of the MAb 2H1 structure. The side chains of F33
or Y33 at this position are near the surface of this cavity in a
location that is likely to be solvated and in contact with the
polysaccharide. Hence, it appears that F33 is in a strategic position
to affect the type of binding that occurs but that a single change at
this location is not sufficient to alter the IF pattern. Instead, the
second change of N57S is also required, and the double mutation
significantly reduced the binding to GXM determined by ELISA in
a manner comparable to that for MAb 13F1. These results imply that
amino acid residues in VH define the epitope
specificity for these Abs to C. neoformans, although both
VH and VL contribute to Ag
affinity. A similar observation has been reported for Abs to digoxin
(35), whereas for Abs to the polysaccharide levan,
residues affecting fine specificity were located in the
VH-VL junctional area
(2).
Greenspan has defined an Ab paratope involved in a given Ag-Ab
interaction as contact-, affinity-, and specificity-determining residues which may confer overlapping but nonidentical interactions with the epitope (19) and has defined amino acids that
contribute to binding as the paratope set, depending on whether the
residue is involved in contact, bond formation, or both
(19). Our results are consistent with this view and
suggest that each amino acid change to the paratope resulted in an
alteration in the type of Ag-Ab complex formed in the capsule. Hence,
the annular and punctate patterns may simply represent two forms of Ab
binding to GXM among a multitude of possible interactions defined by
the paratope of class II MAbs to GXM.
Ab binding in annular IF patterns is associated with significantly
greater opsonic efficacy (10, 39). The 12A1
13F1
variants each resulted in reduced opsonic efficacy relative to that of the parent MAb 12A1, but the greatest effects for single amino acid
changes were observed with F33Y and N57S. Both the F33Y and N57Y
mutations significantly reduced the opsonic efficacy of the Ab without
altering the IF pattern from annular to punctate. However, when both
mutations were present simultaneously, the opsonic efficacy was further
reduced to that of MAb 13F1. Hence, the change in IF pattern from
annular to punctate which resulted from this double mutation also
abolished the opsonic efficacy of this MAb 12A1
13F1 mutant. The
finding that the change from annular to punctate reactivity was
accompanied by a reduction in Ab opsonic efficacy establishes an
association between Ab structure and biological function. This defines
a key structure-function relationship for Abs to C. neoformans that is relevant to the choice of immunotherapeutic
reagents and vaccine design.
IgG1 binding to the C. neoformans capsule alters the charge
of the cell, but the mechanism for this phenomenon is not understood (36, 37). However, neither IgM MAb 12A1 nor 13F1 produced significant changes in cell charge upon binding C. neoformans. Since our mutant Ab set included mutations that
replaced charged and neutral residues, we investigated the effect of
amino acid replacements on the zeta potential of IgM-coated cells in an
attempt to gain insight into this phenomenon. The various amino acid
substitutions had little effect on the cell charge of C. neoformans after Ab binding. Replacement of a negatively charged
aspartic acid at position 80 with a neutral tyrosine had no significant
effect on the zeta potential of IgM-coated cells. Interestingly, the largest change in zeta potential was observed with N56G replacement, which involved the substitution of a neutral amino acid residue for
another. This result suggests that cell charge can change upon Ab
binding without an apparent change in the Ab charge.
The anti-idiotypic MAb 7B8 binds to the MAbs 12A1 and
12A1VH-12A1VL but
not to MAb 13F1. No binding to the
12A1VH-13F1VL hybrid was observed, indicating that amino acid differences between the 12A1
VL and 13F1 VL contribute
to defining the idiotype. In contrast, MAb 7B8 recognized all of the
12A1
13F1 single-amino-acid-mutated variants, and several exhibited
significantly stronger binding than the parent MAb 12A1, suggesting
that those changes stabilized the Ab-Ab interaction. However, there was
no reactivity with the F33Y N57Y double mutant, indicating that F33 and
N57 are part of the idiotype recognized by MAb 12A1. Hence, the same
residues that confer annular or punctate specificity in the
VH chain are involved in recognition by the 7B8
anti-idiotypic Ab. These studies suggest that this reagent may be
useful for identifying protective MAbs.
Peptide mimetics of class II MAbs have been shown to bind in the Ab
combining site and to be useful in mapping the epitope specificities of closely related MAbs (43, 44, 47).
