Previous Article | Next Article 
Infection and Immunity, June 2001, p. 3605-3610, Vol. 69, No. 6
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.6.3605-3610.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Differential Induction of Gamma Interferon in Legionella
pneumophila- Infected Macrophages from BALB/c and A/J
Mice
Sheldon
Salins,
Catherine
Newton,*
Ray
Widen,
Thomas W.
Klein, and
Herman
Friedman
Department of Medical Microbiology and
Immunology, University of South Florida College of Medicine, Tampa,
Florida 33612
Received 9 August 2000/Returned for modification 22 November
2000/Accepted 6 March 2001
 |
ABSTRACT |
Gamma interferon (IFN-
), a pleiotropic cytokine, is now known to
be produced by macrophages as well as by NK cells, 
cells, and
activated T cells. The autocrine biological functions of IFN-
on the
macrophage include the upregulation of major histocompatibility complex
MHC class II and the activation to an antiviral state. In this study,
the production of IFN-
by macrophages was demonstrated to correspond
to antibacterial activity. Legionella pneumophila replicates intracellularly in thioglycolate (TG)-elicited macrophages (TG-macrophages) from A/J mice, while TG-macrophages from BALB/c mice
restrict bacterial growth after an initial period of growth. BALB/c
TG-macrophages were shown to express IFN-
mRNA at 24 and 28 h,
which corresponded to the initiation of anti-L. pneumophila activity. Moreover, IFN-
neutralization by antibody treatment of the
cultures resulted in increased L. pneumophila growth in the
macrophages. In contrast, no IFN-
mRNA was expressed in
TG-macrophages from A/J mice, where L. pneumophila grew
unrestricted. As would be expected, IFN-
treatment decreased
bacterial growth. An IFN-
-mediated antibacterial activity was,
however, inducible in A/J macrophages by the addition of interleukin-12
following L. pneumophila infection. Thus, autocrine IFN-
is involved in anti-L. pneumophila activity associated with
different growth patterns and appears to be important during
intracellular infection.
 |
INTRODUCTION |
Macrophages have long been
recognized as important in the production of proinflammatory cytokines
and chemokines involved in innate responses and in coordination of
adaptive immunity (1, 27). They are therefore important
components of host immunity to infection with intracellular pathogens
such as Mycobacterium spp. and Legionella spp.
(27). Legionella pneumophila replicates in
specialized vacuoles within human macrophages and monocytes (17,
20, 24) and certain types of murine macrophages (5, 35). Gamma interferon (IFN-
) (4, 14, 23, 30, 31, 34), lipopolysaccharide (LPS) (2, 8, 21), and tumor necrosis factor alpha (TNF-
) (21, 31) have been
demonstrated to activate host cells to control the growth of L. pneumophila. Interleukin-12 (IL-12) is also important in
regulating L. pneumophila growth, apparently through
TNF-
, during in vivo infection in A/J mice (6).
While macrophages are known to produce TNF-
and IL-12, the source of
IFN-
was generally considered to be NK cells, 
cells, and
activated T cells (18). However, recently IL-12 and other factors have been reported to induce macrophages to produce IFN-
(7, 9, 11, 22, 26, 33). Murine resident peritoneal macrophages constitutively produce IFN-
(7, 26), and
this production has been suggested to be important during the early immune response to infection (15). Resident macrophages do
not support the growth of L. pneumophila (36),
which is only partly due to reduced intracellular iron, an important
growth nutrient, in these cells (12). The presence of
IFN-
in the resident macrophages suggests that they may also have a
basal antimicrobial activation state, which, in combination with the
poor nutrient environment, inhibits the growth of L. pneumophila.
We have previously reported that thioglycolate (TG)-elicited
macrophages (TG-macrophages) from A/J mice are permissive for L. pneumophila growth while TG-macrophages from BALB/c mice are not
(36). The availability of iron or the productions of
nitric oxide (13) or of TNF-
(3) were
found not to differ between these macrophage cultures. Others have
observed variation in IFN-
production by TG-macrophages
(11) and bone marrow-derived macrophages (22)
from different mouse strains. Moreover, in vitro infection of alveolar
macrophages with Mycobacterium tuberculosis results in
IFN-
production (9). Therefore, we examined the
production of IFN-
by TG-macrophages from BALB/c and A/J mice. These
data demonstrate that L. pneumophila-infected BALB/c
macrophages produce IFN-
, which appears to be responsible, at least
in part, for the ability of BALB/c macrophages to restrict L. pneumophila growth. Macrophages from A/J mice did not produce
IFN-
unless they were stimulated by IL-12 treatment.
 |
MATERIALS AND METHODS |
Mice.
Female A/J and BALB/c mice, 6 to 8 weeks old (Jackson
Laboratory Bar Harbor, Maine), were used in these studies. They were housed and cared for in the USF Health Sciences Center animal facility,
which is fully accredited by the American Association for Accreditation
of Laboratory Animal Care.
Bacteria.
