Previous Article | Next Article 
Infection and Immunity, June 2001, p. 3916-3923, Vol. 69, No. 6
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.6.3916-3923.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
LYT1 Protein Is Required for Efficient In Vitro
Infection by Trypanosoma cruzi
Rebeca
Manning-Cela,1,2
Arantxa
Cortés,3
Elena
González-Rey,3
Wesley C.
Van Voorhis,4
John
Swindle,1,5,* and
Antonio
González3
Seattle Biomedical Research
Institute,1 Departments of Pathobiology
and Medicine, University of Washington,4 and
Infection Disease Research Institute,5
Seattle, Washington; Departamento de Biomedicina Molecular,
Centro de Investigación y de Estudios Avanzados del IPN, Mexico
City, D.F., Mexico2; and Instituto de
Parasitología y Biomedicina, CSIC, Granada,
Spain3
Received 11 January 2001/Returned for modification 28 February
2001/Accepted 22 March 2001
 |
ABSTRACT |
Trypanosoma cruzi invasion of host cells involves
several discrete steps: attachment, parasite internalization mediated
by recruitment and fusion of host cell lysosomes, and escape from the
parasitophorous vacuole to liberate amastigotes to multiply freely in
the cytosol. This report describes the initial characterization of the
LYT1 gene and the demonstration that the gene product is involved in cell lysis and infectivity. Mutational analysis
demonstrated that deletion of LYT1 resulted in attenuation
of infection, which was associated with diminished hemolytic activity.
Reintroduction of LYT1 restored infectivity in null
mutants, confirming the critical role of LYT1 in infection.
Additionally, in vitro stage transition experiments with
LYT1-deficient lines showed that these parasites converted
to extracellular amastigote-like cells and metacyclic trypomastigotes
more rapidly than wild-type parasites, suggesting that the diminished
infectivity was not a result of the LYT1 deficiency that affected the
parasite's ability to complete the life cycle.
 |
INTRODUCTION |
Parasitic protozoa of the family
Trypanosomatidae cause disease on a worldwide scale in a
variety of vertebrate, invertebrate, and plant species. Included in
this family is Trypanosoma cruzi, the etiologic agent of
Chagas' disease, which is endemic throughout much of South and Central
America, affecting over 20 million people. T. cruzi
undergoes a biphasic life cycle, comprised of several distinct
developmental stages in both the reduviid beetle vector and the
mammalian host. In the beetle, the flagellated epimastigote proliferates in the midgut before differentiating into the nondividing but infectious metacyclic trypomastigote found in the vector's hindgut. Following its introduction into the mammalian blood, the
parasite infects host cells, differentiates into an amastigote, and
initiates replication in the cytosol of the infected cell. Ultimately,
the amastigotes develop into nondividing bloodstream trypomastigotes,
which can either initiate another round of infection or be taken up by
the reduviid vector during a blood meal. The life cycle is completed
upon development of the epimastigote from the bloodstream trypomastigote.
T. cruzi invasion of host cells is a complex event, which
has only recently begun to be unraveled (7). This process
appears to involve several discrete steps, beginning with the
attachment of the parasite to the host cell. Immediately after
attachment but probably prior to parasite internalization, host cell
lysosomes are recruited to the site of attachment, where they
transiently fuse with the plasma membrane (18). Then, in a
rapid series of events, the parasite is internalized concomitant with
stable fusion of the recruited lysosomes to the plasma membrane,
resulting in the formation of the parasitophorous vacuole (3,
4). Ultimately, the amastigotes escape from the
parasitophorous vacuole and, thus liberated, they multiply freely
in the cytosol. Although the host cell machinery involved in
internalization is reasonably well understood, little is known of the
parasite molecules involved in the process.
Though many parasite proteins are undoubtedly important for T. cruzi infection and successful completion of the life cycle, surprisingly few have been identified experimentally. One parasite factor likely to be involved is TC-TOX, a secreted acid-stable hemolytic protein (2). This protein has membrane
pore-forming activity at low pH levels and cross-reacts with monoclonal
antibodies directed against C9, and it has been postulated that it
mediates the escape of T. cruzi from the parasitophorous
vacuole into the cytosol (1, 5). Another protein shown to
be involved in infection was a trypomastigote-secreted peptidyl-prolyl
cis or trans isomerase (17), but its
specific target on the host cell remains to be elucidated. A third
T. cruzi protein, which has been shown to play an important
role in host cell invasion, is oligopeptidase B. Using a targeted gene
replacement approach it was demonstrated that this enzyme mediated
production of a signaling agonist for mammalian cells that is required
for efficient invasion and infectivity (8).
The present study describes the cloning of LYT1, which was
isolated from a T. cruzi cDNA library based on the
cross-reactivity of its gene product to antibodies against the C9
component of the membrane attack complex of complement. Searches of all
available DNA and protein databases failed to identify significant
homology of proteins or potential translation products to the LYT1
protein. In order to gain insight in the possible role of the gene
product, LYT1 deletion mutants were generated by targeted
gene replacements. Using these genetic methodologies we have shown that
LYT1 is not required for viability of epimastigotes; however,
LYT1-deficient parasites exhibit three distinct phenotypes.
These parasites exhibit accelerated in vitro development, demonstrate
reduced infectivity, and have diminished hemolytic activity.
Reintroduction of LYT1 reconstituted infectivity for the
null parasites, demonstrating that the LYT1 gene plays an
important role in infection.
 |
MATERIALS AND METHODS |
Cells and parasites.
