Previous Article | Next Article 
Infection and Immunity, June 2001, p. 4041-4047, Vol. 69, No. 6
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.6.4041-4047.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Knockout of the Rodent Malaria Parasite Chitinase
PbCHT1 Reduces Infectivity to Mosquitoes
Johannes T.
Dessens,1,*
Jacqui
Mendoza,1
Charles
Claudianos,1
Joseph M.
Vinetz,2
Emad
Khater,1
Stuart
Hassard,1
Gaya R.
Ranawaka,1 and
Robert
E.
Sinden1
Department of Biology, Imperial College of
Science, Technology, and Medicine, London SW7 2AZ, United
Kingdom,1 and WHO Center for Tropical
Diseases, University of Texas Medical Branch, Galveston, Texas
77555-06092
Received 9 January 2001/Returned for modification 14 February
2001/Accepted 26 February 2001
 |
ABSTRACT |
During mosquito transmission, malaria ookinetes must cross a
chitin-containing structure known as the peritrophic matrix (PM), which
surrounds the infected blood meal in the mosquito midgut. In turn,
ookinetes produce multiple chitinase activities presumably aimed at
disrupting this physical barrier to allow ookinete invasion of the
midgut epithelium. Plasmodium chitinase activities are demonstrated targets for human and avian malaria transmission blockade
with the chitinase inhibitor allosamidin. Here, we identify and
characterize the first chitinase gene of a rodent malaria parasite,
Plasmodium berghei. We show that the gene, named
PbCHT1, is a structural ortholog of
PgCHT1 of the avian malaria parasite Plasmodium
gallinaceum and a paralog of PfCHT1 of the human
malaria parasite Plasmodium falciparum. Targeted
disruption of PbCHT1 reduced parasite infectivity in
Anopheles stephensi mosquitoes by up to 90%. Reductions
in infectivity were also observed in ookinete feeds
an artificial
situation where midgut invasion occurs before PM formation
suggesting
that PbCHT1 plays a role other than PM disruption. PbCHT1 null mutants
had no residual ookinete-derived chitinase activity in vitro,
suggesting that P. berghei ookinetes express only one
chitinase gene. Moreover, PbCHT1 activity appeared insensitive to
allosamidin inhibition, an observation that raises questions about the
use of allosamidin and components like it as potential malaria
transmission-blocking drugs. Taken together, these findings suggest a
fundamental divergence among rodent, avian, and human malaria parasite
chitinases, with implications for the evolution of
Plasmodium-mosquito interactions.
 |
INTRODUCTION |
After ingestion of infectious
Plasmodium gametocytes by the mosquito, motile ookinetes
develop in the midgut lumen and traverse the chitin-containing
peritrophic matrix (PM), the microvillus-associated network, and the
midgut epithelium to form sporozoite-producing oocysts on the hemocoel
side of the midgut (11, 18). After the demonstration that
ookinetes secrete multiple chitinase activities (6), two
distinct Plasmodium chitinase genes were isolated. The first
was isolated from the human malaria parasite Plasmodium falciparum (PfCHT1) (14), while the second
was found in the avian malaria parasite Plasmodium
gallinaceum (PgCHT1) (15). The primary
structures of these two chitinase genes are markedly different:
PgCHT1 encodes putative amino-terminal proenzyme and carboxy-terminal chitin-binding domains, which are both absent in PfCHT1. P. gallinaceum secretes a second chitinase
activity provisionally named PgCHT2, believed to be orthologous to that encoded by PfCHT1 based on its molecular mass and
physiological properties (pH optimum and sensitivity to the chitinase
inhibitor allosamidin), and it may have additional chitinase activities (15).
The Streptomyces-produced molecule allosamidin is a
622-dalton pseudo-oligosaccharide that inhibits Plasmodium
chitinase activities in vitro (10, 14, 15). Moreover, the
presence of allosamidin in an infected blood meal inhibited oocyst
formation of P. gallinaceum in Aedes aegypti and
of P. falciparum in Anopheles freeborni, a
process that was reversed when the PM was prevented from forming by the
addition of exogenous chitinase to the blood meal (10). Although these inhibitor studies identified Plasmodium
chitinases as potential malaria transmission-blocking targets,
dissection of the roles of the individual chitinase activities in
mosquito infection remains a prerequisite for a rational
chitinase-based transmission-blocking vaccine or drug design. For this
purpose, we have isolated a chitinase gene of the rodent malaria
parasite Plasmodium berghei, a Plasmodium species
amenable to such experiments because of its suitability for obtaining
stable transgenic gene knockout parasites and its ability to form large
numbers of ookinetes in vitro for study. We show that the isolated
P. berghei chitinase gene, named PbCHT1, contains
putative proenzyme and chitin-binding domains and is a structural
ortholog of PgCHT1. The construction of transgenic PbCHT1
null mutants has allowed us to establish that P. berghei
ookinetes have only one apparent chitinase activity. We show that these
parasites have significantly reduced, but not abolished, infectivity in
mosquitoes. Our data further suggest that PbCHT1 may play a role other
than PM penetration and is insensitive to allosamidin. The biological
significance of these findings is discussed.
 |
MATERIALS AND METHODS |
Parasite maintenance, culturing, and purification; differential
screening; RNA extraction and purification; Southern, Northern, and
Western blotting; and mosquito infections were performed as described
previously (3).
