Previous Article | Next Article 
Infection and Immunity, June 2001, p. 4079-4085, Vol. 69, No. 6
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.6.4079-4085.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Anaerobic Conditions Induce Expression of
Polysaccharide Intercellular Adhesin in Staphylococcus
aureus and Staphylococcus epidermidis
Sarah E.
Cramton,1
Martina
Ulrich,2
Friedrich
Götz,1 and
Gerd
Döring2,*
Department of Microbial
Genetics1 and Department of General and
Environmental Hygiene, Hygiene Institute,2
University of Tübingen, Tübingen, Germany
Received 27 November 2000/Returned for modification 12 February
2001/Accepted 2 March 2001
 |
ABSTRACT |
Products of the intercellular adhesion (ica) operon
in Staphylococcus aureus and Staphylococcus
epidermidis synthesize a linear
-1,6-linked
glucosaminylglycan. This extracellular polysaccharide mediates
bacterial cell-cell adhesion and is required for biofilm formation,
which is thought to increase the virulence of both pathogens in
association with prosthetic biomedical implants. The environmental
signal(s) that triggers ica gene product and polysaccharide expression is unknown. Here we demonstrate that anaerobic in vitro growth conditions lead to increased polysaccharide expression in both S. aureus and S.
epidermidis, although the regulation is less stringent in
S. epidermidis. Anaerobiosis also dramatically
stimulates ica-specific mRNA expression in
ica- and polysaccharide-positive strains
of both S. aureus and S. epidermidis. These data suggest a mechanism whereby ica gene
expression and polysaccharide production may act as a virulence factor
in an anaerobic environment in vivo.
 |
INTRODUCTION |
Staphylococci cause a wide
range of diseases in animals and humans (17). The
virulence of the two major opportunistic pathogens of this genus,
Staphylococcus epidermidis and Staphylococcus
aureus, is multifactorial and mediated, particularly in S. aureus, by a variety of extracellular toxins and surface
structures (2). In general, bacterial virulence is thought
to be regulated by environmental signals to which the bacteria respond
via global gene regulators, thereby adapting their phenotypes
accordingly (21). Thus, typical staphylococcal infections
such as endocarditis, meningitis, osteomyelitis, postoperative wound
infections, and chronic lung infections may each involve different sets
of virulence factors due to different environmental conditions.
Similarly, in vitro gene expression by bacterial pathogens may not
necessarily reflect in vivo gene expression (13).
Recently, it was shown that S. aureus strains expressing
capsular polysaccharide type 5 (CP5) in vitro but not in vivo produce another polysaccharide in infected airways of cystic fibrosis (CF)
patients, consisting of poly-N-succinyl-
-1,6-glucosamine (PNSG) (20). PNSG is synthesized by products of the
intercellular adhesion (ica) gene locus in S. aureus (7, 20), which was previously identified in
S. epidermidis (12) and whose presence in other
closely related species such as Staphylococcus auricularis and Staphylococcus capitis was inferred (7).
Products of the ica locus in S. epidermidis also
produce the polysaccharide intercellular adhesin (PIA). PIA production
leads to cell-cell adhesion and is required for biofilm formation
(11). This polysaccharide was identified as a linear
-1,6-linked N-acetylglucosaminoglycan (18,
19). Antibodies raised against S. epidermidis PIA or S. aureus PNSG recognize both antigens. We use a polyclonal
antibody raised against S. epidermidis PIA in this work;
however, where the exact nature of the polysaccharide is not known, we
use the term "PIA/PNSG" to refer to the polysaccharide(s)
synthesized by gene products of the ica locus in either
S. epidermidis or S. aureus.
The ica operon (icaADBC) consists of four open
reading frames, with a putative regulatory gene (icaR)
located upstream and in the opposite orientation. In an in vitro assay,
it was shown that IcaA and IcaD together synthesize sugar oligomers
using UDP-N-acetylglucosamine as a substrate. This
N-acetylglucosaminyltransferase activity together with the
activity of IcaC produces a product in vitro that is recognized by an
antibody raised against S. epidermidis PIA (9).
Isogenic mutants of wild-type biofilm-forming strains in which the
ica locus has been mutated or deleted are no longer able to
form a biofilm in vitro, demonstrating that the ica genes, and therefore PIA/PNSG production, are required for biofilm formation (7, 11, 12).