L. pneumophila M124, a serogroup 1 strain originally isolated at Tampa General Hospital (Tampa, Fla.), was
grown on buffered charcoal yeast extract agar (BCYE; Difco, Detroit,
Mich.) for 48 h from a passage 3 stock maintained at
80°C. The
avirulent strain used was isolated by serial passage of M124 on BCYE
and modified Mueller-Hinton agar (3). The bacteria were
suspended in pyrogen-free saline, and the concentration was adjusted spectrophotometrically.
Macrophage infections and stimulations.
Elicited macrophages
were collected 4 days after intraperitoneal injection of TG medium
(Difco) by peritoneal lavage with phosphate-buffered saline (Sigma, St.
Louis, Mo.). The peritoneal cells (106/ml) were cultured in
RPMI 1640 medium (Sigma) supplemented with 10% heat-inactivated fetal
calf serum (HyClone Laboratories, Logan, Utah) and 2-mercaptoethanol
(5 × 10
6 M; Sigma) in either 6-well (mRNA assays;
3 × 106 cells/well), 24-well (enzyme-linked
immunosorbent assays [ELISAs]; 1 × 106 cells/well),
or 96-well (CFU determination; 1 × 105 cells/well)
plates (Corning Costar Corp., Cambridge, Mass.) for 2 h. The
nonadherent cells (less than 5% lymphocytes) were removed by washing
three times. The adherent cells were then cultured in penicillin- and
streptomycin-supplemented medium overnight. The cells were washed three
times, cultured in penicillin- and streptomycin-free medium for an
additional hour, and washed two more times. The resultant adherent
population was more than 99% macrophages as determined by F4/80
staining and fluorescence microscopy. TG-macrophage monolayers were
infected with bacteria at a 10:1 ratio of bacteria (107/ml)
to cells (106/ml) for 30 min. Nonphagocytized bacteria were
removed by washing the macrophages three times. The infected
TG-macrophages were cultured for up to an additional 48 h.
Alternately, formalin-killed L. pneumophila
(108/ml) or Escherichia coli O111:B4 LPS (5 µg/ml; Sigma) was added to the 24-well plates for IL-12 ELISAs.
Cytokine addition or neutralization.
In some cultures,
recombinant IL-12 p70 (40 ng/ml), anti-IFN-
antibodies (10 µg/ml),
recombinant IFN-
(rIFN-
) (20 ng/ml), or anti-IL-12 p40/p70
antibodies (10 µg/ml) were added to the cultures following infection.
All cytokines and antibodies were obtained from PharMingen (San Diego,
Calif.).
CFU determinations.
At the indicated times, macrophage
cultures in the 96-well plates were lysed with 0.1% saponin (Sigma).
The lysates were diluted in Hanks balanced salt solution, plated on
BCYE plates, and incubated at 37°C for 72 h. CFU counts were
determined on an AutoCount apparatus (Dynatech Labs, Chantilly, Va.).
ELISAs.
Supernatants were collected from 24-well plates for
cytokine determinations. Cytokine levels of IFN-
and IL-12 p40/p70
were determined by sandwich ELISAs using antibody pairs from
PharMingen, following protocols previously described (25).
Briefly, the ELISAs were performed in Medium-Bind EIA plates (Costar)
with capture antibodies (IFN-
, 4µg/ml; IL-12, 10 µg/ml),
biotinylated detection antibodies (2 µg/ml), and
streptavidin-horseradish peroxidase (1:1,000) (Southern Biotechnology,
Birmingham, Ala.). 3,3',5,5'-Tetramethylbenzidine liquid substrate
system (TMB) (Sigma) was added for 5 to 30 min, and the horseradish
peroxidase reaction was stopped with 1 N sulfuric acid. The plates were
read at 450 nm on an Emax Microplate Reader (Molecular
Devices, Mento Park, Calif.). Concentrations were calculated from a
standard curve generated for each plate. The low-end sensitivity was
200 pg/ml for both ELISAs.
RT-PCR.
RNA was extracted by standard methods with 1 ml of
TriReagent (Sigma) per 3 × 106 macrophages. RNA was
quantitated using RiboGreen (Molecular Probes, Eugene, Oreg.) and an
fmax Fluorometer (Molecular Devices). Reverse transcription
(RT) of RNA (2 µg) was performed with avian myeloblastosis virus
reverse transcriptase, and the RT products (2 µl) were PCR amplified
as previously described (37). The primer sequences were as
follows: 5'CATTGAAAGCCTAGAAAGTCT and
3'CTCATGGAATGCATCCTTTTTCG for IFN-
and
5'ATGGATGACGATATCGCT and 3'ATGAGGTAGTCTGTCAGGT
for
-actin. Amplification cycles and annealing temperatures
were 40 cycles at 55°C for IFN-
and 26 cycles at 60°C for
-actin. The PCR was performed in a Minicycler (MJ Research,
Watertown, Miss.). The products were visualized with ethidium bromide
in a 2% agarose gel.
Statistical analysis.
