Previous Article | Next Article ![]()
Infection and Immunity, June 2001, p. 3744-3754, Vol. 69, No. 6
Department of Molecular Biology and
Biotechnology, University of Sheffield, Western Bank, Sheffield S10
2TN,1 and Department of Microbiology,
University of Leeds, Leeds,3 England, and
Microbiology and Tumour Biology Centre, Karolinska
Institute, 17177 Stockholm, Sweden2
Received 4 January 2001/Returned for modification 12 February
2001/Accepted 14 March 2001
The Staphylococcus aureus genome encodes three
ferric uptake regulator (Fur) homologues: Fur, PerR, and Zur. To
determine the exact role of PerR, we inactivated the gene by allelic
replacement using a kanamycin cassette, creating strain MJH001
(perR). PerR was found to control transcription of the
genes encoding the oxidative stress resistance proteins catalase
(KatA), alkyl hydroperoxide reductase (AhpCF), bacterioferritin
comigratory protein (Bcp), and thioredoxin reductase (TrxB).
Furthermore, PerR regulates transcription of the genes encoding the
iron storage proteins ferritin (Ftn) and the ferritin-like Dps
homologue, MrgA. Transcription of perR was
autoregulated, and PerR repressed transcription of the iron homeostasis
regulator Fur, which is a positive regulator of catalase expression.
PerR functions as a manganese-dependent, transcriptional repressor of
the identified regulon. Elevated iron concentrations produced induction
of the PerR regulon. PerR may act as a peroxide sensor, since addition
of external hydrogen peroxide to 8325-4 (wild type) resulted in
increased transcription of most of the PerR regulon, except for
fur and perR itself. The PerR-regulated
katA gene encodes the sole catalase of S.
aureus, which is an important starvation survival determinant
but is surprisingly not required for pathogenicity in a murine skin
abscess model of infection. In contrast, PerR is not necessary for
starvation survival but is required for full virulence
(P < 0.005) in this model of infection. PerR of
S. aureus may act as a redox sentinel protein during
infection, analogous to the in vitro activities of OxyR and PerR of
Escherichia coli and Bacillus subtilis,
respectively. However, it differs in its response to the metal
balance within the cell and has the added capability of regulating iron
uptake and storage.
The relationship between
invading pathogenic bacteria and their host is dynamic, with bacteria
having to rapidly adapt to the hostile and changing environment which
they have entered. Metal ion acquisition is essential for pathogen
proliferation, and limitation is a nonspecific host response to
infection (10), which reduces the ability of bacteria to
replicate and increases their susceptibility to clearance by the immune
system. Iron is an essential nutrient in vivo and together with
manganese is an important cofactor for bacterial antioxidant defense
enzymes, e.g., catalase, peroxidase, and superoxide dismutase (SOD)
(1, 48). Consequently, bacteria have evolved specialized
proteins that monitor metal ion levels and respond accordingly by
regulating gene expression (31, 51). These
metalloregulatory proteins cluster in four distinct families
represented by Fur (ferric uptake regulator), DtxR (diphtheria toxin
repressor), MerR, and ArsR (53). The well-characterized
DtxR from Corynebacterium diphtheriae (61) and
Fur (26) have similar roles with respect to iron homeostasis and toxin synthesis; however, these two proteins share little amino acid homology, and their consensus DNA binding sequences are different.
Four metal ion-dependent repressors have been identified in
Bacillus subtilis: three Fur-like proteins, Fur, PerR, and
Zur (13, 28), and the recently identified DtxR-like
protein, MntR (53). Fur controls iron homeostasis via a
regulon of iron transporters, iron siderophore transporters, and
siderophore biosynthesis proteins. Zinc homeostasis is maintained by
Zur-mediated repression of two operons encoding zinc uptake
transporters. MntR is a bifunctional, manganese-responsive regulator of
two manganese transporters, MntABCD and MntH, which are both
selectively repressed by high levels of Mn(II) while MntR functions as
a positive regulator of the mntABCD operon under low-Mn(II)
growth conditions (53). MntH belongs to the Nramp family
of proteins and has been proposed previously to have a role in the
pathogenesis of Salmonella enterica serovar Typhimurium
(42).
Genetic evidence revealed that B. subtilis PerR is a
manganese- and iron-responsive transcriptional repressor of the
genes encoding a catalase, alkyl hydroperoxide reductase
(AhpCF); a Dps homologue (MrgA); and heme biosynthesis
enzymes (13, 17, 18). Furthermore, PerR was hydrogen
peroxide responsive, a property that makes it functionally analogous to
OxyR, the well-characterized peroxide stress regulator in
Escherichia coli. It was proposed elsewhere that peroxide
stress activation of B. subtilis PerR was linked to the
bound metal ion, a feature that would separate it mechanistically from
OxyR, which is activated by
H2O2-catalyzed disulfide
bond formation and is not metalliferous (13, 69). A
homologue of PerR in the gram-negative pathogen Campylobacter jejuni was similarly shown to repress catalase and AhpC in
response to iron; however, regulation by manganese was not investigated (62). The Streptococcus pyogenes PerR was shown
to be required for an inducible peroxide stress response
(43). Intriguingly, this inducible response did not
involve AhpC or MrgA, and it was suggested that a novel mechanism of
peroxide stress management may exist in S. pyogenes
(43)
Staphylococcus aureus successfully colonizes humans and
commonly forms part of the flora of the anterior nares and the skin. Its versatility makes it an important pathogen that can infect a
diversity of tissues causing a wide spectrum of diseases
(24). Many staphylococcal virulence determinants are known
and include adhesins, hemolysins, proteases, and superantigenic toxins
that are mainly controlled by the interdependent, global regulators Agr
and SarA (16, 20, 44). Intracellular survival in
neutrophils (30), endothelial cells (63),
epithelial cells (8), and osteoblasts (38)
has been described previously, suggesting that both intracellular
survival and extracellular multiplication play important roles in the
pathogenesis of S. aureus infections. The determinants that
promote in vivo survival intracellularly are poorly defined.
S. aureus has homologues of the four main metal
ion-dependent repressors, Fur, PerR, Zur, and MntR. S. aureus Fur has been shown to be an iron-dependent repressor in
vitro (68). Recently, we have shown that Fur represses the
transcription of a number of iron uptake transporters and positively
regulates, either directly or indirectly, catalase expression
(37). Inactivation of fur was shown to impact
on virulence, although this may simply be due to the fact that under
some conditions growth rate was affected by the loss of Fur
(37). S. aureus Zur mediates zinc homeostasis but is not important for virulence, and the functions of PerR and MntR
have yet to be determined. The Staphylococcus epidermidis MntR homologue SirR was identified in vitro as an iron-regulated DtxR-like protein (34).