Peptide mimetics for MAb 12A1 and 13F1 have been reported
(39). The availability of multiple MAb 12A1 mutants
expressing the corresponding MAb 13F1 amino acid provided the
opportunity to ascertain whether the same residues were responsible for
peptide and binding pattern specificities. To our knowledge this is the
first study that has simultaneously evaluated the contributions of
V-region residues to the binding of polysaccharide Ag and a peptide
mimotope. PA1 is a 10-mer peptide that binds to the closely related
MAbs 2H1 and 2D10 but not to MAbs 12A1, 13F1, and 21D2 or to any of the variants generated here. The crystal structure has shown that PA1 has
significantly more van der Waals interactions with
VL than with VH. Hence,
even though MAbs 2D10, 13F1, and 21D2 have the same
VL, their interactions with PA1 are not
sufficient to promote binding in the absence of specific
VH interactions. Similar results were obtained
with the 6-mer peptide 601, which includes the same motif as peptide
PA1 which is involved in Ab combining site binding. In contrast, 206.1 is a 19-mer peptide that binds MAbs 2D10, 2H1, and 21D2 strongly, 12A1
weakly, and 13F1 not at all. The larger size of 206.1 is believed to
make it capable of making additional contacts with the Ab binding
region. The I53S, N56G, and D80Y mutants exhibited stronger binding to
peptide 206.1 than either MAb 12A1 or 13F1. The results with peptide
206.1 indicate a dissociation of the binding characteristics of Ab with
polysaccharide and peptide, suggesting that different residues are
responsible for binding the GXM Ag and the peptide mimetic. This is
consistent with the suggestion that peptide mimotopes of
carbohydrate-binding Abs are recognized by different mechanisms than
the carbohydrate Ag (21). However, in the case of peptide
PM14, which reacts with MAb 13F1 but not 12A1, the 12A1
VH mutant F33Y demonstrated significant
reactivity. Since the F33Y N57Y double mutant indicates that the F33Y
residue is also involved in the IF binding pattern, it appears that
some amino acids in the paratope set bind primarily peptide or
carbohydrate, whereas others interact with both types of Ag.
In summary, our results indicate that VH amino
acid residues F33 and N57 are critical determinants for Ab binding to
GXM in a manner that translates into Ab-mediated protection against
C. neoformans. Changing these two amino acids to the
corresponding residues in MAb 13F1 resulted in a mutated variant of MAb
12A1 which behaved like MAb 13F1 with regard to IF, phagocytosis,
recognition by anti-idiotypic MAb, and binding to GXM. These results
are internally consistent and define two molecular determinants for
protective efficacy against C. neoformans. The difference in
reactivity of mutated Abs with GXM and peptide mimetics strongly
suggests that different paratopes interacted with the polysaccharide Ag
and the peptide mimetic. Hence, the search for peptide mimotopes that can elicit antipolysaccharide responses may be more fruitful if it
focuses on peptides that interact with Ab amino acids important for
binding carbohydrate epitopes. The implication that the punctate IF
specificity can be either encoded in germ line V genes or generated by
somatic mutation highlights the complexity and difficulty in consistently eliciting protective Ab responses to C. neoformans.
 |
ACKNOWLEDGMENTS |
We thank H. Bernstein and R. Sayle for help with the RASTOP
program. We are grateful to Liise-anne Pirofski for critical reading of
the manuscript.
This work was supported by NIH awards AI33774, AI3342, and HL-59842-01
to A.C. and AI01489 to J.N. A.C. is the recipient of a Burroughs
Wellcome Development Therapeutics Award.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Infectious Diseases, Department of Medicine, Albert Einstein College of Medicine, 1300 Morris Park Ave., Bronx, NY 10461. Phone: (718) 430-3665. Fax: (718) 430-8701. E-mail:
casadeva{at}aecom.yu.edu.
Editor:
T. R. Kozel
 |
REFERENCES |
| 1.
|
Beenhouwer, D. O.,
P. Valadon,
R. May, and M. D. Scharff.
2000.
Peptide mimicry of the polysaccharide capsule of Cryptococcus neoformans, p. 143-160.
In
M. W. Cunningham, and R. S. Fujinami (ed.), Molecular mimicry, microbes, and autoimmunity. ASM Press, Washington, D.C.
|
| 2.
|
Brorson, K.,
C. Thompson,
G. Wei,
M. Krasnokutsky, and K. E. Stein.
1999.