Data were analyzed by one-way analysis
of variance with Dunnett's test for comparing individuals, using
SigmaStat (Jandel Scientific, San Rafael, Calif.).
 |
RESULTS |
L. pneumophila growth is unrestricted in A/J
macrophages and restricted in BALB/c macrophages.
TG-elicited
macrophages from A/J and BALB/c mice were infected with L. pneumophila, and CFU counts determined at 24 and 48 h
postinfection. L. pneumophila displayed continuous growth in A/J macrophages throughout the 48-h period, as indicated by the increase in CFU counts (Fig. 1). In
contrast, L. pneumophila initially grew in BALB/c
macrophages but was restricted after 24 h (Fig. 1).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
L. pneumophila growth patterns vary within
TG-macrophage cultures from A/J and BALB/c mice. TG-macrophages were
infected with L. pneumophila (10:1), and the cells were
washed and incubated for 24 or 48 h. The cells were lysed, and CFU
counts were determined. Data are means and standard errors of the means
(SEM) of four experiments.
|
|
Infected BALB/c macrophages express IFN-
mRNA.
The CFU data
above suggested that BALB/c macrophages, after the initial infection,
were activated in some way to suppress L. pneumophila
growth. We speculated that IFN-
production might be involved, and so
the level of cellular mRNA was examined. A/J and BALB/c TG-macrophage
cultures were infected and at 24 and 28 h postinfection, and RNA
was collected and analyzed by RT-PCR. IFN-
mRNA was not detected in
uninfected cultures or in infected A/J macrophages (Fig.
2). However, IFN-
mRNA was detected in infected BALB/c macrophages at both 24 and 28 h (Fig. 2). These time points corresponded to the times when CFU counts had leveled off
in BALB/c cultures (Fig. 1). We performed ELISA for IFN-
protein in
supernatants and freeze-thawed samples of BALB/c macrophage cultures at
24 and 48 h postinfection. The freeze-thawed samples were examined
because others had detected IFN-
only by intracellular immunofluorescence in TG-macrophages (11). The detected
levels were minimal (200 to 300 pg/ml) and just above the sensitivity end point for our ELISA system, with no significant difference being
observed between uninfected and L. pneumophila-infected cultures (data not shown). IFN-
was detectable in resident
peritoneal BALB/c macrophages (578 ± 166 pg/ml [total mean ± standard deviation]), with the majority being found in the
frozen-thawed samples. Interestingly, L. pneumophila
infection did not increase the amount of IFN-
, although the presence
of killed L. pneumophila did (1,026 ± 72 pg/ml).

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 2.
L. pneumophila induces IFN- mRNA in
TG-macrophage cultures from BALB/c mice. TG-macrophages were infected
with L. pneumophila (10:1) or left uninfected. The cells
were washed and incubated for 24 or 28 h. RNA was extracted,
subjected to RT-PCR, and then visualized on 2% agarose gel with
ethidium bromide. The gels are from a representative of three
experiments.
|
|
Anti-IFN-
antibodies increase L. pneumophila growth
in BALB/c macrophages while rIFN-
decreases growth in A/J
macrophages.
The RT-PCR data suggested that the induced IFN-
in
BALB/c macrophages was involved in the growth restriction of L. pneumophila. To examine this issue further, anti-IFN-
antibodies were added to the BALB/c macrophage cultures to neutralize
endogenous IFN-
. Antibody treatment increased the growth of L. pneumophila, as indicated by the higher CFU counts at 48 h
(Fig. 3A) compared to the control. The
addition of anti-IFN-
had no effect on L. pneumophila
growth in A/J macrophages (Fig. 3B), although rIFN-
treatment of
these cultures restricted the growth of L. pneumophila at
48 h (Fig. 3B).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 3.
Neutralizing IFN- increases L. pneumophila
growth in TG-macrophages from BALB/c mice (A) but IFN- decreases
growth in cultures from A/J mice (B). TG-macrophages were infected with
L. pneumophila (10:1). The cells were washed, anti-IFN-
antibodies were added, and the cells were incubated for 24 or 48 h. The cells were lysed, and CFU counts were determined. Data are means
and SEM of three experiments. *, P < 0.05.
|
|
Growth restriction of L. pneumophila in A/J and BALB/c
TG-macrophages in response to treatment with IL-12 p70 is mediated
through IFN-
.
Because IFN-
appeared to be involved in
restricting the growth of L. pneumophila and IL-12 activated
cells to produce IFN-
, bacterial growth was examined in macrophage
cultures treated with IL-12 p70. The addition of IL-12 after infection
significantly reduced the CFU counts in A/J macrophages (Fig.
4B); however, it caused only a slight
decrease in counts in BALB/c TG-macrophages, (Fig. 4A). The IL-12
restriction appeared to require at least 24 h to become effective.