NIH 3T3 and NRK fibroblasts were
maintained in Dulbecco's minimal essential medium (DMEM) supplemented
with 10% fetal bovine serum (FBS), 1% glutamine, and 5 µg of
penicillin-streptomycin (pen-strep) per ml at 37°C in a humidified
atmosphere containing 5% CO2. Epimastigotes from the
T. cruzi Cl-Brener and Y strains were maintained in liver
infusion tryptose medium containing 10% FBS (LIT) at 28°C
(13). Mid-log-phase cultures containing from 5 × 106 to 2 × 107 parasites
ml
1 were used in all experiments. Transformed clones were
isolated from the G418- and hygromicin B-resistant T. cruzi
population by limiting dilution in the absence of selection, as
described by Hariharan et al. (13). Trypomastigotes were
obtained from supernatant of infected monolayers of NIH 3T3
fibroblasts. Amastigotes were obtained from the supernatant of infected
monolayers of NIH 3T3 fibroblasts or from in vitro stage transition
experiments. The amastigotes were separated from trypomastigotes or
epimastigotes using the amastigote-specific antibody 2C2B6, specific
for the Ssp-4 surface antigen of amastigotes (6).
Isolation and sequence of LYT1 cDNA and genomic
clones.
A T. cruzi Y strain amastigote cDNA expression
library constructed in
gt11 (12) was screened with
antibodies against human complement component C9. Using the 0.8-kb
insert from a positive clone (
gt11-LYT1-0.8) as a probe,
a
EMBL-3 genomic library (11) was screened. A positive
clone (
EMBL-3LYT1-20) with a 20-kb insert was digested
with different restriction enzymes and probed by Southern blotting to
obtain a 5.8-kb AatII fragment containing the
LYT1 gene and flanking sequences. Following gel purification, the 5.8-kb fragment was ligated into the AatII
site of pGEM5Zf(+). The pGEM5Zf(+)LYT1-5.8 clone insert was
sequenced by the dideoxy chain termination method (19).
After gel purification, a 2,888-bp BsiWI fragment from
pGEM5zfLYT1a-5.8 was treated with T4 DNA polymerase to
generate flush ends and then ligated into the HincII site of
pBS. The resultant plasmid, pBSLYT1a-BsiWI, contains the
complete LYT1a coding sequence and 644 and 591 bp of the 5'
and 3' flanking sequences, respectively. Using a 587-bp PCR fragment
(1,496 to 2,083 bp from pGEM5Zf(+)LYT1-5.8) as the probe, a
4.3-kb BsiWI genomic clone containing the LYT1a
allele from the Cl-Brener strain was isolated and partially sequenced (19). The LYT1b allele was cloned by PCR using
genomic DNA from the C1-Brener strain and the primers TcL1
(5'-CGAGCCCGAACGATGAACAT) and TcL4
(5'-TTTGCGAGCCTCTGCATTTT) and sequenced.
Expression of LYT1 in yeast.
The full coding sequence of
LYT1 plus 597 bp of downstream sequence was amplified by PCR
using the primers ARTX-8 (5'-CGGGATCCATGCGGAAGA) and ARTX-1
(5'-TGAAAGAGAAGAAAGTC) and pGEM5Zf(+)LYT1-5.8 as
the template. After BamHI digestion (BamHI sites
are located 9 bp upstream of the initiator codon and 199 bp upstream of
ARTX-1), the fragment was ligated to dephosphorylated
BamHI-digested pREP3X. After transformation of
Escherichia coli XL1-blue, the plasmid was purified and used
to transform Schizosaccharomyces pombe by electroporation.
Transformants were grown in Edimburgh minimal medium with thiamine (5 µg/ml) to repress expression of LYT1. Expression was
achieved by growth of the transformed yeast in the absence of thiamine,
and the presence of LYT1 was tested in whole extracts by Western
blotting. Extracts for measurements of hemolytic activity were obtained
by grinding 2 × 109 yeast cells in a mortar with a
quantity of sea sand that was double the weight. The ground material
was resuspended in 4 ml of acid buffer plus protease inhibitors (ABPI)
(50 mM NaCl, 100 mM sodium acetate [pH 5.5], 0.1%
D-glucose, 50 mM EDTA, 1 mM phenylmethylsulfonyl fluoride 1 µg of leupeptin per ml, 1 µg of pepstatin per ml) and clarified by centrifugation.
Western blots.
Samples were electrophoresed under reducing
conditions in 7.5% polyacrylamide gels (15) and
transferred for 2 h at 80 V to polyvinylidine difluoride membrane
(Immobilon-P; Millipore). Membranes were blocked overnight with 5%
nonfat milk in a solution containing 10 mM Tris-HCl [pH 8], 150 mM
NaCl, and 0.05% Tween 20 (TBST) plus 0.02% NaN3 and
incubated for 1 h at room temperature with 1:200 dilutions of
rabbit anti-C9 serum or rabbit serum against truncated LYT1
(approximately 250 amino-terminal amino acids) expressed in E. coli and purified by affinity chromatography (E. González-Rey and A. González, unpublished results). The
membranes were exhaustively washed with TBST and then incubated with
1:1,000 alkaline phosphatase-conjugated goat anti-rabbit immunoglobulin for 1 h at room temperature. The membranes were washed and
developed with 5-bromo-4-chloro-3-indolyl phosphate-nitroblue
tetrazolium (Sigma).
Construction of pGEM5Zf(+)hyg::LYT1 and
pGEM5Zf(+)neo::LYT1.