Gene isolation and sequence analysis.
From the partial cDNA,
the complete PbCHT1 sequence was obtained with the
gene-specific primer F02-RACE (CGATACCAGGTGCCCGTGTTGAATAG) using SMART rapid amplification of cDNA ends (RACE) (Clontech Laboratories) according to the manufacturer's instructions. Sequence analyses were carried out with the MacVector package (Oxford Molecular).
Construction of transgenic parasites.
A 600-bp fragment
corresponding to the 5' portion of the PbCHT1 mRNA was amplified with
primers CHIT-BAM (GGATCCATTTTTTTGGAGACTTTATAACA) and
CHIT-ERI (GAATTCTAAAATTTCCCTTGGAGA), digested with
BamHI and EcoRI, and ligated into
BamHI/EcoRI-digested pBS-DHFR (3) to give pCHT1-BE. A 530-bp fragment corresponding to the 3' portion of the
PbCHT1 mRNA was amplified with primers CHIT-KPN
(GGTACCAAATATATGCAATGTAACTAAAA) and CHIT-HIND
(AAGCTTAAACAATGGCATGGAGG), digested with KpnI and HindIII, and ligated into
KpnI/HindIII-digested pCHT1-BE to give the
transfection plasmid pPbCHT1-KO. Fifty micrograms of pCHT1-KO was
digested with KpnI and BamHI to excise the
plasmid backbone and transfected into purified schizonts as described
previously (16). Pyrimethamine selection of transformed
parasites and limiting dilution cloning were performed as described
previously (16).
RT-PCR.
One microgram of ookinete total RNA was reverse
transcribed with Superscript II (Life Technologies) in the presence of
d(T25) according to the manufacturer's
instructions and then diluted to 100 µl with Tris-glycine buffer (pH
8.0). One microliter was subjected to PCR amplification. The
PbCHT1-specific primers CHT1-PF (GCCAAGGAGCTAGCGGG) and CHT1-PR
(CGATACCAGGTGCCCG) were used to amplify the
PbCHT1 probe used in Southern and Northern blotting and for
semiquantitative reverse transcription (RT)-PCR. Gene Pbs25-specific primers were described previously
(9). Degenerate primers CHT2-Forward
[GGTAT(A/T/C)AT(A/T/C)(G/C)(G/C)IGGITA(C/T) TA(C/T)(G/C)(G/C)ITCITGG]
(where I is inosine) and CHT2-Reverse [GG(C/T)TCI(C/T)A(A/G)TCIA(C/T)(A/G)TCIA(C/T)CC(A/G)TC]
were used to amplify Plasmodium chitinase genes.
In vitro chitinase activity assay.
Ten million ookinetes
were homogenized in phosphate-buffered saline (PBS) (pH 7.5) containing
1% Nonidet P-40 (Sigma) and centrifuged at 20,000 × g for 2 min;
the supernatant was loaded into 1% agarose gels in PBS containing
0.01% ethylene glycol chitin (Seikagaku). After overnight
incubation at 37°C, the gels were stained for 5 min in PBS containing
0.01% Fluorescent Brightener 28 (Sigma) and destained in distilled
water. Chitin hydrolysis was visualized under UV light. Relative
intensities of hydrolysis were measured by pixel density scanning with
NIH Image software. Serratia marcescens chitinase A
(SmChiA; 10 mU; Sigma) was used as a positive control for allosamidin activity.
Nucleotide sequence accession number.
Sequence data have
been submitted to the DDBJ/EMBL/GenBank databases under accession
number AJ305256.
 |
RESULTS |
Identification and sequence analysis of PbCHT1.