Mutational analysis of avidity and fine specificity of anti-levan antibodies.
J. Immunol.
163:6694-6701[Abstract/Free Full Text].
|
| 3.
|
Casadevall, A.
1995.
Antibody immunity and invasive fungal infections.
Infect. Immun.
63:4211-4218[Medline].
|
| 4.
|
Casadevall, A.,
W. Cleare,
M. Feldmesser,
A. Glatman-Freedman,
D. L. Goldman,
T. R. Kozel,
N. Lendvai,
J. Mukherjee,
L. Pirofski,
J. Rivera,
A. L. Rosas,
M. D. Scharff,
P. Valadon,
K. Westin, and Z. Zhong.
1998.
Characterization of a murine monoclonal antibody to Cryptococcus neoformans polysaccharide that is a candidate for human therapeutic studies.
Antimicrob. Agents Chemother.
42:1437-1446[Abstract/Free Full Text].
|
| 5.
|
Casadevall, A.,
M. DeShaw,
M. Fan,
F. Dromer,
T. R. Kozel, and L. Pirofski.
1994.
Molecular and idiotypic analysis of antibodies to Cryptococcus neoformans glucuronoxylomannan.
Infect. Immun.
62:3864-3872[Abstract/Free Full Text].
|
| 6.
|
Casadevall, A.,
J. Mukherjee,
S. J. N. Devi,
R. Schneerson,
J. B. Robbins, and M. D. Scharff.
1992.
Antibodies elicited by a Cryptococcus neoformans glucuronoxylomannan-tetanus toxoid conjugate vaccine have the same specificity as those elicited in infection.
J. Infect. Dis.
65:1086-1093.
|
| 7.
|
Casadevall, A.,
J. Mukherjee, and M. D. Scharff.
1992.
Monoclonal antibody ELISAs for cryptococcal polysaccharide.
J. Immunol. Methods
154:27-35[CrossRef][Medline].
|
| 8.
|
Casadevall, A., and M. D. Scharff.
1991.
The mouse antibody response to infection with Cryptococcus neoformans: VH and VL usage in polysaccharide binding antibodies.
J. Exp. Med.
174:151-160[Abstract/Free Full Text].
|
| 9.
|
Cherniak, R.,
E. Reiss, and S. Turner.
1982.
A galactoxylomannan antigen of Cryptococcus neoformans serotype A.
Carbohydr. Res.
103:239-250[CrossRef].
|
| 10.
|
Cleare, W.,
M. E. Brandt, and A. Casadevall.
1999.
Monoclonal antibody 13F1 produces annular immunofluorescent patterns on Cryptococcus neoformans serotype AD isolates.
J. Clin. Microbiol.
37:3080[Free Full Text].
|
| 11.
|
Cleare, W., and A. Casadevall.
1998.
The different binding patterns of two IgM monoclonal antibodies to Cryptococcus neoformans serotype A and D strains correlates with serotype classification and differences in functional assays.
Clin. Diagn. Lab. Immunol.
5:125-129[Abstract/Free Full Text].
|
| 12.
|
Cleare, W., and A. Casadevall.
1999.
Scanning electron microscopy of encapsulated and nonencapsulated Cryptococcus neoformans and the effect of glucose on capsular polysaccharide release.
Med. Mycol.
37:235-243[CrossRef][Medline].
|
| 13.
|
Devi, S. J. N.
1996.
Preclinical efficacy of a glucuronoxylomannan-tetanus toxoid conjugate vaccine of Cryptococcus neoformans in a murine model.
Vaccine
14:841-842[CrossRef][Medline].
|
| 14.
|
Feldmesser, M.,
Y. Kress,
P. Novikoff, and A. Casadevall.
2000.
Cryptococcus neoformans is a facultative intracellular pathogen in murine pulmonary infection.
Infect. Immun.
68:4225-4237[Abstract/Free Full Text].
|
| 15.
|
Feldmesser, M.,
J. Rivera,
Y. Kress,
T. R. Kozel, and A. Casadevall.
2000.
Antibody interactions with the capsule of Cryptococcus neoformans.
Infect. Immun.
68:3642-3650[Abstract/Free Full Text].
|
| 16.
|
Fleuridor, R.,
R. H. Lyles, and L. Pirofski.
1999.