A 7,253-bp fragment
containing the 5' and 3' LYT1 flanking sequences and the
complete pGEM5Zf(+) sequence was generated by PCR amplification using
pGEM5Zf(+)LYT1-5.8 as the template and the primers ARTX-9
(5'-TCTAGAGCGAGCACG [reverse primer, nucleotides
1 to
13 upstream from the first LYT1 ATG and terminal
XbaI site]) and ARTX-10 (5'-CCCGGGCAGCTAGA
[nucleotides 85 to 95 downstream of the LYT1 stop
codon, followed by 2 additional nucleotides as part of a terminal
SmaI site]). The PCR conditions used were as follows: 1.5 min of denaturation at 94°C, 3 min of annealing at 50°C, and 7 min
of polymerization at 72°C (20 cycles). The PCR product was treated
with T4 DNA polymerase to generate flush ends and then religated. The
resultant plasmid was digested with XbaI and
SmaI, gel purified after electrophoresis, and used to ligate the hygr and neor coding
sequences, which have been generated by digestion of
pBSSK-hyg1f8 and pBSSK-neo1f8 (21)
with XbaI/StuI and
XbaI/SmaI, respectively. The resulting plasmids
were pGEM5Zf(+)hyg::LYT1 and
pGEM5Zf(+)neo::LYT1 containing, respectively,
hygr and neor coding
sequence, as well as 714 and 2,854 bp of the 5' and 3' LYT1
flanking sequences, respectively.
Generation of LYT1 gene knockouts.
For
LYT1 sequence replacement, a 4,515-bp LYT1(Neo)
fragment was generated, as was a 4,773-bp LYT1(Hyg)
fragment, by digestion of pGEM5Zf(+)neo::LYT1 and
pGEM5Zf(+)hyg::LYT1 with BglI.
Approximately 25 µg of each fragment was purified and used to
transform the Cl-Brener epimastigotes following established procedures
(9, 10, 13, 14). Forty-eight hours after electroporation,
the cultures were exposed to antibiotic selection using G418 (250 µg/ml) and hygromycin B (250 µg/ml). Once antibiotic-resistant growth cultures were established, clonal derivatives were isolated from
each population by limiting dilution and analyzed as described below.
Southern and Northern hybridization.
The blotting,
hybridization, and washing conditions used in Southern and Northern
analysis were precisely as described previously (13). For
Northern analysis total cellular RNA was isolated by the
guanidium-cesium chloride method and size fractionated on 1.1% agarose
gels containing 2.2 M formaldehyde (16). Probes were
generated by PCR. The oligonucleotides used to amplify the LYT1 coding sequence were LYTEXP1
( 5 ' - CGCGATATC TAAGAAGGAGATATACATATGCGGAAGAAAGCCGCAGCATT [an EcoRV restriction site sequence followed by
nucleotides 1 to 23 of LYT1 coding sequence]) and LYT3'
(5'-ACGTGGATCCCAGTGGCGGAGCAGCACTATTCGC [complementary to
nucleotides 648 to 672 of the LYT1 coding sequence downstream of the BamHI site]). The oligonucleotides used
for the 5' probe were LYTEXP1 and LYT2 (5'-CGTGCGACTGAGATGTCACC
[complementary to nucleotides 239 to 259 of the LYT1
coding sequence]). The oligonucleotides used for the 3' probe were
either LYT4 (5'-GCAGGATTTGCCAGCGATGC [nucleotides 392 to
411 of the LYT1 coding sequence]) and LYT3' or LYT7
(5'-GCGACAACATACCCGACCCCGCGGA [nucleotides 1058 to 1082 of
the LYT1 coding sequence]) and LYT8
(5'-GTCATCCCTAATGCCAAAGACTTC [complementary to nucleotides
3 to 26 downstream of the LYT1 translation stop codon]).
Infectivity assay.
Monolayers of NIH 3T3 cells grown to 50%
confluency in DMEM supplemented with 2% fetal calf serum were infected
with 2 × 106 mid-log-phase epimastigotes per ml
derived from wild-type Cl-Brener as well as each of the LYT1
mutant lines cultured in LIT media plus 10% FBS at 28°C. Forty-eight
hours later the cells were washed, and they were subsequently washed
every 2 days with DMEM to remove nonadherent parasites, after which
fresh DMEM plus 2% fetal calf serum was added. For the secondary
infection experiments, wild-type and LYT1 mutant
trypomastigotes (2 × 104 trypomastigotes/ml)
resulting from the first infection were purified as described above and
used to infect NIH 3T3 cells (grown to 50% confluency) over 2 h.
NIH 3T3 cells were washed every 2 days, and fresh DMEM plus 2% fetal
calf serum was added. A host cell was considered infected if
replicating amastigotes were observed inside the cell. Infections were
monitored daily, and the number of amastigotes and trypomastigotes in
the supernatant was determined. The percentage of infected cells
determined by microscopic observation was calculated by comparing the
number of cells containing parasites to the total number of cells.
Reconstitution of LYT1 null mutants.
For
LYT1 reconstitution of null mutant parasites, a 1,656-bp
fragment was generated from the pBSLYT1a-BsiWI genomic
clone. After electrophoresis and gel purification, 100 or 200 µg of
fragment was used to transform wild-type and null mutant parasites.
Forty-eight hours after electroporation, the same numbers of wild-type
and mutant parasites as described in the infectivity assay were used to
infect NIH 3T3 cells.
In vitro stage transition.
Epimastigotes were grown in LIT
medium plus 10% FBS at 28°C until they reach mid-log phase (about
1 × 107 epimastigotes/ml). Parasites were then either
transferred to DMEM plus 2% FBS-1% glutamine-5-µg/ml
penicillin-streptomycin at 37°C or were allowed to progress to
stationary phase in the original LIT medium at 28°C. Cultures were
monitored daily, and the percentage of amastigotes in DMEM or of
metacyclic trypomastigotes in LIT medium was determined by microscopic observation.
Hemolytic assays.