A partial cDNA
corresponding to PbCHT1 was obtained by differential
screening of a subtracted P. berghei cDNA library enriched for ookinete-specific sequences (4). Subsequently, the
remainder of the PbCHT1 sequence was obtained by rapid
amplification of cDNA ends. PbCHT1 is encoded by a single large open
reading frame of 1,947 nucleotides encoding a 649-amino-acid protein
with a calculated Mr of 72,127. It
contains a predicted amino-terminal signal peptide of 18 amino acids
resulting in a mature protein with an
Mr of 70,072. Homology searches
revealed high levels of sequence homology with the other
Plasmodium chitinases, PgCHT1 and PfCHT1. Amino acid
sequence identity of PbCHT1 is substantially higher with PgCHT1 (58%)
than with PfCHT1 (19%), although the differences at sequence
similarity levels are less pronounced (81 and 76%, respectively).
In other respects also, PbCHT1 is more similar to PgCHT1 than to
PfCHT1 (Fig.
1A).
First, it contains a putative carboxy-terminal chitin-binding domain
(residues 495 to 648; PbCHT1 numbering) very similar to that present in
PgCHT1. This domain is absent in PfCHT1. Second, PbCHT1 contains a
region of low complexity and low sequence conservation between residues
37 and 152; this region contains nine imperfect repeats of the amino
acid sequence E(NG)NGNGA/V (one-letter amino acid code, with
parentheses enclosing acids not always present and a shill between two
acids indicating the presence of one or the other acid). It is likely
that this amino-terminal region downstream of the signal peptide
constitutes a proenzyme domain like that described for PgCHT1
(15). Given the overall structural features and sequence
homologies, it is clear that PbCHT1 and PgCHT1 are orthologs, whereas
PfCHT1 is a paralog.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 1.
Comparison of PbCHT1, PgCHT1, PfCHT1, and SmChiA,
a bacterial family 18 chitinase from S. marcescens. (A)
Multiple amino acid alignment (Clustal W). Residue identities are
indicated by shading (grey, 75%; black, 100%), and secondary
structure features (coils represent helices; arrows represent sheets)
are shown below the sequences. The predicted catalytic dyad (SmChiA
residues 315 and 391) is marked with red dots.
Plasmodium chitinases show a high structural
conservation with subdomains 2 (blue) and 3 (green) of SmChiA. (B)
Stereo-space-filled image of the atomic structure of SmChiA showing
subdomains 2 (blue) and 3 (green) and the catalytic dyad (red). These
domains correspond to the areas of strong conservation in
Plasmodium chitinases and are similarly colored in panel
A. The numbers refer to the three subdomains.
|
|
A comparison of the three Plasmodium chitinases with SmChiA,
a closely related family 18 glycosylhydrolase for which the
crystal structure has been determined (8), reveals
extended sequence homology for all three parasite chitinases with
/
barrel subdomain 2 and
+
subdomain
3 of SmChiA (Fig. 1). Based on similarities with lysozyme, SmChiA
subdomain 2 contains two catalytic dyad residues that are juxtaposed in
the substrate-binding groove: glutamate 315 and aspartate 391 (Fig. 1).
These residues are conserved in the Plasmodium chitinases,
although aspartate 391 has been substituted with glutamate.
-Sheet
subdomain 1 of SmChiA is structurally related to the fibronectin III
domain; in the parasite chitinases this domain is absent. Notably,
sequence homology starts just downstream of the putative proenzyme
sequences and extends to include the entire SmChiA subdomains 2 and 3. Thus, all Plasmodium chitinases contain a hydrolytic domain
equivalent to SmChiA subdomains 2 and 3, while PbCHT1 and PgCHT1
contain additional amino- and carboxy-terminal subdomains corresponding
to the putative proenzyme and chitin-binding domains, respectively.
Expression of PbCHT1.
To determine the pattern of expression
of PbCHT1, we carried out a Northern blot analysis of RNA samples
purified from asexual blood-stage parasites, gametocytes, or in
vitro-cultured ookinetes. This analysis identified an abundant mRNA of
approximately 2.5 kb in the ookinete sample, while no signal was
obtained in either asexual blood-stage parasites or gametocytes (Fig.
2A). These results strongly indicate the
expression of PbCHT1 in ookinetes, which is also the case for the other
Plasmodium chitinases (14, 15). In fact, PgCHT1
was recently shown to be transported via micronemes to the
electron-dense area of the apical complex for extracellular secretion
(7).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 2.
Differential expression of PbCHT1. Total
RNA from asexual blood-stage parasites (lane 1), gametocytes (lane 2),
and in vitro-cultured ookinetes (lane 3) was subjected to Northern blot
analysis using a probe corresponding to PbCHT1. RNA
amounts were normalized using large- and small-subunit rRNAs
(ethidium bromide stained), as shown at the bottom of the
figure.
|
|
Targeted disruption of PbCHT1.