The importance of in vivo expression of the oxidative stress enzymes
catalase and SOD has been suggested through the analysis of clinical
isolates with reduced levels of expression of these enzymes (40,
46). In contrast, in vivo expression of one of the two SODs,
SodA, was shown not to be important for pathogenicity despite
contributing to survival in vitro (21).
In this report, we demonstrate that PerR controls a regulon of
oxidative stress resistance and iron storage proteins in S. aureus. Furthermore, we demonstrate that PerR-dependent control of
this regulon is important for pathogenicity.
Media and growth conditions.
S. aureus, and
E. coli strains and plasmids are listed in Table
1. E. coli was grown in
Luria-Bertani (LB) medium at 37°C. S. aureus was grown at
37°C with shaking at 250 rpm in brain heart infusion (BHI) broth
(Oxoid), in chemically defined medium (CDM) (64), or in
chemically defined metal-limitation medium (CL) (37). CLR
medium consists of CL (which contains 400 µM magnesium sulfate)
without glucose and replete with the following metals added at an 0.2 µM final concentration: calcium chloride, copper sulfate, ferrous
sulfate, manganese chloride, nickel sulfate, molybdenum sulfate, and
zinc sulfate. Colonies from non-Chelex-treated CL agar plates were used
to inoculate a CLR preculture. Experimental 25-ml cultures in
acid-washed, 250-ml flasks were inoculated at a starting optical
density at 600 nm (OD600) of 0.002 prior to growth at 37°C. When included, antibiotics were added at the
indicated concentrations: ampicillin, 100 mg
liter
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.6.3744-3754.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
PerR Controls Oxidative Stress Resistance and Iron Storage
Proteins and Is Required for Virulence in Staphylococcus
aureus
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
1; kanamycin, 50 mg
liter
1; neomycin, 50 mg
liter
1; and erythromycin and lincomycin, 5 and
25 mg liter
1, respectively.
TABLE 1.
Strains, plasmids, and primers used in this study
Construction of strains. Derivatives of plasmid pAZ106, an integrating plasmid conferring resistance to erythromycin and containing a promoterless lacZ gene (16), or plasmid pAUL-A, a temperature-sensitive integrating plasmid conferring resistance to erythromycin (15), were constructed using PCR with Pwo polymerase (Roche) and standard cloning techniques (56). A plasmid for disrupting perR was constructed by PCR amplification of a 2-kb perR fragment using primers OL7, OL8, OL9, and OL10 (Table 1) to insert an internal ClaI site by the site-directed mutagenesis method of Higuchi (33). This fragment was cloned into pAUL-A, creating pMAL5, and then a 1.5-kb ClaI fragment containing a kanamycin cassette from pDG782 (32) was inserted to produce pMAL7.
Transcriptional reporter fusions to the perR, fur, katA, ahpC, mrgA, bcp, ftn, and trxB genes were made by PCR amplification of suitable DNA fragments using primers detailed in Table 1 followed by cloning into pAZ106, creating the plasmids pMAL9, pMAL10, pMAL11, pMAL12, pMAL13, pMAL28, pMAL29, and pMAL30, respectively. Typically, between 0.6 and 1.4 kb of DNA encompassing the start and promoter regions was amplified using Pwo polymerase. The purified DNA fragments were digested with BamHI and EcoRI and cloned into plasmid pAZ106 digested with the same enzymes. The perR gene, amplified using primers OL82 and OL83, was cloned into the E. coli-S. aureus shuttle vector pCU1 (7), producing plasmid pMAL34. All of the above suicide plasmids were integrated into the chromosome of electrocompetent S. aureus RN4220 (58) through homology with the parental copies by a Campbell-type event. These were then transduced into 8325-4 using phage
11
(50), and individual clones were verified by Southern
blotting or genomic DNA sequencing to confirm the structural integrity
of the DNA at the integration site.
Random Tn917 insertions into the chromosome of S. aureus 8325-4 were created as described in the work of Watson et
al. (65). Screening of transposants for a
starvation survival defect was performed on CDM agar as described in
the work of Watson et al. (65) with limiting, 0.1%
(wt/vol) concentrations of glucose. Comparative starvation survival
experiments were performed in glucose-limiting CDM with shaking (250 rpm) at 37°C.
Genomic DNA sequencing.
DNA was isolated from lysed cells of
overnight cultures of S. aureus using lysostaphin (100 µg
ml
1) and Qiagen genomic DNA columns. Three
micrograms of genomic DNA was sequenced from both ends of the
transposon insertion using 16 µl of Big-Dye (ABI) premix in a 40-µl
volume with 13 pmol of primer Tn1 or Tn2 (Table 1) in a 90-cycle PCR
sequencing program (95°C, 30 s; 50°C, 20 s; 60°C, 4 min). PCR sequencing products were purified using DyeEx columns (Qiagen).
-Galactosidase assays.
Levels of
-galactosidase
activity were measured as described previously (37).
Briefly, 0.1-ml samples were harvested, and cell pellets were stored at
20°C. Thawed pellets were resuspended in 0.5 ml of ABT buffer (60 mM K2HPO4, 40 mM
KH2PO4, 100 mM NaCl). The
assay was started with the addition of 50 µl of freshly prepared MUG
(4-methylumbelliferyl-
-D-galactoside) (10 mg
ml
1), and the assay mixture was incubated at
25°C for 60 min. The assay was stopped with the addition of 0.5 ml of
0.4 M Na2CO3. The stopped
assay mixture was then serially diluted in a 50:50 (vol/vol) mixture of
ABT and Na2CO3 in 96-well
microtiter plates (Nunc). Fluorescence was measured using a Victor
plate reader (Wallac) with a 0.1-s count time and calibrated with
standard concentrations of MU (4-methylumbelliferone). One unit of
-galactosidase activity was defined as the amount of enzyme that
catalyzed the production of 1 pmol of MU min
1
OD600 U
1. Assays were
performed on duplicate samples, and the values were averaged. The
results presented here were representative of three independent
experiments that showed less than 20% variability.
Catalase assay activity gels, H2O2
challenge, and induction.
Catalase activity was detected after
electrophoresis on a 10% (wt/vol) native polyacrylamide gel, pH 7.5 (45), of washed cells lysed with lysostaphin (100 µg
ml
1). The double-staining method of Wayne and
Diaz (66) was used to visualize bands of activity.
Catalase activity was assayed spectrophotometrically at 240 nm as
described by Beers and Sizer (9) using 50 mM potassium
phosphate buffer (pH 7.0) with 19.6 mM hydrogen peroxide. Protein
concentration was measured by the method of Bradford (12)
using bovine serum albumin (fraction V; Sigma) as the standard.