To determine if the antimicrobial activity of IL-12 occurred via
IFN-
induction, IL-12 p70 and anti-IFN-
antibodies were added to
the infected cultures and CFU counts were determined at 48 h. In
BALB/c cultures, addition of anti-IFN-
antibodies increased the CFU
counts above those in the IL-12-treated cultures and control cultures
(Fig. 4A). This latter effect was seen previously in Fig. 3A and is
most probably due to neutralizing endogenous IFN-
. In A/J cultures,
the addition of anti-IFN-
antibodies also increased the CFU counts
to a level similar to that in the infected controls (Fig. 4B). Thus,
the restriction of bacterial growth by IL-12 p70 appeared to be
mediated through the induction of IFN-
.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
IL-12 treatment of L. pneumophila-infected
cultures decreased bacterial growth in TG-macrophages from BALB/c (A)
and A/J (B) mice, which was attenuated by neutralization of IFN- .
TG-macrophages were infected with L. pneumophila (10:1). The
cells were washed, and IL-12 or a combination of IL-12 and anti-IFN-
antibodies was added. The cells were lysed at 24 or 48 h
postinfection, and CFU counts were determined. Data are means and SEM
of three experiments. *, P < 0.05.
|
|
Addition of IL-12 induces IFN-
mRNA expression in infected
TG-macrophage.
To determine if IL-12 was inducing IFN-
mRNA, as
the antibody neutralization studies implied, RT-PCR was performed on
IL-12-treated, infected macrophage cultures at 24 and 28 h
postinfection. As seen in Fig. 5, the
addition of IL-12 to A/J macrophage cultures induced a weak but
detectable IFN-
band at 24 h and a stronger band at 28 h.
These results are in contrast to those in Fig. 2, wherein no IFN-
expression was detected. In BALB/c cultures, the IL-12 had little
effect on IFN-
induction. These results supported the CFU data
observed in Fig. 4, in that IL-12 treatment had a much stronger effect
on macrophages from A/J mice than on those from BALB/c mice.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
IL-12 treatment of L. pneumophila-infected
cultures induces IFN- mRNA. TG-macrophages were infected with
L. pneumophila (10:1). The cells were washed, and IL-12 p70
was added. After 24 or 28 h of incubation, RNA was extracted,
subjected to RT-PCR, and then visualized on 2% agarose gel with
ethidium bromide. The gels are from a representative of three
experiments.
|
|
L. pneumophila infection has little effect on IL-12
p40/p70 production.
Because it is thought that bacterial
infections induce IL-12 and the current data demonstrate that IL-12
inhibited L. pneumophila growth by inducing IFN-
, the
production of IL-12 following infection was examined. TG-macrophage
cultures were exposed to virulent or avirulent L. pneumophila or stimulated with killed L. pneumophila or
E. coli LPS. The culture supernatants were harvested, and
the IL-12 protein levels were measured. As shown in Fig.
6, small but equivalent amounts of IL-12
p40/p70 were detected following infection of macrophage cultures from
A/J and BALB/c mice. Avirulent L. pneumophila, as well as
killed L. pneumophila, induced more IL-12 p40/p70 protein.
E. coli LPS was included as a positive control and induced
even more IL-12. The low induction of IL-12 observed following L. pneumophila infection was supported by studies examining the
effect of anti-IL-12 antibody treatment on L. pneumophila growth. Macrophage cultures from A/J and BALB/c mice were either infected only or infected and treated with anti-IL-12 p70. The results
showed that antibody treatment had little effect on the number of CFU
counts in either A/J or BALB/c macrophage cultures (Fig.
7). Slight decreases in CFU counts were
observed in the BALB/c macrophages (Fig. 7A), which contrast with the
increased CFU counts that one would predict if endogenous IL-12 was
inducing the IFN-
. These results suggested that L. pneumophila infection of these cells induced small amounts of
IL-12, which had little effect on the subsequent capacity of the
cultures to support the growth of the bacteria.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 6.
L. pneumophila infection induces little IL-12
p40/p70, although avirulent or killed L. pneumophila
stimulates higher levels. TG-macrophages were infected with virulent
L. pneumophila (Lp) or avirulent L. pneumophila
(AvLp) as described in Materials and Methods or stimulated with
formalin-killed L. pneumophila (kLp) or E. coli
LPS. At 24 h, supernatants were collected and analyzed by ELISA
for IL-12 p40/p70. Data are the means and SEM of three experiments.
|
|

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 7.
Neutralizing IL-12 has no effect on the growth of
L. pneumophila in TG-macrophages from BALB/c (A) or A/J (B)
mice. TG-macrophages were infected with L. pneumophila
(10:1). The cells were washed, and anti-IL-12 antibodies were added.
After 24 of 48 h of incubation, the cells were lysed and CFU
counts were determined. Data are means and SEM of three experiments.
|
|
 |
DISCUSSION |
TG-elicited macrophages from BALB/c and A/J mice in culture have
very different capacities to support the intracellular growth of
L. pneumophila, with BALB/c macrophages displaying a
restrictive phenotype and A/J macrophages displaying a permissive
phenotype. Our results show that infected BALB/c macrophages produce
IFN-
, as demonstrated by RT-PCR and antibody neutralization studies, at a time when the cells were initiating anti-L. pneumophila
activity. Furthermore, permissive A/J macrophages did not express
IFN-
mRNA, nor did anti-IFN-
treatment affect bacterial growth.