To investigate the function of
PbCHT1, we generated transgenic PbCHT1-disrupted parasites
by insertion of a modified Toxoplasma gondii dihydrofolate
reductase-thymidylate synthase gene cassette (DHFR/TS)
(13, 16) that confers resistance to the antimalarial drug
pyrimethamine into the PbCHT1 gene by double homologous
recombination (Fig. 3A). The
DHFR/TS cassette was inserted between nucleotide positions
660 and 1960 of PbCHT1 (Fig. 3A), thereby removing 1.3 kb of
the PbCHT1 central coding sequence, including the sequences encoding the putative binding pocket and the catalytic site.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
Targeted disruption of PbCHT1 and
molecular analyses. (A) Schematic diagram of the targeting strategy.
Indicated is the transfection vector pPbCHT1-KO containing the
T. gondii DHFR/TS gene cassette (white box), P.
berghei DHFR flanking sequences (gray boxes), and
PbCHT1-specific sequences (hatched boxes). The double
homologous recombination crossover sites (crossed lines), the
integration sites (arrows with nucleotide positions), the
SphI restriction sites, and the probes used in Southern
blot analysis (thick lines) are shown. gDNA, genomic DNA. (B)
Southern blot analysis of SphI-digested genomic DNA from
WT and PbCHT1-KO parasites using probes corresponding to
PbCHT1 (left panel) and to the DHFR/TS
cassette (right panel). (C) RT-PCR analysis of total RNA derived from
ookinete-enriched midgut stages of WT (left lanes) and PbCHT1-KO (right
lanes) parasites. Amplicons corresponding to
PbCHT1(~1,100 bp) and Pbs25 (~600 bp)
are shown.
|
|
Subsequently, two independent clonal transgenic parasite populations
(termed PbCHT1-KO clones 33 and 37) were assessed for their integrity
by Southern blot analysis of SphI-digested genomic DNA. A
probe corresponding to nucleotide positions 710 to 1840 of
PbCHT1 (no internal SphI sites present) gave rise
to a single band in the parental (wild-type [WT]) parasites but no
bands in the PbCHT1-KO parasites (Fig. 3B), demonstrating the
successful removal of the PbCHT1 central sequence by
the insertion of the DHFR/TS cassette. Cross-hybridization
with other putative chitinase genes was not observed under the
conditions used. Conversely, a probe corresponding to the
DHFR/TS cassette (two SphI sites present) gave
rise to three DHFR/TS-specific bands in the PbCHT1-KO parasites but no signal in the WT sample (Fig. 3B). Together, these
results confirmed correct integration of the DHFR/TS
cassette into the target gene.
PbCHT1-KO parasites developed gametocytes and formed ookinetes in vivo
and in vitro, in numbers similar to and indistinguishable from those of
WT parasites in Giemsa-stained blood films (data not shown). To confirm
that PbCHT1 expression was abolished in the transgenic parasites, total
RNA was extracted from in vitro-cultured ookinetes and subjected to
RT-PCR using PbCHT1-specific primers. In the WT
parasites, a band of approximately 1,100 bp corresponding to
PbCHT1 was amplified, while no band was amplified in the
PbCHT1-KO parasites. In contrast, a 600-bp band corresponding to the
reference ookinete gene Pbs25 (9) was amplified
in both parasite samples (Fig. 3C). Clearly, the absence of
PbCHT1 mRNA is in full agreement with the genotype of the
PbCHT1-KO parasites (Fig. 3B) and supports the successful knockout
of PbCHT1 expression.
Are there other chitinases of P. berghei?
We
performed several experiments to investigate whether P.
berghei had any additional chitinase genes. First, we performed Western blotting with ookinete homogenates and antiserum raised against
a PgCHT1 active-site peptide. This antiserum detects at least two
distinct chitinases in P. gallinaceum and cross-reacts with PfCHT1 (7, 15). Thus, it is likely that this
antiserum would cross-react with PbCHT1 and other chitinases of
P. berghei. However, only a single band with an
approximate Mr of 70,000 was detected in the
WT parasites; as expected, this band was absent in the PbCHT1-KO
parasites (Fig. 4A). Based on its
apparent size and its absence in the PbCHT1-KO parasites, this 70-kDa
band likely corresponds to PbCHT1 and confirms that the transgenic
parasites are PbCHT1 null mutants. Prolonged development of the blot
revealed a weak band with an approximate Mr
of 60,000 in the WT sample (data not shown), indicating the processing
of PbCHT1 and possibly reflecting the cleavage of the putative
proenzyme domain. No other proteins were recognized, arguing against
the presence of additional chitinases in P. berghei.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
Analysis of P. berghei WT and PbCHT1-KO
ookinete homogenates for additional chitinase activity. (A) Western
blot analysis with PgCHT1 active-site antiserum. (B) In vitro chitinase
activity assay with glycol chitin-containing agarose. Also included is
a homogenate from similarly purified blood stages (BS).
|
|
Second, we designed degenerate primers for amino acid sequences
conserved among the three Plasmodium chitinases and
performed RT-PCR with RNA purified from WT and PbCHT1-KO ookinetes.