Biofilm formation is a major concern in nosocomial infections because
it protects microorganisms from opsonophagocytosis and antibiotic
agents, leading to chronic infection and sepsis, particularly in
immunocompromised patients (6). The contribution of
PIA/PNSG to the virulence of S. epidermidis has been
repeatedly demonstrated (24-26, 31); however, the
environmental signals which mediate PIA/PNSG expression are at present unknown.
Recently, we provided evidence that the partial pressure of oxygen in
airway plugs of CF patients was <4% that of intraluminal air (D. Worlitzsch, K. C. Meyer, P. Birrer, and G. Döring, Pediatr. Pulmonol., abstr. A457, p. 333, 1998). Since we also observed PNSG
expression in the S. aureus-infected CF lung
(20), the objective of the present study was to
investigate the impact of anaerobiosis on PIA/PNSG expression in
S. epidermidis and S. aureus. Here we show that
PIA/PNSG expression is indeed induced by anaerobic growth conditions
and that ica gene transcription is regulated by
environmental oxygen.
 |
MATERIALS AND METHODS |
Staphylococcal strains and plasmids.
The strains used in
this study are listed in Table 1. The
ica deletion mutant of S. aureus ATCC 35556 was
described previously (7). The S. epidermidis
O-47 ica deletion mutant was constructed in a similar
manner, replacing the entire ica operon
(icaR-icaC) with a tetracycline resistance cassette. The
S. epidermidis strain ATCC 35984 (RP62A) ica
locus and surrounding DNA were amplified using PCR and primers CG-28
(CCGGATCCATTGAATAATCATGAAATAATGTC) and SR-1
(CGGGATCCGAGAAAAATTTCATTTTAAAATAAAC) and cloned into the
SmaI site of temperature-sensitive shuttle vector pBT5, a derivative of pBT2 lacking the EcoRI restriction site in the
multiple cloning site (4), creating plasmid pSC1. The
ica locus was deleted using pSC1, inverse PCR, and primers
CG-7 (CTAGAGCTCTAGACCTTTCGTTAGTTAGGTTGT) and SR-2
(CGGAATTCACGCGTCACCTGTCATGTATCTCACTCC) and replaced with the
tetracycline resistance cassette from pT181, amplified using primers
tet-4 (CTCGAATTCGCCAGTCGATTTAACGGAC) and tet-5
(CTCGAATTCGAGTGGCAAAATGCTAGCCAC) and restriction enzyme
EcoRI, creating plasmid pSC12. Primers were obtained from
MWG-Biotech (Ebersberg, Germany). PCR amplifications were performed
using a MiniCycler PTC-150 (MJ Research, Inc., Watertown, Mass.).
Homologous recombination was performed using wild-type S. epidermidis strain O-47 containing plasmid pSC12. Bacteria were
grown overnight in B medium (1% tryptone [Gibco BRL-Life Technologies
GmbH, Eggenstein, Germany], 0.5% yeast extract [Gibco BRL], 0.5%
NaCl, 0.1% K2HPO4, 0.1%
glucose) at 30°C with 10 µg of chloramphenicol/ml, diluted 1:1,000,
and grown again at 30°C with antibiotic selection; diluted 1:1,000
and grown at 41°C without antibiotic selection twice; and diluted
1:100 and plated on tryptic soy broth (TSB) (Gibco BRL) plates
containing 2.5 µg of tetracycline/ml. Homologous recombination and
plasmid curing of chloramphenicol-sensitive, tetracycline-resistant
colonies were then confirmed with PCR and detection for loss of
PIA/PNSG expression. The strain listed in Table 1 as ATCC 10832 is not the same as the strain with the same name used in our previous study
(7). Strain SE05 was isolated in association with a
central venous catheter removed from a patient in the intensive care
unit of the University Hospital, Tübingen, Germany, in January
2000.
Aerobic and anaerobic growth.
Bacterial strains were
cultured in either TSB supplemented with 0.25% glucose (TSB plus Glc)
or CYPG medium (23) supplemented with 2% glucose (CYPG
plus Glc) and supplemented when appropriate with tetracycline (10 µg/ml), chloramphenicol (10 µg/ml), or erythromycin (10 µg/ml).