Quantitative and qualitative differences in the serum antibody profiles of human immunodeficiency virus-infected persons with and without Cryptococcus neoformans meningitis.
J. Infect. Dis.
180:1526-1535[CrossRef][Medline].
|
| 17.
|
Fleuridor, R.,
Z. Zhong, and L. Pirofski.
1998.
A human IgM monoclonal antibody prolongs survival of mice with lethal cryptococcosis.
J. Infect. Dis.
178:1213-1216[Medline].
|
| 18.
|
Goren, M. B.
1967.
Experimental murine cryptococcosis: effect of hyperimmunization to capsular polysaccharide.
J. Immunol.
98:914-922[Abstract/Free Full Text].
|
| 19.
|
Greenspan, N. S.
1997.
Conceptions of epitopes and paratopes and the ontological dynamics of immunological recognition, p. 383-403.
In
D. H. Rouvray (ed.), Concepts in chemistry: a contemporary challenge. Research Studies Press Ltd, Taunton, Somerset, England.
|
| 20.
|
Han, Y., and J. E. Cutler.
1995.
Antibody response that protects against disseminated candidiasis.
Infect. Immun.
63:2714-2719[Abstract].
|
| 21.
|
Harris, S. L.,
L. Craig,
J. S. Mehroke,
M. Rashed,
M. B. Zwick,
K. Kenar,
E. J. Toone,
N. Greenspan,
F. I. Auzanneau,
J. R. Marino-Albernas,
B. M. Pinto, and J. K. Scott.
1997.
Exploring the basis of peptide-carbohydrate crossreactivity: evidence for discrimination by peptides between closely related anti-carbohydrate antibodies.
Proc. Natl. Acad. Sci. USA
94:2454-2459[Abstract/Free Full Text].
|
| 22.
|
Houpt, D. C.,
G. S. T. Pfrommer,
B. J. Young,
T. A. Larson, and T. R. Kozel.
1994.
Occurrences, immunoglobulin classes, and biological activities of antibodies in normal human serum that are reactive with Cryptococcus neoformans glucuronoxylomannan.
Infect. Immun.
62:2857-2864[Abstract/Free Full Text].
|
| 23.
|
Kabat, E. A., and T. T. Wu.
1991.
Identical V region amino acid sequences and segments of sequences in antibodies of different specificities. Relative contributions of VH and VL genes, minigenes, and complementarity-determining regions to binding of antibody-combining sites.
J. Immunol.
147:1709-1719[Abstract].
|
| 24.
|
Kabat, E. A.,
T. T. Wu,
H. M. Perry,
K. S. Gottesman, and C. Foeller.
1991.
Proteins of immunological interest. Publication no. 91-3242.
National Institutes of Health, Bethesda, Md.
|
| 25.
|
Kirkham, P. M.,
F. Mortari,
J. A. Newton, and H. W. Schroeder.
1991.
Immunoglobulin VH clan and family identity predicts variable domain structure and may influence antigen binding.
EMBO J.
11:603-609[Medline].
|
| 26.
|
Lendvai, N., and A. Casadevall.
1999.
Antibody mediated toxicity in Cryptococcus neoformans infection: mechanism and relationship to antibody isotype.
J. Infect. Dis.
180:791-801[CrossRef][Medline].
|
| 27.
|
MacGill, T. C.,
R. S. MacGill,
A. Casadevall, and T. R. Kozel.
2000.
Biological correlates of capsular (quellung) reactions of Cryptococcus neoformans.
J. Immunol.
164:4835-4842[Abstract/Free Full Text].
|
| 28.
|
McLean, G.,
A. Nakouzi,
A. Casadevall, and N. S. Green.
2001.
Human and murine expression vector cassettes.
Mol. Immunol.
37:837-845.
|
| 29.
|
Mukherjee, J.,
A. Casadevall, and M. D. Scharff.
1993.
Molecular characterization of the antibody responses to Cryptococcus neoformans infection and glucuronoxylomannan-tetanus toxoid conjugate immunization.
J. Exp. Med.
177:1105-1106[Abstract/Free Full Text].
|
| 30.
|
Mukherjee, J.,
T. R. Kozel, and A. Casadevall.
1998.
Monoclonal antibodies reveal additional epitopes of serotype D Cryptococcus neoformans capsular glucuronoxylomannan that elicit protective antibodies.