While we were able to amplify a PbCHT1-specific sequence
from the WT parasites, no product could be amplified from the PbCHT1-KO
parasites (data not shown), again arguing against the expression of
other chitinase genes in this stage of the life cycle.
Third, we performed an in vitro chitinase activity assay with ookinete
homogenates and glycol chitin-containing agarose. In this assay,
chitinase activity is demonstrated by a dark area around the well
containing the homogenate, resulting from hydrolysis of the chitin
substrate by the diffusing chitinase. An approximately 80% reduction
in activity was observed in the PbCHT1-KO ookinetes (Fig. 4B), again
confirming that the PbCHT1-KO parasites are PbCHT1 null mutants. This
residual chitinase activity corresponds to background activity, as it
was also observed in homogenates from similarly purified blood-stage
parasites. This chitinase activity likely is derived from contaminating
mouse leukocytes or serum proteins, as has been reported for human
leukocytes and serum (5). Thus, the apparent absence of
residual ookinete-derived chitinase activity in the PbCHT1-KO sample,
combined with the results from the Western and RT-PCR analyses,
indicates that PbCHT1 is the sole chitinase gene expressed
in P. berghei ookinetes.
Infectivity of PbCHT1-KO parasites to Anopheles
stephensi mosquitoes.
To assess the effects of PbCHT1
disruption on mosquito infection, PbCHT1-KO and WT parasites were fed
to A. stephensi mosquitoes and compared for their ability to
form oocysts, a measure of parasite infectivity. In seven experiments,
significant (P < 0.01) reductions in oocyst numbers of
between 30 and 90% were obtained with the PbCHT1-KO parasites (Table
1). The two independent clonal
populations of transgenic parasites (clones 33 and 37) had very similar
transmission phenotypes, indicating that the reduction in infectivity
is unlikely to be a result of clonal phenotypic variation.
Surprisingly, we observed significant levels of reduction in the
infectivity of the PbCHT1-KO parasites in both gametocyte and ookinete
feeds (Table 1). In A. stephensi, PM formation is first
detectable by electron microscopy at 12 h and continues up to
48 h after blood feeding (1). In ookinete feeds, we
observed ookinetes in the midgut epithelium as early as 3 h
postfeeding, and by 12 h the majority had reached the midgut
epithelium (data not shown). Thus, in ookinete feeds most ookinetes
invade the midgut epithelium in the absence of a developed PM. In
contrast, in gametocyte feeds 20 to 30 h is required for ookinete
development in the midgut lumen (11); consequently, the
majority of ookinetes invade the midgut epithelium in the presence of a
developed PM. Clearly, if PbCHT1 played a role in PM disruption,
then we would anticipate infection levels more comparable to those of
the WT parasites in ookinete feeds. As this was clearly not the case, the results suggest that the PM is not a target of PbCHT1 activity in
A. stephensi.
PbCHT1-KO oocysts formed normal numbers of sporozoites, which were
infectious to mice upon mosquito bite. Moreover, parasites from
sporozoite-induced infections retained their phenotype in subsequent
mosquito transmissions (data not shown). This result demonstrates that
PbCHT1 functions predominantly in the ookinete stage, an observation
consistent with its expression profile (Fig. 2). Indeed, chitinase
activity is unlikely to be required for downstream sporozoite invasion
of the salivary gland ducts of A. stephensi, as these have
been reported not to contain chitin (17).
Allosamidin does not inhibit PbCHT1.
When we assessed the
effects of the chitinase inhibitor allosamidin on P. berghei
infectivity in A. stephensi, we found no decrease in oocyst
numbers (data not shown). Interestingly, we used an allosamidin
concentration (0.1 mM) that effectively abolished oocyst development of
P. falciparum and P. gallinaceum in A. freeborni and A. aegypti, respectively
(10). This result suggested that allosamidin does not
inhibit PbCHT1. To test this suggestion, we added allosamidin to
ookinete homogenates at concentrations of up to 1 mM in our in vitro
chitinase activity assay and observed no inhibition of chitinase
activity (Fig. 5A), while a control chitinase activity (SmChiA) was inhibited (data not shown). The concentration of 1 mM is far in excess (200-fold) of that found to
reduce P. gallinaceum chitinase activity in vitro by more
than 90% (10). The addition of allosamidin to blood feeds
did, however, have a clear effect on the ability of the mosquitoes to
digest the blood meal. At an allosamidin concentration of 0.1 mM, PMs and partially digested blood meals were still present at 9 days postinfection in one-third of the mosquitoes examined, while none of
the control mosquitoes contained blood meal remnants (Fig. 5B). A
similar observation was made for A. freeborni and A. aegypti mosquitoes fed allosamidin (10) and is
indicative of the allosamidin inhibition of mosquito-derived
chitinase(s).