Hydrogen peroxide resistance was assayed as described in the work of
Watson et al. (64) with the following modifications. Cells
grown to exponential phase in CLR were washed and diluted in
phosphate-buffered saline (PBS) to an OD600 of 0.2 and, following challenge with 7.5 mM
H2O2, were diluted in PBS
containing 10 mg of catalase ml
1 and then
serially diluted in PBS. Viability was assessed by overnight growth on
BHI agar. Hydrogen peroxide induction of gene expression using
lacZ fusions was performed on cultures grown in CLR or
Chelex-treated BHI medium to OD600s of 0.2, 2, and 8 by adding H2O2 to a
final concentration of 100 or 500 µM with shaking (250 rpm) at
37°C. Samples were removed for assay before and 60 min after the
addition of H2O2 and
assayed for
-galactosidase.
Cellular protein preparation. The soluble cellular protein fraction was prepared by pelleting cells and resuspending them in 5 µl per 0.1 OD600 U of 1 M Tris-HCl, pH 6.8, containing 20 µg of lysostaphin (Sigma). After 10 min of incubation at 37°C, an equal volume of Laemmli sample buffer was added before boiling for 10 min. The samples were centrifuged for 5 min before loading on a 10% (wt/vol) polyacrylamide gel. Samples were blotted and N-terminally sequenced as described previously (16).
RNA isolation and transcriptional start site mapping.
Total
RNA was isolated from exponential cultures of S. aureus
(OD600 = 1.0) using the rapid liquid nitrogen
chill method of Arnau et al. (6). Frozen cell pellets,
briefly stored at
70°C, were thawed, and RNA was rapidly extracted
by cell disruption using the Fast-Prep blue kit (Bio 101) and a
Fast-Prep system reciprocal shaker (Bio 101). Primer extension
reactions were performed for perR, katA, mrgA,
ahpC, and fur as described in the work of Horsburgh and
Moir (36) using 100 µg of RNA and 10 pmol of the corresponding primer (PEX2, PEX3, PEX4, PEX5, and PEX6, respectively). The PCR products used for cloning into pAZ106 were purified using a
Qiagen PCR kit and then sequenced with a Sequenase 2.0 PCR kit (Amersham) using the same oligonucleotide used for the primer extension reaction.
Virulence testing of strains in a murine skin abscess model.
Virulence of S. aureus strains was tested in an established
murine abscess model of infection (16). Briefly, cells
were grown to stationary phase in BHI (time, 15 h), then harvested by centrifugation, and washed twice in PBS. The cell numbers were adjusted to 5 × 108 CFU
ml
1, and then 200 µl of cell suspension was
injected subcutaneously in female 6- to 8-week-old BALB/c mice. The
precise inoculum was confirmed by serial dilution and counting on BHI
agar. After 7 days, the mice were euthanatized with
CO2, and skin lesions were aseptically removed
and stored frozen in liquid nitrogen. The lesions were weighed,
chopped, and homogenized in a miniblender in 2.5 ml of ice-cold PBS.
After 1 h of incubation on ice, the lesions were homogenized again
before serial dilution of the suspension, and the total number of
bacteria was determined by growth on BHI agar. Statistical significance
was evaluated on the percent recovery of strains using Student's
t test with a 5% confidence limit.
| |
RESULTS |
|---|
|
|
|---|
Identification of perR and katA in S. aureus The strain ST16 was isolated during a screen for S. aureus Tn917 transposants unable to survive glucose starvation after prolonged incubation on CDM agar plates. Genomic DNA sequencing in both directions from the transposon insertion of ST16 revealed inactivation of the katA gene encoding catalase. The 1,518-bp gene is monocistronic and encodes a protein of 505 amino acids with a molecular mass of 58.3 kDa (57). Upstream of the catalase gene is an imperfect palindrome of 18 bp, suggestive of transcriptional regulation by a member of the Fur family. A homologue of the B. subtilis perR gene, which controls peroxide stress resistance, was identified in the incomplete S. aureus 8325 genomic database (http://www.genome.ou.edu). The 441-bp perR gene is monocistronic and encodes a protein with a predicted molecular mass of 17.2 kDa. To characterize the role of PerR in S. aureus, we introduced a kanamycin resistance cassette into the perR gene using allelic replacement, thereby disrupting the chromosomal copy and creating strain MJH001.
Peroxide resistance of MJH001 (perR) and ST16
(katA).
To investigate the importance of PerR and
catalase in stress resistance of S. aureus, we examined the
effect of adding hydrogen peroxide. MJH001 (perR) and ST16
(katA) mutants contrasted strikingly with 8325-4 (wild
type). ST16 (katA) was hypersensitive to hydrogen peroxide,
while MJH001 (perR) was more resistant than 8325-4 (wild type) (Fig. 1A). The katA gene
encodes the sole catalase (Fig. 1B) of S. aureus, and the
observed sensitivity was a consequence of a complete loss of all
catalase activity as shown by enzyme assay (Fig. 1C). Database
searching also failed to reveal any further catalase homologues in
S. aureus. MJH001 (perR) was found to have
increased levels of catalase activity (Fig. 1), as was reported
elsewhere for B. subtilis (13) and C. jejuni (62) perR mutants. The addition of
20 µM manganese to the growth medium reduced the amount of catalase
present in 8325-4 (wild type) and decreased resistance to hydrogen
peroxide (Fig. 1A) but did not reduce the amount of catalase or
resistance in MJH001 (perR). Addition of 20 µM iron
produced the reverse effect, increasing catalase expression in both
8325-4 (wild type) and MJH001 (perR). This contrasts with
both B. subtilis and C. jejuni, where PerR functions as both a manganese- and an iron-responsive repressor (13, 62). The increased level of katA
expression when MJH001 (perR) was grown with 20 µM iron
sulfate added is due to a second regulator of catalase that was
identified as Fur (37).
|
The role of perR and katA in the
growth of S. aureus.
The importance of PerR and
catalase for growth in vitro and their effect on the sensitivity of the
strains to different metal ions were evaluated by growth in the
metal-depleted medium CL. MJH001 (perR) had an increased
doubling time compared to that of 8325-4 (wild type) during exponential
growth in CL medium (262 and 144 min, respectively) (Fig.
2A). This difference in growth rate was
eliminated (doubling time, 133 and 150 min, respectively) by adding
increased (20 µM) iron sulfate (Fig. 2B) to the cultures. ST16
(katA) showed a wild-type growth rate in CLR and yet had marked growth defects in CL, where all metal ions (except magnesium) were absent from the culture (Fig. 2A), and in CL with 20 µM iron sulfate (Fig. 2B). Growth in the metal-replete medium CLR produced a
wild-type growth rate for ST16 (katA) (Fig. 2C). Further
experiments showed that manganese alone was capable of restoring a
wild-type growth rate to ST16 (katA) (Fig. 2D).