Thus, a correlation between IFN-
production and the induction of
antibacterial activity was suggested. This IFN-
-mediated
anti-Legionella activity was further demonstrated by
IL-12-induced antimicrobial activity. We observed that IL-12 treatment
increased anti-L. pneumophila activity in TG-macrophages
from both mouse strains by a mechanism involving IFN-
. A similar
IL-12-induced antiviral activation of macrophages has been reported to
also involve IFN-
(26). Therefore, although L. pneumophila-infected macrophages from A/J and BALB/c mice differ
in their initial potential for IFN-
production, the addition of
IL-12 could induce IFN-
and a corresponding antibacterial state in
both strains of macrophages.
The mechanisms involved in IFN-
induction by BALB/c TG-macrophages,
as well as an explanation of the difference between cells from the
mouse strains, are unclear. The literature suggests that IL-12 is
involved in IFN-
production by macrophages. The induction of IFN-
by M. tuberculosis in alveolar macrophages is partially blocked by anti-IL-12 antibodies (9). Furthermore, Wang et al. observed that lung macrophages from IL-12
/
mice did
not produce IFN-
when stimulated with LPS or purified protein
derivative, while wild-type cells did (33). However, when
IL-12 (20 pg/ml) was added to stimulated IL-12
/
cells,
they produced IFN-
. In our studies, only BALB/c macrophages produced
IFN-
in response to L. pneumophila infection even though IL-12 production by both cell types was equivalent. Although the small
amount of IL-12 (~200 pg/ml) produced might have been sufficient to
induce IFN-
, as previously demonstrated in alveolar macrophages (33), IL-12 neutralization studies (Fig. 7) suggested that
endogenous IL-12 was not affecting L. pneumophila growth.
Additional studies are required to determine if endogenous IL-12 is
inducing IFN-
or if an IL-12-independent mechanism of induction is involved.
The relatively low level of IL-12 p40/p70 detected in the macrophage
cultures surprised us. We had previously observed that IL-12 in the
nanogram-per-milliliter range was detected in the serum of mice within
3 h of a systemic infection (19). The reason for this
discrepancy is unclear, but it may be due to IL-12 production by other
antigen-presenting cells such as dendritic cells, as has been observed
in Toxoplasma gondii (28, 29) and
Leishmania donovani (16) infections.
Alternately, cofactors such as cytokines or CD40/CD40L interactions
that are present in vivo may be required for optimal IL-12 production.
Bone marrow-derived macrophages from C57BL/6 mice require priming with
IFN-
to produce IL-12 when infected with Mycobacterium
bovis BCG (10). Furthermore, macrophages from IFN
regulatory factor 1 (IRF-1)-deficient mice have impaired IL-12
production that is associated with a failed Th1 development
(32). These observations suggest that the autocrine IFN-
could prime the cells for IL-12 production. However, that does
not appear to have occurred in our study, because the two types of
infected macrophages produced equivalent IL-12 levels while only BALB/c
macrophages expressed IFN-
mRNA.
Since the recognition that macrophages produce IFN-
, the biological
significance of this production has been questioned (15). A variety of macrophage populations have been demonstrated to produce
IFN-
, from human (9) and murine (33)
alveolar macrophages to resting (7, 26) and elicited
(11) murine peritoneal macrophages. The IFN-
induction
has been demonstrated to upregulate nitric oxide synthase, CD40
(22), and major histocompatibility complex class II
expression (33), in addition to activating an antiviral
state (26). In this study we demonstrated that IFN-
induction caused the activation of antibacterial activity that
inhibited the growth of L. pneumophila in TG-macrophage
cultures. This induction explains, in part, the variation in growth
patterns of L. pneumophila within macrophages from the two
strains of mice and demonstrates a definite biological function for the
IFN-
. The autocrine activity of IFN-
in macrophages therefore
appears to be important during infection at least with intracellular bacteria.
 |
ACKNOWLEDGMENT |
This work was supported by Public Health Service grant AI45169
from the National Institute of Allergy and Infectious Diseases.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Medical Microbiology and Immunology, University of South Florida, 12901 Bruce B. Downs Blvd., Tampa, FL 33612. Phone: (813) 974-4017. Fax:
(813) 974-4151. E-mail: cnewton{at}hsc.usf.edu.
Editor:
S. H. E. Kaufmann
 |
REFERENCES |
| 1.
|
Aderem, A., and D. M. Underhill.
1999.
Mechanisms of phagocytosis in macrophages.
Annu. Rev. Immunol.
17:593-623[CrossRef][Medline].
|
| 2.
|
Arata, S.,
C. Newton,
T. W. Klein, and H. Friedman.
1993.
Legionella pneumophila growth restriction in permissive macrophages cocultured with nonpermissive lipopolysaccharide-activated macrophages.
Infect. Immun.
61:5056-5061[Abstract/Free Full Text].
|
| 3.
|
Arata, S.,
C. Newton,
T. W. Klein,
Y. Yamamoto, and H. Friedman.
1993.