View larger version (95K):
[in this window]
[in a new window]
|
FIG. 5.
Effects of allosamidin. (A) In vitro chitinase activity
assay with P. berghei WT ookinete homogenates in the
presence of 0, 0.1, and 1 mM allosamidin. (B) Effect of allosamidin on
blood meal digestion. Shown are dissected guts of mosquitoes at 9 days
after blood feeding in the presence (+) or absence ( ) of 0.1 mM
allosamidin.
|
|
 |
DISCUSSION |
In this paper, we describe and characterize PbCHT1, the
first chitinase gene isolated from a rodent malaria species. We show that the gene product, PbCHT1, contains putative proenzyme and chitin-binding domains and is orthologous to a previously described endochitinase, PgCHT1, from P. gallinaceum. Targeted
disruption of the PbCHT1 gene by double homologous
recombination has allowed us to study the existence of other putative
chitinase activities in P. berghei ookinetes as well as the
role of PbCHT1 in mosquito infection in the absence and presence of a PM.
Our findings indicate that P. berghei ookinetes have a
single chitinase activity because (i) no additional bands were
recognized in Western blottings by a PgCHT1 active-site antibody, (ii)
no specific products could be amplified from PbCHT1-KO ookinetes with
Plasmodium chitinase gene-specific degenerate primers, and (iii) most importantly, no residual ookinete-derived chitinase activity
was observed in PbCHT1-KO parasites (Fig. 4). In fact, the same may be
true for P. falciparum because only a single chitinase gene
has thus far been described in the Malaria Genome Project databases,
which now contain about 95% of the genome. Intuitively, if this
assumption is correct and P. gallinaceum does indeed possess both types of chitinase genes, then it can be suggested that both P. falciparum and P. berghei share an avian
Plasmodium ancestor and that each has retained a different
one of the two chitinases.
Transmission experiments with A. stephensi have shown that
PbCHT1 null mutants are significantly impaired in oocyst formation but
that PbCHT1 is not essential for mosquito infection. The residual infectivity of the PbCHT1-KO ookinetes may, at least to some extent, be
the result of mouse-derived chitinase activity; however, it is just as
conceivable that A. stephensi midgut chitin simply does not
provide a foolproof barrier for P. berghei infection. It
should be noted that A. stephensi is highly susceptible to P. berghei. In contrast, P. falciparum infection
of its anopheline vectors gives substantially lower oocyst numbers,
which could have implications for the role of PfCHT1 in mosquito infection.
Reductions in infectivity were observed both in the presence of a PM
(gametocyte feeds) and in its absence (ookinete feeds). Although in the
absence of complementation we cannot rule out the possibility that the
reduced infectivity is the result of pleiotropic effects, the findings
suggests that PbCHT1 plays a role other than PM disruption. We cannot
rule out the possibilities that chitin is present in the
microvillus-associated network or the epithelial cells themselves and
that chitinase activity is required to allow ookinete egress from these
tissues. In this respect, it should be noted that chitin precursors are
synthesized by epithelial cells and must traverse the
microvillus-associated network to form the mature PM. Experiments are
in progress to investigate these hypotheses.
Our data appear to conflict with previous chitinase inhibitor studies
conducted with P. gallinaceum and P. falciparum
in A. aegypti and A. freeborni mosquitoes,
respectively, which did not indicate a role for Plasmodium
chitinases downstream of PM disruption (10). In those
experiments, however, transmission in the absence of a PM was achieved
not by conducting ookinete feeds but instead by adding exogenous
Streptomyces griseus chitinase to the blood meal, thereby
preventing PM formation. Clearly, it is conceivable that the S. griseus chitinase may also have affected potential chitin
integrity in other midgut tissues. Moreover, there may be substantial
differences in chitin composition or deposition between these mosquito
species and A. stephensi. Thus, we cannot truly compare
those experiments with ours.