For yeast extract, 0.9 ml of yeast extract
was incubated for 2 h at 37°C with 0.1 ml of ABPI containing 5 × 107 rabbit erythrocytes. After centrifugation, the
results were quantified by monitoring optical adsorbance at 545 nm. To
obtain values for 0 and 100% lysis, the same numbers of erythrocytes
were incubated in ABPI and water, respectively, over the same time
course as the experimental samples.
For measuring hemolytic activity with whole parasites, parasites and
horse erythrocytes (PML Microbiologicals, Tualatin, Oreg.) were
pelleted by centrifugation, washed, and resuspended in acid buffer (10 mM NaOAc [pH 5.4], 200 mM NaCl, 0.2% D-glucose) or neutral buffer (10 mM NaOAc [pH 7], 150 mM NaCl, 0.2%
D-glucose). Washed red blood cells (2 × 107 cells) were incubated with parasites (2 × 107 parasites) in 0.5 ml of acid or neutral buffer at
37°C and for various periods of time as indicated below.
Nucleotide sequence accession numbers.
The nucleotide
sequence accession numbers for pGEM5Zf(+)LYT1-5.8,
LYT1a, and LYT1b are AF253317, AF263616, and
AF320626, respectively (all are GenBank accession numbers).
 |
RESULTS |
Cloning, characterization, and yeast expression of
LYT1.
A LYT1 cDNA clone was isolated from a
Y strain T. cruzi amastigote expression library by virtue of
its cross-reactivity to antibodies against human complement component
C9 (Fig. 1A). The 0.8-kb insert from the
LYT1 cDNA clone (
gt11-LYT1-0.8) was
subsequently used as a probe to isolate
EMBL-3LYT1-20
from a T. cruzi Y strain genomic library. From the genomic
clone, a 5.8-kb AatII restriction fragment was subcloned
(pGEM5Zf(+)LYT1-5.8) and sequenced. Using the
pGEM5Zf(+)LYT1-5.8 sequence, a set of primers was designed to isolate and sequence both the LYT1a and LYT1b
alleles from the Cl-Brener strain. A 1,653-bp open reading frame
encoding a 552-amino-acid protein was identified, as were 5' and 3'
flanking sequences. Figure 1B shows the deduced amino acid sequence
derived from the LYT1a coding sequence of the Y strain and
from the LYT1a and LYT1b coding sequences of the
Cl-Brener strain. The derived amino acid sequence of LYT1 predicts a
61,400-dalton polypeptide with an isoelectric point of 11.04.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Isolation and sequencing of LYT1 cDNA clone. (A) Western
blot of isopropyl- -D-thiogalactopyraroside-induced
-infected E. coli lysates showing reaction with rabbit
anti-C9 antibodies. Lane 1, gt11-LYT1-0.8; lane 2, gt11. (B) Deduced amino acid sequences of LYT1a of the Y
strain and LYT1a and LYT1b of the Cl-Brener
strain. Differences in the Cl-Brener strain are shown above (for
LYT1a) or below (for LYT1b) the Y strain
sequence.
|
|
Computer analysis of LYT1 failed to show any significant homology to C9
but did predict the amino-terminal sequence as a signal
peptide for
secretion. Searches of all available DNA and protein
databases also
failed to identify significant homology to known
proteins or potential
translation products. Since the size of
the protein, the presence of a
leader peptide, and the cross-reactivity
to C9 suggest a possible
relationship to TC-TOX, we aimed at determining
the potential lytic
activity of LYT1 by expression in yeast. Figure
2A shows that transformed
S. pombe was able to express LYT1. As
shown in Fig.
2B, extracts from
LYT1-expressing yeast lyse rabbit
erythrocytes at pH 5.5 more than
twice as efficiently as nonexpressing
or nontransformed controls.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of LYT1 in yeast. (A) Western blot of
extracts of S. pombe transformed with pREP3X (lane 1) or
pREP3X-LYT1 (lane 2), grown in the absence of thiamin to
induce expression. The filter was reacted with rabbit antibodies
against recombinant LYT1 produced in E. coli. (B) Hemolytic
activity of extracts of S. pombe transformed with pREP3X and
grown in the presence of thiamin (bar 1), transformed with
pREP3X-LYT1 and grown in the presence of thiamin (bar 2 [control]), or transformed with pREP3X-LYT1 and grown in
the absence of thiamin (bar 3) was determined using rabbit
erythrocytes. The results presented have been corrected for spontaneous
lysis (13%).
|
|
Genomic Southern analysis using several restriction enzymes indicated
that
LYT1 was a single-copy gene (data not shown). The
genomic organization of the genes was confirmed by the gene knockout
experiments described below (Fig.
3).
Chromosomal blot hybridization
also showed that the allelic copies of
LYT1 gene are located in
chromosomes VI and XII, of 1.03 and
1.60 Mb, respectively (
9)
(data not shown).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
Genomic Southern blot analysis of wild-type Cl-Brener
strain (lane 1), LYT1 double knockout L16 (lane 2), and
LYT1 single knockout L14 (lane 3). The PstI (P)
restriction maps of a and b LYT1 loci are shown beneath the
gel image. Restriction fragments hybridizing with the LYT1
probe (hatched rectangles) were the expected sizes, indicating that
correct integration had occurred. The LYT1 probe failed to
hybridize with the LYT1 double knockout, demonstrating that
both alleles of the LYT1 gene were replaced.
|
|
Generation of LYT1 mutants.
As mentioned above,
LYT1 lacks homology to known proteins or hypothetical translation
products. Consequently, a genetic strategy aimed at generating single
and double knockouts of both LYT1 alleles in the Cl-Brener
strain of T. cruzi was used to gain insight into the
possible role of the gene product. Two plasmids were designed consisting of either the neomycin phosphotransferase II gene
(neor) or the hygromycin B phosphotransferase
gene (hygr), conferring resistance to G418 and
hygromycin B, respectively, bounded by LYT1 5' and 3'
flanking sequences. The gene replacement constructs were targeted to
the wild-type LYT1 loci by homologous recombination. These
two LYT1 loci can be distinguished in the Cl-Brener strain
by virtue of the absence (allele a) or presence (allele b) of a
PstI restriction site at position 1588 in the nucleotide
coding sequence.