Legionella pneumophila induced tumor necrosis factor production in permissive versus nonpermissive macrophages.
Proc. Soc. Exp. Biol. Med.
203:26-29[CrossRef][Medline].
|
| 4.
|
Bhardwaj, N.,
T. W. Nash, and M. A. Horwitz.
1986.
Interferon-gamma-activated human monocytes inhibit the intracellular multiplication of Legionella pneumophila.
J. Immunol.
137:2662-2669[Abstract].
|
| 5.
|
Brieland, J.,
P. Freeman,
R. Kunkel,
C. Chrisp,
M. Hurley,
J. Fantone, and C. Engleberg.
1994.
Replicative Legionella pneumophila lung infection in intratracheally inoculated A/J mice. A murine model of human Legionnaires' disease.
Am. J. Pathol.
145:1537-1546[Abstract].
|
| 6.
|
Brieland, J. K.,
D. G. Remick,
M. L. LeGendre,
N. C. Engleberg, and J. C. Fantone.
1998.
In vivo regulation of replicative Legionella pneumophila lung infection by endogenous interleukin-12.
Infect. Immun.
66:65-69[Abstract/Free Full Text].
|
| 7.
|
Di Marzio, P.,
P. Puddu,
L. Conti,
F. Belardelli, and S. Gessani.
1994.
Interferon gamma upregulates its own gene expression in mouse peritoneal macrophages.
J. Exp. Med.
179:1731-1736[Abstract/Free Full Text].
|
| 8.
|
Egawa, K.,
T. W. Klein,
Y. Yamamoto,
C. A. Newton, and H. Friedman.
1992.
Enhanced growth restriction of Legionella pneumophila in endotoxin-treated macrophages.
Proc. Soc. Exp. Biol. Med.
200:338-342[CrossRef][Medline].
|
| 9.
|
Fenton, M. J.,
M. W. Vermeulen,
S. Kim,
M. Burdick,
R. M. Strieter, and H. Kornfeld.
1997.
Induction of gamma interferon production in human alveolar macrophages by Mycobacterium tuberculosis.
Infect. Immun.
65:5149-5156[Abstract].
|
| 10.
|
Flesch, I. E.,
J. H. Hess,
S. Huang,
M. Aguet,
J. Rothe,
H. Bluethmann, and S. H. Kaufmann.
1995.
Early interleukin 12 production by macrophages in response to mycobacterial infection depends on interferon gamma and tumor necrosis factor alpha.
J. Exp. Med.
181:1615-1621[Abstract/Free Full Text].
|
| 11.
|
Fultz, M. J.,
S. A. Barber,
C. W. Dieffenbach, and S. N. Vogel.
1993.
Induction of IFN-gamma in macrophages by lipopolysaccharide.
Int. Immunol.
5:1383-1392[Abstract/Free Full Text].
|
| 12.
|
Gebran, S. J.,
C. Newton,
Y. Yamamoto,
R. Widen,
T. W. Klein, and H. Friedman.
1994.
Macrophage permissiveness for Legionella pneumophila growth modulated by iron.
Infect. Immun.
62:564-568[Abstract/Free Full Text].
|
| 13.
|
Gebran, S. J.,
Y. Yamamoto,
S. McHugh,
C. Newton,
T. W. Klein, and H. Friedman.
1994.
Differences and similarities in permissive A/J versus non-permissive BALB/c murine macrophages infected with Legionella pneumophila: the role of iron.
FEMS Immunol. Med. Microbiol.
9:7-14[CrossRef][Medline].
|
| 14.
|
Gebran, S. J.,
Y. Yamamoto,
C. Newton,
T. W. Klein, and H. Friedman.
1994.
Inhibition of Legionella pneumophila growth by gamma interferon in permissive A/J mouse macrophages: role of reactive oxygen species, nitric oxide, tryptophan, and iron(III).
Infect. Immun.
62:3197-3205[Abstract/Free Full Text].
|
| 15.
|
Gessani, S., and F. Belardelli.
1998.
IFN-gamma expression in macrophages and its possible biological significance.
Cytokine Growth Factor Rev.
9:117-123[CrossRef][Medline].
|
| 16.
|
Gorak, P. M.,
C. R. Engwerda, and P. M. Kaye.
1998.
Dendritic cells, but not macrophages, produce IL-12 immediately following Leishmania donovani infection.
Eur. J. Immunol.
28:687-695[CrossRef][Medline].
|
| 17.
|
Horwitz, M. A., and S. C. Silverstein.
1980.
Legionnaires' disease bacterium (Legionella pneumophila) multiples intracellularly in human monocytes.
J. Clin. Investig.
66:441-450.
|
| 18.
|
Kaufmann, S. H.
1993.
Immunity to intracellular bacteria.
Annu. Rev. Immunol.
11:129-163[CrossRef][Medline].
|
| 19.
|
Klein, T. W.,
C. A. Newton,
N. Nakachi, and H. Friedman.
2000.
9-tetrahydrocannabinol treatment suppresses immunity and early IFN-gamma, IL-12, and IL-12 receptor 2 responses to Legionella pneumophila infection.