Complementation of the mutation in MJH001 (perR) with the
perR gene alone restored catalase activity and
manganese-dependent repression to levels similar to those of the wild
type (8325-4). This was demonstrated by assaying strains MJH408
(perR::kan [pMAL34
(perR+)]) and MJH418 (8325-4 [pMAL34
(perR+)]) during growth in CLR or CLR
containing 20 µM manganese chloride (data not shown).
|
Identification of PerR-regulated genes in S.
aureus.
Putative PerR binding sites were identified in the
S. aureus incomplete genomic databases based on homology
with the putative site upstream of katA (Fig.
3). A number of candidate sites were found upstream of the coding sequences of genes whose protein products
were likely to have a role in oxidative stress or metal ion storage
(Fig. 3). The fur, ftn, perR,
trxB, and bcp genes have not been identified as
members of a PerR regulon previously. To determine whether these
candidate PerR binding sites were located in the promoter region of the
genes, we determined the transcriptional start point for the
perR, fur, ahpC, katA, and
mrgA genes (Fig. 4). In each
case, the PerR binding site was located in the promoter region close to
the
35 and
10 elements. The PerR box in the mrgA gene
was situated between the
35 and
10 elements in a position consistent with the high level of manganese-dependent transcriptional repression observed in 8325-4 (wild type) compared to that in MJH001
(perR) (Fig. 5).
|
|
|
The effect of PerR on transcription of candidate genes. To determine whether PerR regulated the expression of the identified genes, lacZ fusions were made to each of the eight genes listed in Fig. 3 to monitor transcription from their promoters. All of the identified genes displayed PerR-dependent regulation (Fig. 5) as evinced by significantly increased transcriptional activity from the promoters in MJH001 (perR) compared to that for 8325-4 (wild type). Furthermore, elevated levels of manganese repressed transcription of the genes, with the exception of trxB, in 8325-4 (wild type) (Fig. 5), but not in MJH001 (perR) (data not shown). This is consistent with the known manganese-responsive transcriptional repression activity previously reported for PerR from B. subtilis (18). The addition of calcium, copper, cobalt, nickel, molybdenum, or zinc to CLR had no significant effect on transcription of katA or mrgA (data not shown). Transcription of all of the PerR-regulated genes was found to be consistently greater in CLR with 20 µM iron sulfate added than in CLR medium alone (Fig. 5). Titration of the iron-dependent induction showed concentrations above 2 µM to be effective (data not shown). In the case of katA and ftn, iron-dependent induction was found to be as great as the level of transcription resulting from perR inactivation (Fig. 5). Transcription of katA is positively regulated, either directly or indirectly, by Fur in an iron-dependent manner (37).
SOD activity in S. aureus was not affected by perR inactivation (data not shown). Interestingly, when catalase levels were assayed in a sodA mutant (SPW1) of S. aureus, we found a higher specific activity (698 U mg
1) than that for 8325-4 (wild type) (379 U
mg
1). Since this suggested that increased
superoxide stress in the cell ultimately leads to activation of the
PerR regulon, we tested the effect of paraquat on induction of
mrgA. The addition of 10 µM paraquat to an early- or
mid-log culture of MJH007 (mrgA-lacZ mrgA+) produced a threefold increase in
-galactosidase activity when assayed 60 min after paraquat addition
(data not shown).
Induction of PerR-regulated genes with hydrogen peroxide. PerR was originally described as a peroxide-responsive repressor and was shown to derepress transcription of the katA, ahpC, hemA, and mrgA genes of B. subtilis after the addition of 100 µM hydrogen peroxide (19). Peroxide induction of the S. aureus PerR regulon lacZ reporter fusions was tested in 8325-4 (wild type) by adding 100 or 500 µM hydrogen peroxide to early- and mid-exponential and early-stationary-phase cultures grown in CLR medium or Chelex-treated BHI. A 100 µM concentration of hydrogen peroxide was found to produce little induction compared to a 500 µM concentration, possibly due to the very high levels of catalase activity present in S. aureus. Using a concentration of 500 µM hydrogen, increased transcription was observed in early- and mid-log-phase cultures grown in CLR for ahpC (threefold), bcp (twofold), ftn (threefold), katA (twofold), mrgA (sixfold), and trxB (twofold) but not for fur or perR (data not shown). Induction was not observed in early-stationary-phase growth.
The effect of PerR and KatA on cellular protein profiles.
The
soluble cellular protein fraction of the strains revealed that MJH001
(perR) overexpressed a number of proteins compared to 8325-4 (wild type) (Fig. 6). The addition of
manganese repressed these proteins in 8325-4 (wild type), while iron
induced their expression; neither metal affected expression of these
proteins in MJH001 (perR) (data not shown). To confirm that
the major proteins were members of the PerR regulon, they were
N-terminally sequenced. The N-terminal sequence of the 17-kDa
(SNQQDVVKEXNQQXANXTVA), 20-kDa (LSKNXLEAL),
and 23-kDa (SLINKEILPF) proteins matched the predicted
translation of the mrgA, ftn, and ahpC
genes of S. aureus, respectively. AhpC was one of four major
proteins from S. aureus induced by osmotic upshock after
growth in 2.5 M NaCl (5). Apart from AhpC, the other
proteins induced during osmotic upshock do not match the sizes of those
overexpressed in MJH001 (perR), suggesting that this osmotic
induction was not PerR mediated. ST16 (katA) was found to
overexpress the same proteins as MJH001 (perR), albeit at a
lower level (data not shown). Bsat et al. (14) and
Antelmann et al. (3) have shown that inactivation of
katA and ahpC in B. subtilis results
in derepression of the PerR regulon. From this, it was inferred that
PerR senses the accumulation of both hydrogen peroxide and organic
hydroperoxide.
|
The role of PerR and catalase in starvation survival.
ST16
(katA) was identified in a carbon starvation screen due to
its inability to survive extended incubation on glucose-limiting CDM.
Catalase is induced postexponentially, and starved S. aureus cells were shown previously to be highly resistant to elevated hydrogen
peroxide (64). The reduced viability of ST16
(katA) was demonstrated by prolonged aerobic incubation at
37°C (Fig. 7). In contrast, MJH001
(perR) retained a wild-type level of viability in this
assay.
|
The importance of PerR and catalase in vivo.