Single (clone L14)- and double (clone L16)-knockout parasites were
obtained. To characterize the gene replacements, comparative
genomic
Southern analysis of
PstI-digested DNA isolated from
wild-type
and mutant parasites was carried out (Fig.
3). Hybridization
with
a probe from nucleotides 1 to 672 of the
LYT1 coding
region revealed
that the restriction patterns were consistent with
deletions of
the
LYT1 loci. The wild-type restriction
fragments hybridizing
to this probe included fragments of 3.7, 2.5, and
1.2 kb. The
2.5-kb band is common to both alleles, the 1.2-kb band is
specific
for the
LYT1b allele, and the 3.7-kb band is
specific for the
LYT1a allele. As expected, the double gene
knockout L16 lacks
all hybridizing bands, demonstrating that both
LYT1 sequences
were deleted. The single gene knockout L14
carries a deletion
of the
LYT1a allele as evidenced by the
lack of the 3.7-kb restriction
fragment. The successful generation of
LYT1 null mutant line indicates
that LYT1 is not essential
for the viability of
epimastigotes.
LYT1 transcripts in wild-type and mutant lines were analyzed
by Northern blotting of epimastigote nRNA. As shown in Fig.
4,
hybridization with a
LYT1
probe revealed a single band of approximately
1.8 kb in RNA isolated
from wild-type parasites. With L14 RNA,
a band of identical size but
weaker intensity appeared. This result
indicates that L14 expresses the
retained single
LYT1b allele.
As expected, no hybridization
was observed with L16 RNA.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 4.
Northern blot analysis of LYT1 expression in
wild-type and mutant parasites. Total RNA (10 µg) from the wild-type
Cl-Brener (lane 1), the single knockout L14 (lane 2), and the double
knockout L16 (lane 3) was hybridized to a LYT1 probe. A
single 1.8-kb band is observable in lanes 1 and 2.
|
|
LYT1 deficiency reduces the efficiency of in vitro
infection.
Since LYT1 appears to have hemolytic activity and
LYT1 was originally cloned based on its cross-reactivity to
anti-C9 antibodies, we aimed to determine whether LYT1 plays a role in
host cell infection. Monolayers of NIH 3T3 cells were infected with
mid-log-phase epimastigotes derived from strain Cl-Brener and each of
the LYT1 mutant lines. When using these lines, we typically
used mid-log-phase epimastigotes rather than metacyclic trypomastigotes
to initiate infections because of the inefficiency of in vitro
metacyclogenesis in the wild-type parasite line.
Subsequently, secondary-infection experiments were carried out using
trypomastigotes isolated following the first infections,
as described
in Material and Methods. The results of these experiments
are shown in
Fig.
5 and indicate that each
LYT1 mutant line exhibited
significantly reduced
infectivity. In the first infection experiments,
wild-type parasites
infected 100% of the cells at day 16 while
each of the mutant parasite
lines exhibited barely detectable
infectivity (Fig.
5A). By the time
wild-type parasites reached
100% infectivity, the infection rates for
L14 and L16 were approximately
9 and 14%, respectively. Consistent
with these results, the secondary-infection
experiments, using a
multiplicity of infection of one, also showed
that the LYT1 mutant
lines exhibited significantly reduced infectivity.
In this case, by the
time wild-type parasites reached the peak
of infection (60%) at day
14, L14 and L16 both exhibited reduced
infectivity, with rates
approximately half (27%) and 13 times
less (4%), respectively (Fig.
5B). A similar gene dosage effect
was observed when amastigotes and
trypomastigotes were quantified.
Figure
5C shows that the wild-type
strain, Cl-Brener, reached
17 × 10
6 parasites by day
14, while the mutant lines reached approximately
11 × 10
6 parasites and 4 × 10
6 parasites (L14
and L16, respectively). Trypomastigotes counted
at different points
after infection showed a similar pattern.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 5.
Single and double LYT1 allele replacements
decrease the in vitro infectivity of T. cruzi. NIH 3T3 cells
were infected with wild-type Cl-Brener ( ), L14 ( ), or L16 ( ),
parasites and the infections were monitored as described in Material
and Methods. The results shown are the averages of three independent
experiments. (A and B) Percent infected cells 48 h after infection
with epimastigotes and 2 h after infection with trypomastigotes,
respectively; (C) Number of parasites 2 h following infection with
trypomastigotes.
|
|
Reconstitution of infectivity in LYT1 null
parasites.
The additive effect of the LYT1 deletions in
L14 (single deletion) and L16 (double deletion) is consistent with the
notion that the reduced-infectivity phenotype observed in these lines is a result of the LYT1 deletions. To provide further proof
of the association between LYT1 and infection rates, we
reconstituted the infectivity of the null mutant parasite by
reintroducing the native allele LYT1a. Reconstitution was
carried out using a BsiWI restriction fragment that includes
the native LYT1a allele and approximately 600 bp of flanking
regions. Purified DNA fragment (100 µg) was used to transform
wild-type Cl-Brener epimastigotes, and 100 or 200 µg of purified DNA
fragment was used to transform L16 epimastigotes. As a negative control
electroporation was also carried out in the absence of added DNA.
Infection of NIH 3T3 monolayers was monitored for 21 days. The results
are shown in Fig. 6. Because of the
killing incurred during electroporation (70 to 80% death),
electroporated wild-type parasites exhibited reduced infectivity
compared to nonelectroporated parasites (compare approximately 15%
infected cells in this experiment at day 19 with 100% on day 16 [Fig.