J. Immunol.
164:6461-6466[Abstract/Free Full Text].
|
| 20.
|
Marra, A.,
M. A. Horwitz, and H. A. Shuman.
1990.
The HL-60 model for the interaction of human macrophages with the Legionnaires' disease bacterium.
J. Immunol.
144:2738-2744[Abstract].
|
| 21.
|
Matsiota-Bernard, P.,
C. Lefebre,
M. Sedqui,
P. Cornillet, and M. Guenounou.
1993.
Involvement of tumor necrosis factor alpha in intracellular multiplication of Legionella pneumophila in human monocytes.
Infect. Immun.
61:4980-4983[Abstract/Free Full Text].
|
| 22.
|
Munder, M.,
M. Mallo,
K. Eichmann, and M. Modolell.
1998.
Murine macrophages secrete interferon gamma upon combined stimulation with interleukin (IL)-12 and IL-18: a novel pathway of autocrine macrophage activation.
J. Exp. Med.
187:2103-2108[Abstract/Free Full Text].
|
| 23.
|
Nash, T. W.,
D. M. Libby, and M. A. Horwitz.
1988.
IFN-gamma-activated human alveolar macrophages inhibit the intracellular multiplication of Legionella pneumophila.
J. Immunol.
140:3978-3981[Abstract].
|
| 24.
|
Nash, T. W.,
D. M. Libby, and M. A. Horwitz.
1984.
Interaction between the legionnaires' disease bacterium (Legionella pneumophila) and human alveolar macrophages. Influence of antibody, lymphokines, and hydrocortisone.
J. Clin. Investig.
74:771-782.
|
| 25.
|
Newton, C.,
T. Klein, and H. Friedman.
1998.
The role of macrophages in THC-induced alteration of the cytokine network.
Adv. Exp. Med. Biol.
437:207-214[Medline].
|
| 26.
|
Puddu, P.,
L. Fantuzzi,
P. Borghi,
B. Varano,
G. Rainaldi,
E. Guillemard,
W. Malorni,
P. Nicaise,
S. F. Wolf,
F. Belardelli, and S. Gessani.
1997.
IL-12 induces IFN-gamma expression and secretion in mouse peritoneal macrophages.
J. Immunol.
159:3490-3497[Abstract].
|
| 27.
|
Schaible, U. E.,
H. L. Collins, and S. H. Kaufmann.
1999.
Confrontation between intracellular bacteria and the immune system.
Adv. Immunol.
71:267-377[Medline].
|
| 28.
|
Sher, A.,
S. Hieny,
H. Charest,
T. Scharton-Kersten,
C. Collazo,
R. N. Germain, and C. Reis e Sousa.
1998.
The role of dendritic cells in the initiation of host resistance to Toxoplasma gondii.
Adv. Exp. Med. Biol.
452:103-110[Medline].
|
| 29.
|
Sher, A., and C. Reis e Sousa.
1998.
Ignition of the type 1 response to intracellular infection by dendritic cell-derived interleukin-12.
Eur. Cytokine Netw.
9:65-68[Medline].
|
| 30.
|
Skerrett, S. J., and T. R. Martin.
1992.
Recombinant murine interferon-gamma reversibly activates rat alveolar macrophages to kill Legionella pneumophila.
J. Infect. Dis.
166:1354-1361[Medline].
|
| 31.
|
Skerrett, S. J., and T. R. Martin.
1996.
Roles for tumor necrosis factor alpha and nitric oxide in resistance of rat alveolar macrophages to Legionella pneumophila.
Infect. Immun.
64:3236-3243[Abstract].
|
| 32.
|
Taki, S.,
T. Sato,
K. Ogasawara,
T. Fukuda,
M. Sato,
S. Hida,
G. Suzuki,
M. Mitsuyama,
E. H. Shin,
S. Kojima,
T. Taniguchi, and Y. Asano.
1997.
Multistage regulation of Th1-type immune responses by the transcription factor IRF-1.
Immunity
6:673-679[CrossRef][Medline].
|
| 33.
|
Wang, J.,
J. Wakeham,
R. Harkness, and Z. Xing.
1999.
Macrophages are a significant source of type 1 cytokines during mycobacterial infection.
J. Clin. Investig.
103:1023-1029[Medline].
|
| 34.
|
Watanabe, M.,
Y. Shimamoto,
S. Yoshida,
K. Suga,
Y. Mizuguchi,
O. Kohashi, and M. Yamaguchi.
1993.
Intracellular multiplication of Legionella pneumophila in HL-60 cells differentiated by 1,25-dihydroxyvitamin D3 and the effect of interferon gamma.
J. Leukoc. Biol.
54:40-46[Abstract].
|
| 35.
|
Yamamoto, Y.,
T. W. Klein,
C. A. Newton, and H. Friedman.
1988.
Interaction of Legionella pneumophila with peritoneal macrophages from various mouse strains.
Adv. Exp. Med. Biol.