Catalase was
previously proposed to be an important virulence determinant in
S. aureus (40, 46) since catalase and SOD levels correlated with virulence in clinical isolates. The availability of single defined mutations in sodA (21) and
now katA has enabled us to test this fully. While
sodA encodes one of two SODs, making the importance of SOD
activity in virulence harder to test, katA encodes the sole
catalase of S. aureus. Together with MJH001
(perR) and 8325-4 (wild type), we tested the pathogenicity
of ST16 (katA) in a murine subcutaneous skin abscess model
of infection (Fig. 8). ST16
(katA) was not attenuated in this model (P = 0.124) in two independent experiments (n = 7 and
n = 9). Conversely, MJH001 (perR) was
significantly attenuated in this model of infection (P < 0.005) and produced smaller lesions (0.237 ± 0.143 g) compared to both 8325-4 (0.528 ± 0.173 g) and ST16 (0.582 ± 0.217 g).
|
| |
DISCUSSION |
|---|
|
|
|---|
S. aureus PerR controls a large regulon of oxidative stress components including catalase, alkyl hydroperoxide reductase, the thioredoxin-dependent thiol peroxidase (Bcp), and thioredoxin reductase. It also regulates the iron storage protein ferritin and the ferritin-like Dps homologue, MrgA. Furthermore, S. aureus PerR has an autoregulatory capacity and modulates expression of the iron homeostasis regulator Fur. In B. subtilis, PerR has so far been shown to have a more specific role as a controller of catalase, alkyl hydroperoxide reductase, MrgA, and heme biosynthesis enzymes.
MJH001 (perR) has a reduced growth rate in CLR medium that contains low levels of iron and manganese. Supplementing the medium with iron negated this defect, and we hypothesize that the observed high level of overexpression of ferritin and MrgA may sequester intracellular iron, effectively limiting free iron in the cell. MrgA in B. subtilis functions as a Dps-like protein. These proteins have the ability to bind DNA (17, 47) and sequester iron to protect the DNA from oxidative damage (29, 67), and B. subtilis MrgA is important for cellular defense against hydrogen peroxide (17).
The indirect control of iron homeostasis by PerR regulation of Fur and the direct control of iron storage proteins allow S. aureus to coordinate the intracellular availability of free iron with the level of antioxidant proteins present in the cell. The deleterious effect of hydroxyl radicals on growth resulting from hydrogen peroxide and Fe(II) participating in the Fenton reaction has been demonstrated clearly in S. aureus (54), and elevated iron levels have been shown to predispose S. aureus to killing by monocytes and macrophages but not polymorphonuclear granulocytes (35, 55). Regulation of fur in E. coli is mediated by a number of regulators including OxyR, the well-characterized, gram-negative bacterial functional analogue of PerR (60).
Expression of the PerR regulon is repressed by elevated manganese concentrations, and this is likely to be due to the antioxidant properties of manganese in vivo. Numerous studies have shown that several manganese complexes can catalyze the disproportionation of hydrogen peroxide (11, 59) while others can act as superoxide scavengers (27). Lactobacillus plantarum maintains high intracellular levels of manganese as a substitute for having enzymes that protect against reactive oxygen species (4). Que and Helmann (53) recently described the function of MntR of B. subtilis as a manganese homeostasis regulator controlling expression of two manganese uptake transporter systems, MntABC and MntH (Nramp); it has a similar role in S. aureus (S. J. Wharton, M. J. Horsburgh, and S. J. Foster, unpublished data). SirR from S. epidermidis is a homologue of MntR, although its role in metal ion homeostasis is not known (34). TroR was recently described as a DtxR-like manganese-dependent regulatory protein that regulates a manganese transport system in Treponema pallidum (52). A direct regulatory link between the PerR and MntR regulons has not been reported, although Kehres et al. (42) have reported that MntH in S. enterica serovar Typhimurium is induced by peroxide and has a putative OxyR binding site. We have shown that there is PerR-dependent control of Fur, the regulator of iron homeostasis in S. aureus (37). Should such a link between PerR and the MntR regulon exist, it would demonstrate a complex interdependence between antioxidant defense and the levels of iron and manganese in the cell. In S. aureus, the importance of PerR as a central regulator of antioxidant defenses and of iron storage proteins was shown by the reduced virulence of a perR mutant in a skin abscess model of infection. Measured levels of manganese in the human body vary from extremely low levels in the skin (0.05 µM) to 30-fold-higher levels in the blood (1.5 to 2.4 µM) and yet-higher levels in the central nervous system (160 to 180 µM) (41, 52). S. aureus will encounter varying concentrations of manganese depending on its location during infection, and these encompass the concentrations over which PerR is active, since titration experiments show that in vitro manganese-dependent PerR repression occurs at and above 1 to 2 µM concentrations (data not shown).
In B. subtilis, PerR was identified as a metal limitation and peroxide-sensing repressor of the genes encoding catalase, MrgA, AhpC, and heme biosynthesis enzymes (13, 17, 18, 19). The S. aureus PerR regulon was shown here to be metal regulated; however, not all of the genes were induced by hydrogen peroxide. Induction was observed only at early and mid-log phase and not the stationary phase of growth. The lack of induction of transcription for perR and fur suggests that some promoters may be noninducible with hydrogen peroxide, a feature that would indicate a complex response to peroxide stress for members of the PerR regulon. Transcription of the perR gene, for example, is autoregulated. The complex regulation of some of the PerR-dependent loci is highlighted by the effect of iron. In some cases, such as katA, the level of transcription after addition of iron was as high as that in a perR mutant background. We have previously demonstrated that katA is positively regulated by Fur in an iron-dependent manner (37).
The intracellular redox-regulating molecules thioredoxin, glutaredoxin, and protein disulfide isomerase maintain cellular redox status and catalyze the formation and reduction of disulfide bonds. PerR-dependent regulation of thioredoxin reductase (TrxB) and a thiol peroxidase (Bcp) further demonstrates the central role of S. aureus PerR in protection from reactive oxygen species. The thiol peroxidase (Bcp) recently characterized by Jeong et al. (39) was shown to reduce linoleic acid hydroperoxide and hydrogen peroxide with the use of thioredoxin as an in vivo immediate electron donor. We note that a second thiol peroxidase encoded in the S. aureus 8325 genome has a putative PerR box (AAGTATTATTTATTATTATTA) with a high level of identity to those in this study and is located in the likely promoter region of this gene. It would thus appear that S. aureus PerR, like OxyR of E. coli (2), has a regulatory role in transcription of genes for the thioredoxin pathway and thiol peroxidases. The gene encoding 3-phosphoglycerate dehydrogenase (pdh) is located in the same operon as bcp, such that it will be under PerR control. The reason for this is unclear but may be a metabolic mechanism for regenerating the reduced NAD that is consumed when a cell is subjected to oxidative stress.