Bacteria were incubated with shaking under both aerobic and anaerobic
conditions in 250-ml Erlenmeyer flasks containing 100 ml of TSB plus
Glc. Anaerobic conditions were created by bubbling filtered helium gas
through the medium for 10 min following inoculation. Flasks were then
immediately sealed such that no air could enter the flask during
incubation. The airtight seal consisted of a silicone stopper pierced
with two glass pipettes, one of which (gas inlet) was submerged in the
medium. Attached to the outside end of each glass pipette was a piece
of flexible tubing that could be attached to the helium gas tank and
clamped to seal the flask after gassing. Alternatively, overnight
cultures of staphylococcal strains grown in CYPG plus Glc were
harvested and diluted in CYPG plus Glc to an optical density at 600 nm
(OD600) of 0.05 and incubated under aerobic
conditions (with shaking) and anaerobic conditions (without shaking) in
glass tubes or microtiter plates (Becton Dickinson, Heidelberg,
Germany) for up to 96 h. For anaerobic growth, glass tubes were
placed in an anaerobic jar with Anaerocult A (Merck Eurolab GmbH,
Darmstadt, Germany), whereas polystyrol 96-well microtiter plates were
sealed with adhesive tape. Anaerobiosis in both of our experimental
systems was confirmed using Anaerotest test strips (Merck). PIA/PNSG
production and biofilm formation were also tested under controlled (3%
O2, 1% CO2, 96%
N2) conditions in a shaking gassed BB6060
incubator (Heraeus, Stuttgart, Germany); however, these conditions were
apparently not anaerobic enough, and little difference was seen from
cultures incubated in the presence of ambient air. Bacterial growth was
determined by measuring CFU on blood agar plates and/or determining
OD578.
Detection of PIA/PNSG expression and biofilm formation in
vitro.
Biofilm assays and semiquantitative PIA/PNSG detection
using cell surface extracts were performed as described previously (7, 11, 12). Briefly, cell surface extracts were prepared by growing cells overnight (14 to 18 h) or to an
OD578 of 2.0 in TSB plus Glc, the optical density
was determined, and an equal number of cells (typically 2 to 4 ml) from
each culture was resuspended in 50 µl of 0.5 M EDTA, pH 8.0. Cells
were then incubated for 5 min at 100°C and centrifuged to pellet the
cells, and 40 µl of the supernatant was incubated with 10 µl of
20-mg/ml proteinase K (Boehringer GmbH, Mannheim, Germany) for 30 min
at 37°C to minimize nonspecific background. The extracts were then
spotted onto a nitrocellulose membrane, and the membrane was dried,
blocked with 3% bovine serum albumin, and incubated with an
anti-S. epidermidis PIA antibody (diluted 1:5,000) (kind
gift of D. Mack, Hamburg, Germany). Anti-PIA antibodies were detected
using an alkaline phosphatase-conjugated anti-rabbit immunoglobulin
(IgG) antibody (Boehringer) and the 4-nitroblue tetrazolium
chloride-5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP) color
detection system (Boehringer).
Biofilm assays were performed as follows. Bacteria were grown overnight
in TSB plus Glc. Cultures were then diluted 1:200
in fresh medium and
incubated overnight in stationary U-bottomed-well
polystyrol microtiter
plates (Greiner Labortechnik, Frickenhausen,
Germany) at 37°C.
Microtiter wells were washed twice with phosphate-buffered
saline (PBS)
(7 mM Na
2HPO
4, 3 mM
NaH
2PO
4, 130 mM NaCl, pH
7.4),
dried in an inverted position, and stained with 0.1% safranin
(Serva Feinbiochemica GmbH & Co. KG, Heidelberg,
Germany).
PIA/PNSG expression in CYPG plus Glc was determined using indirect
immunofluorescence microscopy. Briefly, liquid cultures
were washed
three times with PBS (pH 7.2) containing 0.05% Tween
20. Bacteria were
harvested by centrifugation (5,000 ×
g) and
resuspended in 5 ml of PBS. A drop of the suspension was transferred
to
a glass slide (Becton Dickinson). Samples on glass slides were
fixed
with 4% formaldehyde for 1 h at 4°C, and nonspecific binding
sites were blocked with 5% human IgG (Sigma, Deisenhofen, Germany).
Thereafter, slides were incubated with a rabbit antibody raised
against
S. epidermidis PIA (diluted 1:200) or a polyclonal rabbit
antibody raised against
S. aureus PNSG (diluted 1:50) (kind
gift
of G. Pier, Boston, Mass.) for 1 h at room temperature. After
washing with PBS, bound antibody was detected with indocarbocyanin
3 (Cy3)-conjugated goat anti-rabbit IgG (Jackson Dianova, Hamburg,
Germany) and analyzed using an Axioplan fluorescence microscope
(Zeiss,
Oberkochen, Germany) and a Kontron KS 300 imaging system
(Kontron
Electronic GmbH, Eching, Germany). Results obtained with
both
antibodies were identical. Data shown were obtained using
the anti-PIA
antibody
only.