5A]). L16 electroporated with buffer alone exhibited no increase in
infectivity over previous experiments (2% at day 19). In contrast, L16
electroporated with 100 or 200 µg of LYT1a restriction
fragment showed significantly enhanced infectivity (about 20% at day
19) comparable with the wild-type strain, Cl-Brener, plus DNA (20% at
day 19).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 6.
Reconstitution of infectivity in LYT1 null
mutant by transient LYT1a allele transformation. Wild-type
and LYT1 double-knockout epimastigotes were electroporated
with LYT1a coding sequence. Transformed parasites were used
to infect NIH 3T3 cells, and the infection was monitored at different
times as described in Material and Methods. The percentage of infected
cells was determined by microscopic observation by comparing the number
of cells containing parasites to total cells. Symbols: , wild type
plus TE; , wild type plus 100 µg of LYT1a DNA; , L16
plus TE; , L16 plus 100 µg of LYT1a DNA; , L16 plus
200 µg of LYT1a DNA. (A) Representative experiment of two
different experiments; (B) Average results from two different
experiments, determined at point when the maximum levels of infection
were reached (19 days).
|
|
LYT1 deficiencies accelerate in vitro stage transition.
To
successfully complete an infection cycle, parasites must efficiently
transition through the different developmental stages. Consequently, it
might be possible that the reduced infectivity of
LYT1-deficient parasites is an indirect effect of the mutant parasite's inability to complete the life cycle. To determine how the
LYT1 mutation effects the parasite's ability to complete the developmental cycle, an in vitro stage transition experiment was
carried out. The results presented in Fig.
7A show that, following transfer to DMEM
medium, the deficient lines rapidly converted to extracellular
amastigote-like parasites (20) characterized by a nearly
spherical shape and lack of visible flagella and by the fact that they
were quantitatively precipitated by the monoclonal antibody 2C2B6,
specific for the Ssp-4 surface antigen of amastigotes. On day 9, when
wild-type parasites reach 5% conversion, the mutant lines exhibited
approximately 68% (L14) and 65% (L16) infectivity. Similar results
were obtained when epimastigotes were allowed to progress to stationary
phase in the original LIT medium (Fig. 7B). The deficient lines rapidly
converted to metacyclic trypomastigotes: 32% for L14 and 18% for L16
at day 13. In contrast, less than 3% of the wild-type epimastigotes
had converted to this form. Over the time course of the experiment the
overall titer of each parasite culture continued to increase,
eliminating the possibility that LYT1 mutant epimastigotes
were less viable in DMEM than wild-type epimastigotes. Why an increase
in metacyclic trypomastigote titer was not seen in DMEM is unclear. It
is possible that under our experimental conditions amastigotes
developed directly from epimastigotes or the parasite proceeded through
the metacyclic trypomastigote stage very rapidly.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 7.
LYT1 gene deletion accelerates in vitro stage
transition. Transition efficiency of wild-type ( ), LYT1
single-knockout ( ), and LYT1 double-knockout ( )
epimastigotes was determined by their ability to convert to
extracellular amastigote-like cells in DMEM (A) or metacyclic
trypomastigotes in LIT medium (B). The results plotted are the
means ± the standard deviations of three different experiments.
|
|
LYT1 deficiency reduces hemolytic activity.
The
marked reduction in host cell infection ability by LYT1 null
mutants could be predicted as a consequence of decreased parasite-mediated lytic activity. To test this possibility, the effect
of LYT1 mutations on the hemolytic activity of the parasite was assessed. As a first step the hemolytic activity of the wild-type parasite during the three developmental stages of the parasite was
tested under acid and neutral conditions. The results showed that after
6 h of incubation no hemolytic activity was obtained at a neutral
pH in any of the three developmental stages, while a strong lysis
activity was observed when the red cells were incubated in the presence
of amastigotes at an acid pH (Fig. 8).
Subsequently, the hemolytic activities of wild-type and single- and
double-knockout parasites were evaluated at the time point at which
wild-type parasites lysed 50% of the red blood cells at pH 5.4 (defined as 100% lytic activity). The results presented in Fig.
9 show that each mutant line expressed
less lytic activity than wild-type parasites. At the time that
wild-type amastigotes had lysed 100% of the erythrocytes, L14 and L16
amastigotes had lysed only 41 and 36% of the red blood cells,
respectively (Fig. 9A). Although lytic activity has been primarily
associated with amastigotes, epimastigotes have also been shown to
express low levels of lytic activity (1). Consequently,
the lytic activity of wild-type and LYT1 mutant parasites
was assessed, with the result that in each case mutant epimastigotes
expressed less lytic activity than wild-type epimastigotes did (Fig.
9B). The mutant phenotype was, however, less striking in epimastigotes
than in amastigotes (Fig. 8). At the time that wild-type epimastigotes
reached 100% hemolysis, L14 (single knockout) exhibited 84% lytic
activity and L16 (double knockout) exhibited 58% lytic activity.
Similar to the results of the in vitro infection experiments, these
results suggest a possible gene dosage effect since the single knockout
retains more activity that the null line.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 8.
Hemolytic activity of the various stages of T. cruzi in neutral and acid pH. The lysis of erythrocytes by
metacyclic trypomastigotes (T), epimastigotes (E), and amastigotes (A)
was determined in acid (filled bars) or neutral (empty bars) conditions
at 37°C for 6 h. The spontaneous lysis (SL) and 100% lysis (C)
of erythrocytes in the two different pH buffers and water,
respectively, under the same sample conditions, were determined. The
results shown are averages from three independent experiments.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 9.