J. Immunol.
161:3557-3568[Abstract/Free Full Text].
|
| 31.
|
Mukherjee, J.,
G. Nussbaum,
M. D. Scharff, and A. Casadevall.
1995.
Protective and nonprotective monoclonal antibodies to Cryptococcus neoformans originating from one B-cell.
J. Exp. Med.
181:405-409[Abstract/Free Full Text].
|
| 32.
|
Mukherjee, J.,
M. D. Scharff, and A. Casadevall.
1992.
Protective murine monoclonal antibodies to Cryptococcus neoformans.
Infect. Immun.
60:4534-4541[Abstract/Free Full Text].
|
| 33.
|
Mukherjee, J.,
M. D. Scharff, and A. Casadevall.
1994.
Cryptococcus neoformans infection can elicit protective antibodies in mice.
Can. J. Microbiol.
40:888-892[Medline].
|
| 34.
|
Mukherjee, S.,
M. Feldmesser, and A. Casadevall.
1996.
J774 murine macrophage-like cell interactions with Cryptococcus neoformans in the presence and absence of opsonins.
J. Infect. Dis.
173:1222-1231[Medline].
|
| 35.
|
Near, R. I.,
R. Bruccoleri,
J. Novotny,
N. W. Hudson,
A. White, and M. Mudgett-Hunter.
1991.
The specificity properties that distinguish members of a set of homologous anti-digoxin antibodies are controlled by H chain mutations.
J. Immunol.
146:627-633[Abstract].
|
| 36.
|
Nosanchuk, J. D., and A. Casadevall.
1997.
Cellular charge of Cryptococcus neoformans: contributions from the capsular polysaccharide, melanin, and monoclonal antibody binding.
Infect. Immun.
65:1836-1841[Abstract].
|
| 37.
|
Nosanchuk, J. D.,
W. Cleare,
S. P. Franzot, and A. Casadevall.
1999.
Amphotericin B and fluconazole affect cellular charge, macrophage phagocytosis, and cellular morphology of Cryptococcus neoformans at subinhibitory concentrations.
Antimicrob. Agents Chemother.
43:233-239[Abstract/Free Full Text].
|
| 38.
|
Nussbaum, G.,
S. Anandasabapathy,
J. Mukherjee,
M. Fan,
A. Casadevall, and M. D. Scharff.
1999.
Molecular and idiotypic analysis of the antibody response to Cryptococcus neoformans glucuronoxylomannan-protein conjugate vaccine in autoimmune and nonautoimmune mice.
Infect. Immun.
67:4469-4476[Abstract/Free Full Text].
|
| 39.
|
Nussbaum, G.,
W. Cleare,
A. Casadevall,
M. D. Scharff, and P. Valadon.
1997.
Epitope location in the Cryptococcus neoformans capsule is a determinant of antibody efficacy.
J. Exp. Med.
185:685-697[Abstract/Free Full Text].
|
| 40.
|
Pirofski, L.,
R. Lui,
M. DeShaw,
A. B. Kressel, and Z. Zhong.
1995.
Analysis of human monoclonal antibodies elicited by vaccination with a Cryptococcus neoformans glucuronoxylomannan capsular polysaccharide vaccine.
Infect. Immun.
63:3005-3014[Abstract].
|
| 41.
|
Richmond, D. V., and D. J. Fisher.
1973.
The electrophoretic mobility of microorganisms.
Adv. Microb. Physiol.
9:1-29[Medline].
|
| 42.
|
Sayle, R. A., and E. J. Milner-White.
1995.
RASMOL: biomolecular graphics for all.
Trends Biochem. Sci.
20:374[CrossRef][Medline].
|
| 43.
|
Valadon, P.,
G. Nussbaum,
L. F. Boyd,
D. H. Margulies, and M. D. Scharff.
1996.
Peptide libraries define the fine specificity of anti-polysaccharide antibodies to Cryptococcus neoformans.
J. Mol. Biol.
261:11-22[CrossRef][Medline].
|
| 44.
|
Valadon, P.,
G. Nussbaum,
J. Oh, and M. D. Scharff.
1998.
Aspects of antigen mimicry revealed by immunization with a peptide mimetic of Cryptococcus neoformans polysaccharide.
J. Immunol.
161:1829-1836[Abstract/Free Full Text].
|
| 45.
|
Vargas-Madrazo, E.,
F. Lara-Ochoa, and J. C. Almagro.
1995.