239:89-98[Medline].
|
| 36.
|
Yamamoto, Y.,
T. W. Klein,
C. A. Newton,
R. Widen, and H. Friedman.
1988.
Growth of Legionella pneumophila in thioglycolate-elicited peritoneal macrophages from A/J mice.
Infect. Immun.
56:370-375[Abstract/Free Full Text].
|
| 37.
|
Yamamoto, Y.,
C. Retzlaff,
P. He,
T. W. Klein, and H. Friedman.
1995.
Quantitative reverse transcription-PCR analysis of Legionella pneumophila-induced cytokine mRNA in different macrophage populations by high-performance liquid chromatography.
Clin. Diagn. Lab. Immunol.
2:18-24[Abstract].
|
Infection and Immunity, June 2001, p. 3605-3610, Vol. 69, No. 6
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.6.3605-3610.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Hayakawa, K., Tateda, K., Fuse, E. T., Matsumoto, T., Akasaka, Y., Ishii, T., Nakayama, T., Taniguchi, M., Kaku, M., Standiford, T. J., Yamaguchi, K.
(2008). Paradoxically high resistance of natural killer T (NKT) cell-deficient mice to Legionella pneumophila: another aspect of NKT cells for modulation of host responses. J Med Microbiol
57: 1340-1348
[Abstract]
[Full Text]
-
Fuse, E. T., Tateda, K., Kikuchi, Y., Matsumoto, T., Gondaira, F., Azuma, A., Kudoh, S., Standiford, T. J., Yamaguchi, K.
(2007). Role of Toll-like receptor 2 in recognition of Legionella pneumophila in a murine pneumonia model. J Med Microbiol
56: 305-312
[Abstract]
[Full Text]
-
Newton, C. A., Perkins, I., Widen, R. H., Friedman, H., Klein, T. W.
(2007). Role of Toll-Like Receptor 9 in Legionella pneumophila-Induced Interleukin-12 p40 Production in Bone Marrow-Derived Dendritic Cells and Macrophages from Permissive and Nonpermissive Mice. Infect. Immun.
75: 146-151
[Abstract]
[Full Text]
-
Lu, T., Newton, C., Perkins, I., Friedman, H., Klein, T. W.
(2006). Cannabinoid Treatment Suppresses the T-Helper Cell-Polarizing Function of Mouse Dendritic Cells Stimulated with Legionella pneumophila Infection. J. Pharmacol. Exp. Ther.
319: 269-276
[Abstract]
[Full Text]
-
Sporri, R., Joller, N., Albers, U., Hilbi, H., Oxenius, A.
(2006). MyD88-Dependent IFN-{gamma} Production by NK Cells Is Key for Control of Legionella pneumophila Infection. J. Immunol.
176: 6162-6171
[Abstract]
[Full Text]
-
Yoshizawa, S., Tateda, K., Matsumoto, T., Gondaira, F., Miyazaki, S., Standiford, T. J., Yamaguchi, K.
(2005). Legionella pneumophila Evades Gamma Interferon-Mediated Growth Suppression through Interleukin-10 Induction in Bone Marrow-Derived Macrophages. Infect. Immun.
73: 2709-2717
[Abstract]
[Full Text]
-
Schleicher, U., Hesse, A., Bogdan, C.
(2005). Minute numbers of contaminant CD8+ T cells or CD11b+CD11c+ NK cells are the source of IFN-{gamma} in IL-12/IL-18-stimulated mouse macrophage populations. Blood
105: 1319-1328
[Abstract]
[Full Text]
-
Akamine, M., Higa, F., Arakaki, N., Kawakami, K., Takeda, K., Akira, S., Saito, A.
(2005). Differential Roles of Toll-Like Receptors 2 and 4 in In Vitro Responses of Macrophages to Legionella pneumophila. Infect. Immun.
73: 352-361
[Abstract]
[Full Text]
-
Derre, I., Isberg, R. R.
(2004). Macrophages from Mice with the Restrictive Lgn1 Allele Exhibit Multifactorial Resistance to Legionella pneumophila. Infect. Immun.
72: 6221-6229
[Abstract]
[Full Text]
-
Amarante-Paffaro, A, Queiroz, G S, Correa, S T, Spira, B, Bevilacqua, E
(2004). Phagocytosis as a potential mechanism for microbial defense of mouse placental trophoblast cells. Reproduction
128: 207-218
[Abstract]
[Full Text]
-
Schiavoni, G., Mauri, C., Carlei, D., Belardelli, F., Castellani Pastoris, M., Proietti, E.
(2004). Type I IFN Protects Permissive Macrophages from Legionella pneumophila Infection through an IFN-{gamma}-Independent Pathway. J. Immunol.
173: 1266-1275
[Abstract]
[Full Text]
-
Kikuchi, T., Kobayashi, T., Gomi, K., Suzuki, T., Tokue, Y., Watanabe, A., Nukiwa, T.
(2004). Dendritic Cells Pulsed with Live and Dead Legionella pneumophila Elicit Distinct Immune Responses. J. Immunol.
172: 1727-1734
[Abstract]
[Full Text]