LYT1 single- and double-knockout mutants
exhibit reduced hemolytic activity at pH 5.4. The lysis of erythrocytes
by amastigotes (A) and epimastigotes (B) was determined at 37°C after
various periods of time, and the results were normalized by defining
100% hemolysis as the time point at which wild-type parasites lysed
50% of the red blood cells. The average percentage of lysis of three
different experiments was calculated from the released hemoglobin where
the spontaneous lysis has been substracted, using wild-type (WT),
LYT1 single-knockout (L14), and LYT1
double-knockout (L16) parasites.
|
|
 |
DISCUSSION |
T. cruzi infection of mammalian cells is a complex
event involving multiple host and parasite proteins. To date, only
three parasite proteins, TC-TOX (1, 2, 5), oligopeptidase
B (8), and TcMIP (17), have been convincingly
shown to be involved in host cell invasion. The present study focused
on the LYT1 gene that encodes a protein that, based on
genetic evidence, is required for efficient infection since deletions
of the gene result in significantly decreased infectivity in vitro. The
LYT1 gene was originally cloned from a cDNA expression
library on the basis of cross-reactivity to antibodies specific for the
C9 component of the complement cascade. Subsequent computer analysis
failed, however, to detect homology to C9 and in fact failed to detect homology to any known protein or possible translation product. The only
clues pointing to a possible function consisted of circumstantial evidence suggesting the protein could be, at least structurally, related to TC-TOX, a secreted protein exhibiting hemolytic activity expressed in T. cruzi (1). This evidence
consisted of the fact that the two proteins are of similar size and
both cross-reacted with antibodies directed towards C9. The notion of a
functional relationship between the two proteins was strengthened by
the finding of hemolytic activity in extracts from yeast transformed to
express LYT1 and by the analysis of mutant parasites which demonstrated that parasites carrying LYT1 deficiencies
exhibited significantly less TC-TOX-associated hemolytic activity than
wild-type parasites. Moreover, the kinetics of the lytic activity we
attribute to LYT1 were indistinguishable from those reported for TC-TOX (1), which is consistent with the idea that the molecules
are at the very least involved in the same pathway.
The central role of LYT1 in the parasite life cycle was illustrated by
the three phenotypes associated with LYT1 deficiencies. Each
of these phenotypes, decreased infectivity, decreased hemolysis, and
enhanced development, also displayed a gene dosage effect, further
supporting the involvement of LYT1. The involvement of LYT1 in
infection was formally demonstrated by the LYT1-dependent reconstitution of infectivity in null mutants. Whether the decreased infectivity of LYT1-deficient parasites was directly related
to their decreased hemolytic activity remains uncertain.
The results presented here also demonstrate that the reduced
infectivity of the LYT1-deficient parasites was not a consequence of an
inability to complete the life cycle, since the mutant epimastigotes converted to metacyclic trypomastigotes and amastigotes more
efficiently than wild-type parasites. The accelerated stage conversion
associated with LYT1 deficiencies is consistent with a
common model for both amastigote and metacyclic trypomastigote
development in which the LYT1 gene product acts as a
suppressor of stage transition in epimastigotes. This would effectively
maintain the epimastigote gene expression profile while suppressing
expression of proteins specific for either of the other two stages.
Inhibition of LYT1 expression, either through normal
processes or mutation, would relieve suppression, permitting expression
of either amastigote- or metacyclic trypomastigote-specific proteins,
depending on the culture media.
The diverse phenotypes associated with LYT1 deficiencies
raise the question of how a single protein could be involved in
processes that are both extracellular (e.g., hemolysis) and
intracellular (e.g., regulation of stage transition). The simplest
explanation would be one that places LYT1 in a cell-signaling pathway
common to both processes. An alternative possibility is that different forms of the protein are expressed and are responsible for the different phenotypes. Support for this later possibility comes from
preliminary experiments demonstrating that, as a result of alternative
trans splicing, derivatives of LYT1 may be expressed (R. Manning-Cela and J. Swindle, unpublished results). One derivative would
consist of the complete 552-amino-acid protein encoded by the
LYT1 open reading frame containing a computer-predicted
15-amino-acid leader peptide. The second would carry an amino-terminal
truncation of 29 amino acids eliminating the putative secretion signal.
Therefore, it is possible that two forms of the protein are produced,
with the secreted form involved in pore-forming activity and the
cytosolic derivative responsible for suppression of stage transition.
 |
ACKNOWLEDGMENTS |
This work was supported by USPHS grant A126578 awarded to J.S.
and grants PM95-0100 and PB98-0479 awarded to A.G. by the Spanish Ministry of Education and Culture. R.M.-C. is the recipient of a
Fogarty Postdoctoral Fellowship (1F05TW05274-01). A.C. and E.G.-R. receive doctoral fellowships from FPI/MEC (Spain).
Rebeca Manning-Cela and Arantxa Cortés each contributed
significantly to the published work.
We thank Norma Andrews (Yale University) for advice and for the
generous gift of 2C2B6 antibodies and Juan Jiménez (Universidad de Málaga) for guidance during the yeast expression experiments.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Infection
Disease Research Institute, 1124 Columbia St., Suite 600, Seattle, WA
98104. Phone: (206)381-0883. Fax: (206) 381-3678. E-mail:
jswindle{at}idri.org.
Editor:
W. A. Petri Jr.
 |
REFERENCES |
| 1.
|
Andrews, N. A., and M. B. Whitlow.
1989.
Secretion by Trypanosoma cruzi of a hemolysin at low pH.
Mol. Biochem. Parasitol.
33:249-256[CrossRef][Medline].
|
| 2.
|
Andrews, N. W.
1990.
The acid-active hemolysin of Trypanosoma cruzi.
Exp. Parasitol.