The ability of S. aureus to survive intracellularly in granulocytes has been noted in several studies (25, 49, 70), and recently this was shown to contribute to infection (30). The intracellular location of the staphylococci was shown to be in macropinosome-like vacuoles similar to those seen with salmonellae in epithelial cells and macrophages. S. aureus has also been shown to escape the endosome of epithelial cells (8). It is not yet clear what role oxidative stress resistance has in these intracellular life cycles. However, the ability of PerR to sense hydrogen peroxide and to regulate antioxidant defense and iron storage may be important for coordinating a survival response. The mechanism by which PerR senses hydrogen peroxide has not been determined, although it has been proposed that metal ion oxidation may be involved (13). We are currently characterizing PerR from S. aureus to determine how oxidative stress is perceived by this protein and how this signal is transduced to DNA binding.
Catalase has long been implicated as a virulence determinant in S. aureus (40, 46). We have shown definitively that it has no role in the murine skin abscess model of infection. This, together with our previous work with SodA (21), suggests that these determinants are not important for infection, at least not in the well-characterized skin abscess model that we have studied. We note that the previous studies used undefined clinical isolates and that the levels of both catalase and SOD were reduced in their avirulent isolates. We have not observed any correlation between disruption of katA and sodA levels; in fact, disruption of sodA increased catalase levels. Staphylococcus aureus subsp. anaerobius is an organism closely related to S. aureus and is the etiological agent of lymphadenitis and abscess formation in young sheep and goats (57). The main phenotypic differences between the strains are the lack of catalase and weak aerobic growth in the former (22). Weak aerobic growth was not observed in S. aureus ST16 (katA), and we suggest that the altered characteristics of S. aureus subsp. anaerobius are not due solely to its dysfunctional catalase gene (57).
The ability to survive long-term starvation and desiccation has been implicated as an important factor in the nosocomial transmission of S. aureus and is likely to exacerbate the problem of methicillin-resistant S. aureus (23). We have previously identified a number of starvation survival components required for nutrient recycling, cellular repair, and oxidative stress resistance (65). The identification of catalase as a critical component for maintaining viability in long-term starvation reinforces the importance of protection from reactive oxygen species in this process.
This study has identified oxidative stress resistance and/or metal ion homeostasis to be important in the ability of S. aureus to cause disease. The role of the many PerR-regulated genes and the complex coregulatory processes linking stress resistance, metal ion homeostasis, and pathogenicity await investigation.
| |
ACKNOWLEDGMENTS |
|---|
We thank the BBSRC (M.J.H.) and the Royal Society (S.J.F.) for funding this research.
We thank the S. aureus Genome Sequencing Project (8325) and B. A. Roe, Y. Qian, A. Dorman, F. Z. Najar, S. Clifton, and J. Iandolo with funding from NIH and the Merck Genome Research Institute. Preliminary sequence data for S. aureus (COL) were obtained from The Institute for Genomic Research website at http://www.tigr.org, accomplished with support from NIH and the Merck Genome Research Institute. We thank Arthur Moir for N-terminal sequencing of proteins.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Molecular Biology and Biotechnology, University of Sheffield, Western Bank, Sheffield S10 2TN, England. Phone: 44 0114 222 4411. Fax: 44 0114 272 8697. E-mail: S.Foster{at}sheffield.ac.uk.
Editor: E. I. Tuomanen
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Agranoff, D. D., and S. Krishna. 1998. Metal ion homeostasis and intracellular parasitism. Mol. Microbiol. 8:403-412. |
| 2. |
Alamo, M. P.,
J. Jurado,
R. Gallardo-Madueno,
F. Monje-Casas,
A. Holmgren, and C. Pueyo.
2000.
Transcriptional regulation of glutaredoxin and thioredoxin pathways and related enzymes in response to oxidative stress.
J. Biol. Chem.
275:13398-13405 |
| 3. |
Antelmann, H.,
S. Engelmann,
R. Schmid, and M. Hecker.
1996.
General and oxidative stress responses in Bacillus subtilis: cloning, expression, and mutation of the alkyl hydroperoxide reductase operon.
J. Bacteriol.
178:6571-6578 |
| 4. |
Archibald, F. S., and I. Fridovich.
1981.
Manganese and defenses against oxygen toxicity in Lactobacillus plantarum.
J. Bacteriol.
145:442-451 |
| 5. | Armstrong-Buisseret, L., M. B. Cole, and G. S. A. B Stewart. 1995. A homologue of the Escherichia coli alkyl hydroperoxide reductase AhpC is induced by osmotic upshock in Staphylococcus aureus. Microbiology 141:1655-1661[Abstract]. |
| 6. | Arnau, J., K. I. Sorensen, K. F. Appel, F. K. Vogensen, and K. Hammer. 1996. Analysis of heat shock gene expression in Lactococcus lactis MG1363. Microbiology 142:1685-1691[Abstract]. |
| 7. | Augustin, J., R. Rosenstein, B. Wieland, U. Schneider, N. Schnell, G. Engelke, K. D. Entian, and F. F. Götz. 1992. Genetic analysis of epidermin biosynthetic genes and epidermin-negative mutants of Staphylococcus aureus. Eur. J. Biochem. 204:1149-1154[Medline]. |
| 8. |
Bayles, K.,
C. Wesson,
L. Liou,
G. Fox,
G. G. Bohach, and W. Trumble.
1998.
Intracellular Staphylococcus aureus escapes the endosome and induces apoptosis in epithelial cells.
Infect. Immun.
66:336-342 |
| 9. |
Beers, R. F., and I. W. Sizer.
1952.
A spectrophotometric method for measuring the breakdown of hydrogen peroxide by catalase.
J. Biol. Chem.
195:133-140 |
| 10. |
Beisel, W. R.
1977.
Magnitude of the host nutritional responses to infection.
Am. J. Clin. Nutr.
30:1236-1247 |
| 11. |
Berlett, B. S.,
P. B. Chock,
M. B. Yim, and E. R. Stadtman.
1990.
Manganese(II) catalyses the bicarbonate-dependent oxidation of amino acids by hydrogen peroxide and the amino acid-facilitated dismutation of hydrogen peroxide.
Proc. Natl. Acad. Sci. USA
87:389-393 |
| 12. | Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[CrossRef][Medline]. |
| 13. |
Bsat, N.,
L. Chen, and J. D. Helmann.
1996.
Mutation of the Bacillus subtilis alkyl hydroperoxide reductase (ahpCF) operon reveals compensatory interactions among hydrogen peroxide stress genes.
J. Bacteriol.
178:6579-6586 |
| 14. | Bsat, N., A. Herbig, L. Casillas-Martinez, P. Setlow, and J. D. Helmann. 1998. Bacillus subtilis contains multiple Fur homologues: identification of the iron uptake (Fur) and peroxide regulon (PerR) repressors. Mol. Microbiol. 29:189-198[CrossRef][Medline]. |
| 15. |
Chackraborty, T.,
M. Leimeister-Wachter,
E. Domann,
M. Hartl,
W. Goebel,
T. Nichterlein, and S. Noterman.
1992.