Allosamidin is a chitin-like metabolite that inhibits numerous
chitinase enzymes with different efficacies by binding to the active
site (12). Although it is known that allosamidin does not
universally inhibit chitinase enzymes (for example, S. griseus chitinase is not inhibited [10]), it was
surprising to discover that PbCHT1, the ortholog of the efficiently
inhibited PgCHT1, was insensitive in our assay (Fig. 5A). It is known
that single amino acid replacements can alter substrate specificity and
enable catalytic turnover of compounds that previously strongly
inhibited enzyme activity (2). Modeling the homologous
Plasmodium chitinases on the atomic structure of the related
bacterial chitinase SmChiA (Fig. 1) highlights a number of candidate
residue replacements that may elicit such an effect. Notable among
these is a unique Lys366Pro replacement, which occurs adjacent to the
predicted catalytic Glu367 residue in PbCHT1. This substitution would
significantly alter the orientation of the catalytic residue in the
active site, which could change the specificity for allosamidin; future
site-directed mutagenesis studies are needed to verify this hypothesis.
In any event, these findings may have implications for the long-term use of allosamidin or compounds like it as malaria
transmission-blocking drugs. The natural allelic variation of P. falciparum chitinase enzymes is unknown, and under selective
pressure by allosamidin, alleles containing enabling mutations could
rise to a high frequency in human malaria. Moreover, simple mutations
that render the enzymes insensitive to the inhibitor could arise and be
selected for.
 |
ACKNOWLEDGMENTS |
We thank Meiji Arai for help with the photography.
This work was supported by a grant from the European Union TMR program.
C.C. was supported by a grant from the NHMRC, Canberra, Australian
Capital Territory, Australia. E. K. was supported by a
grant from the Islamic Development Bank Merit Scholarship Program in
High Technology, Jeddah, Saudi Arabia.
 |
ADDENDUM IN PROOF |
As this paper was going to press, a highly conserved sequence
orthologous to PbCHT1 appeared in the P. yoelii
database accessible through The Institute for Genomic Research website
(www.tigr.org). This sequencing program is carried on in collaboration
with the Naval Medical Research Center and is supported by the U.S.
Department of Defense. At this time, no other chitinase genes in this
genome have been identified.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biology, Imperial College of Science, Technology, and Medicine, Sir
Alexander Fleming Building, Imperial College Rd., London SW7 2AZ,
United Kingdom. Phone: 44 20 75945350. Fax: 44 20 75945424. E-mail: j.dessens{at}ic.ac.uk.
Editor:
W. A. Petri Jr.
 |
REFERENCES |
| 1.
|
Berner, R.,
W. Rudin, and H. Hecker.
1983.
Peritrophic membranes and protease activity in the midgut of the malaria mosquito, Anopheles stephensi (Liston) (Insecta: Diptera), under normal and experimental conditions.
J. Ultrastruct. Res.
83:195-204[CrossRef][Medline].
|
| 2.
|
Claudianos, C.,
R. J. Russell, and J. G. Oakeshott.
1999.
The same amino acid substitution in orthologous esterases confers organophosphate resistance on the house fly and a blowfly.
Insect Biochem. Mol. Biol.
29:675-686[CrossRef][Medline].
|
| 3.
|
Dessens, J. T.,
A. L. Beetsma,
G. Dimopoulos,
K. Wengelnik,
A. Crisanti,
F. C. Kafatos, and R. E. Sinden.
1999.
CTRP is essential for mosquito infection by malaria ookinetes.
EMBO J.
18:6221-6227[CrossRef][Medline].
|
| 4.
|
Dessens, J. T.,
G. Margos,
M. C. Rodriguez, and R. E. Sinden.
2000.
Identification of differentially regulated genes of Plasmodium by suppression subtractive hybridization.
Parasitol. Today
16:354-356[CrossRef][Medline].
|
| 5.
|
Escott, G. M., and D. J. Adams.
1995.
Chitinase activity in human serum and leukocytes.
Infect. Immun.
63:4770-4773[Abstract].
|
| 6.
|
Huber, M.,
E. Cabib, and L. H. Miller.
1991.
Malaria parasite chitinase and penetration of the mosquito peritrophic membrane.
Proc. Natl. Acad. Sci. USA
88:2807-2810[Abstract/Free Full Text].
|
| 7.
|
Langer, R. C.,
R. E. Hayward,
T. Tsuboi,
M. Tachibana,
M. Torii, and J. M. Vinetz.
2000.
Micronemal transport of Plasmodium ookinete chitinases to the electron-dense area of the apical complex for extracellular secretion.
Infect. Immun.
68:6461-6465[Abstract/Free Full Text].
|
| 8.
|
Perrakis, A.,
I. Tews,
Z. Dauter,
A. B. Oppenheim,
I. Chet,
K. S. Wilson, and C. E. Vorgias.
1994.
Crystal structure of a bacterial chitinase at 2.3 Å resolution.
Structure
2:1169-1180[Medline].
|
| 9.
|
Rodriguez, M. C.,
P. Gerold,
J. Dessens,
K. Kurtenbach,
R. T. Schwartz,
R. E. Sinden, and G. Margos.
2000.