71:241-244[CrossRef][Medline].
|
| 3.
|
Andrews, N. W.
1994.
From lysosomes into the cytosol: the intracellular pathway of Trypanosoma cruzi.
Braz. J. Med. Biol. Res.
27:471-475[Medline].
|
| 4.
|
Andrews, N. W.
1993.
Living dangerously: how Trypanosoma cruzi uses lysosomes to get inside host cells, and then escapes into the cytoplasm.
Biol. Res.
26:65-67[Medline].
|
| 5.
|
Andrews, N. W.,
C. K. Abrams,
S. L. Slatin, and G. Griffiths.
1990.
A T. cruzi-secreted protein immunologically related to the complement component C9: evidence for membrane pore-forming activity at low pH.
Cell
61:1277-1287[CrossRef][Medline].
|
| 6.
|
Andrews, N. W.,
K. S. Hong,
E. S. Robbins, and V. Nussenzweig.
1987.
Stage-specific surface antigens expressed during the morphogenesis of vertebrate forms of Trypanosoma cruzi.
Exp. Parasitol.
64:474-484[CrossRef][Medline].
|
| 7.
|
Burleigh, B. A., and N. W. Andrews.
1995.
The mechanisms of Trypanosoma cruzi invasion of mammalian cells.
Annu. Rev. Microbiol.
49:175-200[CrossRef][Medline].
|
| 8.
|
Caler, E. V.,
S. Vaena de Avalos,
P. A. Haynes,
N. W. Andrews, and B. A. Burleigh.
1998.
Oligopeptidase B-dependent signaling mediates host cell invasion by Trypanosoma cruzi.
EMBO J.
17:4975-4986[CrossRef][Medline].
|
| 9.
|
Chung, S. H.,
R. D. Gillespie, and J. Swindle.
1994.
Analyzing expression of the calmodulin and ubiquitin-fusion genes of Trypanosoma cruzi using simultaneous, independent dual gene replacements.
Mol. Biochem. Parasitol.
63:95-107[CrossRef][Medline].
|
| 10.
|
Gillespie, R. D.,
J. Ajioka, and J. Swindle.
1993.
Using simultaneous, tandem gene replacements to study expression of the multicopy ubiquitin-fusion (FUS) gene family of Trypanosoma cruzi.
Mol. Biochem. Parasitol.
60:281-292[CrossRef][Medline].
|
| 11.
|
Gonzalez, A.,
T. J. Lerner,
M. Huecas,
B. Sosa-Pineda,
N. Noqueira, and P. M. Lizardi.
1985.
Apparent generation of a segmented mRNA from two separate tandem gene families in Trypanosoma cruzi.
Nucleic Acids Res.
13:5789-5804[Abstract/Free Full Text].
|
| 12.
|
Gonzalez, A.,
J. L. Rosales,
V. Ley, and C. Diaz.
1990.
Cloning and characterization of a gene coding for a protein (KAP) associated with the kinetoplast of epimastigotes and amastigotes of Trypanosoma cruzi.
Mol. Biochem. Parasitol.
40:233-243[CrossRef][Medline].
|
| 13.
|
Hariharan, S.,
J. Ajioka, and J. Swindle.
1993.
Stable transformation of Trypanosoma cruzi: inactivation of the PUB12.5 polyubiquitin gene by targeted gene disruption.
Mol. Biochem. Parasitol.
57:15-30[CrossRef][Medline].
|
| 14.
|
La, F. A. C.,
F. Buckner,
J. Swindle,
J. Ajioka,
L. Barrett, and V. W. C. Van.
1994.
Engineering cytokine secretion from Trypanosoma cruzi.
Mem. Inst. Oswaldo Cruz
89:650-651[Medline].
|
| 15.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[CrossRef][Medline].
|
| 16.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual, 1st ed.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 17.
|
Moro, A.,
F. Ruiz-Cabello,
A. Fernandez-Cano,
R. P. Stock, and A. Gonzalez.
1995.
Secretion by Trypanosoma cruzi of a peptidyl-prolyl cis-trans isomerase involved in cell infection.
EMBO J.
14:2483-2490[Medline].
|
| 18.
|
Rodriguez, A.,
E. Samoff,
M. G. Rioult,
A. Chung, and N. W. Andrews.
1996.
Host cell invasion by trypanosomes requires lysosomes and microtubule/kinesin-mediated transport.
J. Cell Biol.
134:349-362[Abstract/Free Full Text].
|
| 19.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 20.
|
Teixeira, M. R. S.,
K. Otsu,
K. L. Hill,
L. V. Kirchoff, and J. E. Donelson.
1999.
Expression of a marker for intracellular Trypanosoma cruzi amastigotes in extracellular spheromastigotes.
Mol. Biochem. Parasitol.
98:265-270[CrossRef][Medline].
|
| 21.
|
Thomas, M. C., and A. Gonzalez.
1997.
A transformation vector for stage-specific expression of heterologous genes in Trypanosoma cruzi epimastigotes.
Parasitol. Res.
83:151-156[CrossRef][Medline].
|
Infection and Immunity, June 2001, p. 3916-3923, Vol. 69, No. 6
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.6.3916-3923.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zago, M. P., Barrio, A. B., Cardozo, R. M., Duffy, T., Schijman, A. G., Basombrio, M. A.
(2008). Impairment of Infectivity and Immunoprotective Effect of a LYT1 Null Mutant of Trypanosoma cruzi. Infect. Immun.
76: 443-451
[Abstract]
[Full Text]
-
Manning-Cela, R., Gonzalez, A., Swindle, J.
(2002). Alternative Splicing of LYT1 Transcripts in Trypanosoma cruzi. Infect. Immun.
70: 4726-4728
[Abstract]
[Full Text]