Coordinate regulation of virulence genes in Listeria monocytogenes requires the product of the prfA gene.
J. Bacteriol.
174:568-574 |
| 16. |
Chan, P. F.,
S. J. Foster,
E. Ingham, and M. O. Clements.
1998.
The Staphylococcus aureus alternative sigma factor B controls the environmental stress response but not starvation survival or pathogenicity in a mouse abscess model.
J. Bacteriol.
180:6082-6089 |
| 17. | Chen, L., and J. D. Helmann. 1995. Bacillus subtilis MrgA is a Dps(PexB) homologue: evidence for metalloregulation of an oxidative-stress gene. Mol. Microbiol. 18:295-300[CrossRef][Medline]. |
| 18. |
Chen, L.,
L. P. James, and J. D. Helmann.
1993.
Metalloregulation in Bacillus subtilis: isolation and characterization of two genes differentially repressed by metal ions.
J. Bacteriol.
175:5428-5437 |
| 19. |
Chen, L.,
L. Keramati, and J. D. Helmann.
1995.
Coordinate regulation of Bacillus subtilis peroxide stress genes by hydrogen peroxide and metal ions.
Proc. Natl. Acad. Sci. USA
92:8190-8194 |
| 20. |
Cheung, A.,
J. M. Koomey,
C. Butler,
S. Projan, and V. Fischetti.
1992.
Regulation of exoprotein expression in Staphylococcus aureus by a locus (sar) distinct from agr.
Proc. Natl. Acad. Sci. USA
89:6462-6466 |
| 21. |
Clements, M. O.,
S. P. Watson, and S. J. Foster.
1999.
Characterization of the major superoxide dismutase of Staphylococcus aureus and its role in starvation survival, stress resistance, and pathogenicity.
J. Bacteriol.
181:3898-3903 |
| 22. | De la Fuente, R., J. A. Ruiz-Santa-Quiteria, D. Cid, M. Domingo, and G. Suarez. 1993. Experimental intramammary infection of ewes with Staphylococcus aureus subsp. anaerobius. Res. Vet. Sci. 54:221-226[Medline]. |
| 23. | Duckworth, G. J., and J. Z. Jordens. 1990. Adherence and survival properties of an epidemic methicillin-resistant strain of Staphylococcus aureus compared with those of methicillin sensitive strains. J. Med. Microbiol. 32:195-200[Abstract]. |
| 24. | Easmon, C. S. F., and C. Adlam. 1983. Staphylococci and staphylococcal infections. Academic Press, New York, N.Y. |
| 25. |
Elliot, G. R.,
P. K. Peterson,
H. A. Verbrugh,
M. R. Freiberg,
J. R. Hoidal, and P. G. Quie.
1982.
Influence of subinhibitory concentrations of penicillin, cephalothin, and clindamycin on Staphylococcus aureus growth in human phagocytic cells.
Antimicrob. Agents Chemother.
22:781-784 |
| 26. |
Escolar, L.,
J. Perez-Martin, and V. De Lorenzo.
1999.
Opening the iron box: transcriptional metalloregulation by the Fur protein.
J. Bacteriol.
181:6223-6229 |
| 27. |
Faulkner, K. M.,
S. I. Liochev, and I. Fridovich.
1994.
Stable Mn(III) porphyrins mimic superoxide dismutase in vitro and substitute for it in vivo.
J. Biol. Chem.
269:23471-23476 |
| 28. |
Gaballa, A., and J. D. Helmann.
1998.
Identification of a zinc-specific metalloregulatory protein, Zur, controlling zinc transport operons in Bacillus subtilis.
J. Bacteriol.
180:5815-5821 |
| 29. | Grant, R. A., D. J. Filman, S. E. Finkel, R. Kolter, and J. M. Hogle. 1998. The crystal structure of Dps, a ferritin homolog that binds and protects DNA. Nat. Struct. Biol. 5:294-303[CrossRef][Medline]. |
| 30. |
Gresham, H. D.,
J. H. Lowrance,
T. E. Caver,
B. S. Wilson,
A. L. Cheung, and F. P. Lindberg.
2000.
Survival of Staphylococcus aureus inside neutrophils contributes to infection.
J. Immunol.
164:3713-3722 |
| 31. | Guerinot, M. L. 1994. Microbial iron transport. Annu. Rev. Microbiol. 48:743-772[CrossRef][Medline]. |
| 32. | Guerot-Fleury, A.-M., N. Shazand, N. Frandsen, and P. Stragier. 1995. Antibiotic resistance cassettes for Bacillus subtilis. Gene 167:335-336[CrossRef][Medline]. |
| 33. | Higuchi, R. 1989. Using PCR to engineer DNA, p. 61-70. In H. A. Erlich (ed.), PCR technology. Principles and applications for DNA amplification Macmillan, New York, N.Y. |
| 34. |
Hill, P. J.,
A. Cockayne,
P. Landers,
J. A. Morrissey,
C. A. Sims, and P. Williams.
1998.
SirR, a novel iron-dependent repressor in Staphylococcus epidermidis.
Infect. Immun.
66:4123-4129 |
| 35. |
Hoepelman, I. M.,
W. A. Bezemer,
C. M. Vandenbroucke-Grauls,
J. J. Marx, and J. Verhoef.
1990.
Bacterial iron enhances oxygen radical-mediated killing of Staphylococcus aureus by phagocytes.
Infect. Immun.
58:26-31 |
| 36. |
Horsburgh, M. J., and A. Moir.
1999.
M, an ECF RNA polymerase sigma factor of Bacillus subtilis 168, is essential for growth and survival in high concentrations of salt.
Mol. Microbiol.
32:41-50[CrossRef][Medline].
|
| 37. |
Horsburgh, M. J.,
E. Ingham, and S. J. Foster.
2001.
In Staphylococcus aureus, Fur is an interactive regulator with PerR, contributes to virulence, and is necessary for oxidative stress resistance through positive regulation of catalase and iron homeostasis.
J. Bacteriol.
183:468-475 |
| 38. | Hudson, M., W. Ramp, N. Nicholson, A. Williams, and M. Nousiainen. 1995. Internalization of Staphylococcus aureus by cultured osteoblasts. Microb. Pathog. 19:409-419[CrossRef][Medline]. |
| 39. |
Jeong, W.,
M. Cha, and I. Kim.
2000.
Thioredoxin-dependent hydroperoxide peroxidase activity of bacterioferritin comigratory protein (BCP) as a new member of the thiol-specific antioxidant protein (TSA)/alkyl hydroperoxide peroxidase C (AhpC) family.
J. Biol. Chem.
275:2924-2930 |
| 40. |
Kanafi, H., and S. E. Martin.
1985.