Canonical structure repertoire of the antigen-binding site of immunoglobulins suggests strong geometrical restrictions associated to the mechanism of immune recognition.
J. Mol. Biol.
254:497-504[CrossRef][Medline].
|
| 46.
|
Vecchiarelli, A., and A. Casadevall.
1998.
Antibody-mediated effects against Cryptococcus neoformans: evidence for interdependency and collaboration between humoral and cellular immunity.
Res. Immunol.
149:321-333[CrossRef][Medline].
|
| 47.
|
Young, A. C. M.,
P. Valadon,
A. Casadevall,
M. D. Scharff, and J. C. Sacchettini.
1997.
The three-dimensional structures of a polysaccharide binding antibody to Cryptococcus neoformans and its complex with a peptide from a phage display library: implication for the identification of peptide mimotopes.
J. Mol. Biol.
274:622-634[CrossRef][Medline].
|
| 48.
|
Yuan, R.,
A. Casadevall,
G. Spira, and M. D. Scharff.
1995.
Isotype switching from IgG3 to IgG1 converts a non-protective murine antibody to C. neoformans into a protective antibody.
J. Immunol.
154:1810-1816[Abstract].
|
| 49.
|
Zhang, H.,
Z. Zhong, and L. Pirofski.
1997.
Peptide epitopes recognized by a human anticryptococcal glucuronoxylomannan antibody.
Infect. Immun.
65:1158-1164[Abstract].
|
Infection and Immunity, May 2001, p. 3398-3409, Vol. 69, No. 5
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.5.3398-3409.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Frases, S., Nimrichter, L., Viana, N. B., Nakouzi, A., Casadevall, A.
(2008). Cryptococcus neoformans Capsular Polysaccharide and Exopolysaccharide Fractions Manifest Physical, Chemical, and Antigenic Differences. Eukaryot Cell
7: 319-327
[Abstract]
[Full Text]
-
Nimrichter, L., Frases, S., Cinelli, L. P., Viana, N. B., Nakouzi, A., Travassos, L. R., Casadevall, A., Rodrigues, M. L.
(2007). Self-Aggregation of Cryptococcus neoformans Capsular Glucuronoxylomannan Is Dependent on Divalent Cations. Eukaryot Cell
6: 1400-1410
[Abstract]
[Full Text]
-
Buchwald, U. K., Lees, A., Steinitz, M., Pirofski, L.-a.
(2005). A Peptide Mimotope of Type 8 Pneumococcal Capsular Polysaccharide Induces a Protective Immune Response in Mice. Infect. Immun.
73: 325-333
[Abstract]
[Full Text]
-
Maitta, R. W., Datta, K., Chang, Q., Luo, R. X., Witover, B., Subramaniam, K., Pirofski, L.-a.
(2004). Protective and Nonprotective Human Immunoglobulin M Monoclonal Antibodies to Cryptococcus neoformans Glucuronoxylomannan Manifest Different Specificities and Gene Use Profiles. Infect. Immun.
72: 4810-4818
[Abstract]
[Full Text]
-
McFadden, D. C., Casadevall, A.
(2004). Unexpected Diversity in the Fine Specificity of Monoclonal Antibodies That Use the Same V Region Gene to Glucuronoxylomannan of Cryptococcus neoformans. J. Immunol.
172: 3670-3677
[Abstract]
[Full Text]
-
Maitta, R. W., Datta, K., Lees, A., Belouski, S. S., Pirofski, L.-a.
(2004). Immunogenicity and Efficacy of Cryptococcus neoformans Capsular Polysaccharide Glucuronoxylomannan Peptide Mimotope-Protein Conjugates in Human Immunoglobulin Transgenic Mice. Infect. Immun.
72: 196-208
[Abstract]
[Full Text]
-
Beenhouwer, D. O., May, R. J., Valadon, P., Scharff, M. D.
(2002). High Affinity Mimotope of the Polysaccharide Capsule of Cryptococcus neoformans Identified from an Evolutionary Phage Peptide Library. J. Immunol.
169: 6992-6999
[Abstract]
[Full Text]
-
McLean, G. R., Torres, M., Elguezabal, N., Nakouzi, A., Casadevall, A.
(2002). Isotype Can Affect the Fine Specificity of an Antibody for a Polysaccharide Antigen. J. Immunol.
169: 1379-1386
[Abstract]
[Full Text]