Characterisation and expression of Pbs25, a sexual and sporogonic stage specific protein of Plasmodium berghei.
Mol. Biochem. Parasitol.
110:147-159[CrossRef][Medline].
|
| 10.
|
Shahabuddin, M.,
T. Toyoshima,
M. Aikawa, and D. C. Kaslow.
1993.
Transmission-blocking activity of a chitinase inhibitor and activation of malarial parasite chitinase by mosquito protease.
Proc. Natl. Acad. Sci. USA
90:4266-4270[Abstract/Free Full Text].
|
| 11.
|
Sinden, R. E.
1997.
Infection of mosquitoes with rodent malaria, p. 261-267.
In
J. M. Crampton, C. B. Beard, and C. Louis (ed.), The molecular biology of insect disease vectors. Chapman & Hall, London, United Kingdom.
|
| 12.
|
Spindler, K. D., and M. Spindler-Barth.
1999.
Inhibitors of chitinases.
EXS
87:201-209[Medline].
|
| 13.
|
Van Dijk, M. R.,
A. P. Waters, and C. J. Janse.
1995.
Stable transfection of malaria parasite blood stages.
Science
268:1358-1362[Abstract/Free Full Text].
|
| 14.
|
Vinetz, J. M.,
S. K. Dave,
C. A. Specht,
K. A. Brameld,
B. Xu,
R. Hayward, and D. A. Fidock.
1999.
The chitinase PfCHT1 from the human malaria parasite Plasmodium falciparum lacks proenzyme and chitin-binding domains and displays unique substrate preferences.
Proc. Natl. Acad. Sci. USA
96:14061-14066[Abstract/Free Full Text].
|
| 15.
|
Vinetz, J. M.,
J. G. Valenzuela,
C. A. Specht,
L. Aravind,
R. C. Langer,
J. M. Ribeiro, and D. C. Kaslow.
2000.
Chitinases of the avian malaria parasite Plasmodium gallinaceum, a class of enzymes necessary for parasite invasion of the mosquito midgut.
J. Biol. Chem.
14:10331-10341.
|
| 16.
|
Waters, A. P.,
A. W. Thomas,
M. R. van Dijk, and C. J. Janse.
1997.
Transfection of malaria parasites.
Methods
13:134-147[CrossRef][Medline].
|
| 17.
|
Wright, K. A.
1969.
The anatomy of salivary glands of Anopheles stephensi Liston.
Can. J. Zool.
47:579-587.
|
| 18.
|
Zieler, H.,
C. F. Garon,
E. R. Fischer, and M. Shahabuddin.
2000.
A. tubular network associated with the brush-border surface of the Aedes aegypti midgut: implications for pathogen transmission by mosquitoes.
J. Exp. Biol.
203:1599-1611[Abstract].
|
Infection and Immunity, June 2001, p. 4041-4047, Vol. 69, No. 6
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.6.4041-4047.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tremp, A. Z., Khater, E. I., Dessens, J. T.
(2008). IMC1b Is a Putative Membrane Skeleton Protein Involved in Cell Shape, Mechanical Strength, Motility, and Infectivity of Malaria Ookinetes. J. Biol. Chem.
283: 27604-27611
[Abstract]
[Full Text]
-
Kadota, K., Ishino, T., Matsuyama, T., Chinzei, Y., Yuda, M.
(2004). From The Cover: Essential role of membrane-attack protein in malarial transmission to mosquito host. Proc. Natl. Acad. Sci. USA
101: 16310-16315
[Abstract]
[Full Text]
-
Zhu, Z., Zheng, T., Homer, R. J., Kim, Y.-K., Chen, N. Y., Cohn, L., Hamid, Q., Elias, J. A.
(2004). Acidic Mammalian Chitinase in Asthmatic Th2 Inflammation and IL-13 Pathway Activation. Science
304: 1678-1682
[Abstract]
[Full Text]
-
Langer, R. C., Li, F., Popov, V., Kurosky, A., Vinetz, J. M.
(2002). Monoclonal Antibody against the Plasmodium falciparum Chitinase, PfCHT1, Recognizes a Malaria Transmission-Blocking Epitope in Plasmodium gallinaceum Ookinetes Unrelated to the Chitinase PgCHT1. Infect. Immun.
70: 1581-1590
[Abstract]
[Full Text]
-
Langer, R. C., Li, F., Vinetz, J. M.
(2002). Identification of Novel Plasmodium gallinaceum Zygote- and Ookinete-Expressed Proteins as Targets for Blocking Malaria Transmission. Infect. Immun.
70: 102-106
[Abstract]
[Full Text]