Catalase and superoxide dismutase activities in virulent and nonvirulent Staphylococcus aureus isolates.
J. Clin. Microbiol.
21:607-610 |
| 41. | Keen, C. L., B. Lonnerdal, and L. S. Hurley. 1984. Manganese, p. 89-132. In I. Frieden (ed.), Biochemistry of the essential ultratrace elements. Plenum Press, New York, N.Y. |
| 42. | Kehres, D. G., M. L. Zaharik, B. B. Finlay, and M. E. Maguire. 2000. The NRAMP proteins of Salmonella typhimurium and Escherichia coli are selective manganese transporters involved in the response to reactive oxygen. Mol. Microbiol. 36:1085-1100[CrossRef][Medline]. |
| 43. |
King, K. Y.,
J. A. Horenstein, and M. G. Caparon.
2000.
Aerotolerance and peroxide resistance in peroxidase and PerR mutants of Streptococcus pyogenes.
J. Bacteriol.
182:5290-5299 |
| 44. | Kornblum, J., B. N. Kreisworth, S. J. Projan, H. Ross, and R. P. Novick. 1990. agr: a polycistronic locus regulating exoprotein synthesis in Staphylococcus aureus, p. 373-402. In R. P. Novick (ed.), Molecular biology of the staphylococci. VCH Publishers, New York, N.Y. |
| 45. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[CrossRef][Medline]. |
| 46. | Mandell, G. L. 1975. Catalase, superoxide dismutase and virulence of Staphylococcus aureus. J. Clin. Investig. 55:561-566. |
| 47. |
Martinez, A., and R. Kolter.
1997.
Protection of DNA during oxidative stress by the nonspecific DNA-binding protein Dps.
J. Bacteriol.
179:5188-5194 |
| 48. | Nelson, N. 1999. Metal ion transporters and homeostasis. EMBO J. 18:4361-4371[CrossRef][Medline]. |
| 49. | Nielsen, S. L., F. T. Black, M. Storgaard, and N. Obel. 1995. Evaluation of a method for measurement of intracellular killing of Staphylococcus aureus in human neutrophil granulocytes. APMIS 103:460-468[Medline]. |
| 50. | Novick, R. P. 1991. Genetic systems in staphylococci. Methods Enzymol. 204:587-636[Medline]. |
| 51. |
O'Halloran, T. V.
1993.
Transition metals in control of gene expression.
Science
261:715-725 |
| 52. |
Posey, J. E.,
J. M. Hardham,
S. J. Norris, and F. C. Gherardini.
1999.
Characterization of a manganese-dependent regulatory protein, TroR, from Treponema pallidum.
Proc. Natl. Acad. Sci. USA
96:10887-10892 |
| 53. | Que, Q., and J. D. Helmann. 2000. Manganese homeostasis in Bacillus subtilis is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Mol. Microbiol. 35:1454-1468[CrossRef][Medline]. |
| 54. |
Repine, J. E.,
R. B. Fox, and E. M. Berger.
1981.
Hydrogen peroxide kills Staphylococcus aureus by reacting with staphylococcal iron to form hydroxyl radical.
J. Biol. Chem.
256:7094-7096 |
| 55. |
Repine, J. E.,
R. B. Fox,
E. M. Berger, and R. N. Harada.
1981.
Effect of staphylococcal iron content on the killing of Staphylococcus aureus by polymorphonuclear leukocytes.
Infect. Immun.
32:407-410 |
| 56. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 57. |
Sanz, R.,
I. Marin,
J. A. Ruiz-Santa-Quiteria,
J. A. Orden,
D. Cid,
R. M. Diez,
K. S. Silhadi,
R. Amils, and R. De La Fuente.
2000.
Catalase deficiency in Staphylococcus aureus subsp. anaerobius is associated with natural loss-of-function mutations within the structural gene.
Microbiology
146:465-475 |
| 58. | Schenk, S., and R. A. Ladagga. 1992. Improved methods for electroporation of Staphylococcus aureus. FEMS Microbiol. Lett. 94:133-138[CrossRef]. |
| 59. |
Stadtman, E. R.,
B. S. Berlett, and P. B. Chock.
1990.
Manganese-dependent disproportionation of hydrogen peroxide in bicarbonate buffer.
Proc. Natl. Acad. Sci. USA
87:384-388 |
| 60. | Storz, G., and J. A. Imlay. 1999. Oxidative stress. Curr. Opin. Microbiol. 2:188-194[CrossRef][Medline]. |
| 61. | Tao, X., N. Schiering, H. Y. Zeng, D. Ringe, and J. R. Murphy. 1994. Iron, DtxR, and regulation of diphtheria toxin expression. Mol. Microbiol. 14:191-197[Medline]. |
| 62. |
Van Vliet, A. H. M.,
M.-L. A. Baillon,
C. W. Penn, and J. Ketley.
1999.
Campylobacter jejuni contains two Fur homologs: characterization of iron-responsive regulation of peroxide stress genes by the PerR repressor.
J. Bacteriol.
181:6371-6376 |
| 63. | Vesga, O., M. Groeschel, M. Otten, D. Brar, J. Vann, and R. Proctor. 1996. Staphylococcus aureus small colony variants are induced by the endothelial intracellular milieu. J. Infect. Dis. 173:739-745[Medline]. |
| 64. |
Watson, S. P.,
M. O. Clements, and S. J. Foster.
1998.
Characterization of the starvation survival response of Staphylococcus aureus.
J. Bacteriol.
180:1750-1758 |
| 65. | Watson, S. P., M. A. Antonio, and S. J. Foster. 1998. Isolation and characterisation of Staphylococcus aureus starvation-induced, stationary phase mutants defective in survival or recovery. Microbiology 144:3159-3169[Abstract]. |
| 66. | Wayne, L. G., and G. A. Diaz. 1986. A double staining method for differentiating between two classes of mycobacterial catalase in polyacrylamide electrophoresis gels. Anal. Biochem. 157:89-92[CrossRef][Medline]. |
| 67. | Wolf, S. G., D. Frenkiel, T. Arad, S. E. Finkel, R. Kolter, and A. Minsky. 1999. DNA protection by stress-induced biocrystallization. Nature 400:83-85[CrossRef][Medline]. |
| 68. |
Xiong, A.,
V. K. Singh,
G. Cabrera, and R. K. Jayaswal.
2000.
Molecular characterisation of the ferric uptake regulator, Fur, from Staphylococcus aureus.
Microbiology
146:659-668 |
| 69. |
Zheng, M.,
F. Aslund, and G. Storz.
1998.
Activation of the OxyR transcription factor by reversible disulfide bond formation.
Science
279:1718-1721 |
| 70. | Zimmerli, W., P. D. Lew, S. Suter, M. Wyss, and F. A. Waldvogel. 1983. In v |