In order to observe biofilm formation over time as detected with the
anti-PIA antibody, bacteria were grown in CYPG plus Glc
in stationary
microtiter plates and enzyme-linked immunosorbent
assays (ELISAs) were
performed. Briefly, microtiter plates were
washed gently three times
with PBS (pH 7.2), air dried, fixed
with formaldehyde, and blocked with
human IgG. The plates were
incubated with rabbit anti-
S.
epidermidis PIA antibody for 2 h
at 37°C, washed, and
incubated with horseradish peroxidase-conjugated
anti-rabbit IgG
antibody (diluted 1:250) (Dako, Hamburg, Germany)
for 2 h at
37°C, followed by an incubation with the substrate
(Sigma). After 40 min, OD
450s were measured using an ELISA plate
reader (SLT Lab Instruments, Crailsheim, Germany). Each assay
was
performed in
triplicate.
RNA extraction and detection.
S. aureus cultures
were grown to an OD578 of 2.0 in TSB plus Glc.
Generally, anaerobic cultures grown overnight (14 to 18 h) reached
an OD578 of approximately 2.0, and aerobic
cultures were grown for several hours until an
OD578 of 2.0 was reached. Approximately
1010 cells were harvested by centrifugation and
washed with 0.5 volume of cold 0.5 M EDTA. S. aureus cell
pellets were then resuspended in 1 ml of 0.5-mg/ml lysostaphin
(Sigma-Aldrich Chemie GmbH, Deisenhofen, Germany) and incubated for 3 min at 37°C. S. epidermidis cells were resuspended in cold
0.5 M EDTA and disrupted using glass beads and vortexing. RNA was then
prepared using the RNeasy Midi kit (Qiagen GmbH, Hilden, Germany) as
recommended by the manufacturer. RNA yield was measured by
OD260, and the relative concentration between
samples was confirmed by visual inspection of rRNA in samples run on an
agarose gel and stained with ethidium bromide. Three micrograms of
total RNA from each sample was then applied to a nylon membrane
(Boehringer) using a dot blotting apparatus (Bio-Rad Laboratories,
Munich, Germany). Filters were hybridized at 50°C using DIG
(digoxigenin) Easy Hyb solution (Boehringer) and an
ica-specific DNA probe. Filters were washed in 0.1× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.1% sodium dodecyl sulfate at 68°C and exposed to X-ray film after detection using the DIG luminescent detection kit (Boehringer). The DIG-labeled probes were made by using PCR, DIG-labeled nucleotide labeling mix
(Boehringer), and the Expand Long Template PCR system (Boehringer) as
recommended by the manufacturer. Amplified DNA included sequences within the coding regions from the beginning of icaA to the
end of icaC and was amplified using primers SA9
(GTATTTATGTCTATTTACTGGATTGTCGGTTC) and SA6
(GTAGTGATATCGCTAGAAAGCCATTGT) for S. aureus and
primers SE1 (GTCAATTTACTGGATAGTAGGATCGATTTAC) and SE2
(AGTTAGGCTGGTATTGGTCAAATTGTAACT) for S. epidermidis.
 |
RESULTS |
Construction of an ica deletion-replacement mutant
in S. epidermidis.
An ica
deletion-replacement mutant was constructed in wild-type
biofilm-forming S. aureus strain ATCC 35556 and was
described previously (7). An S. epidermidis ica
deletion-replacement mutant was constructed on a plasmid in a similar
manner, replacing the entire ica operon
(icaRADBC) with a tetracycline resistance cassette. The
chromosomal copy of the ica operon was replaced by
homologous recombination. A schematic representation of the cloning
strategy is shown in Fig. 1 and described
in more detail in Materials and Methods.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of cloning strategy used to
construct the ica deletion-replacement mutant of
S. epidermidis. A similar strategy was used to construct
the ica deletion-replacement mutant of S.
aureus, described in reference 7. (A) Plasmid
pSC1. Sequences including and surrounding the ica locus
are included in database entry U43366. Sequences including and
surrounding the geh1 gene are included in database entry
AF053006. PCR primers used to amplify cloned DNA are indicated (CG-28
and SR-1). (B) Plasmid pSC12, the deletion-replacement construct used
for homologous recombination. Inverse PCR primers used to delete the
ica locus (CG-7 and SR-2) and amplify the tetracycline
resistance cassette (tet4 and tet5) are indicated. EcoRI
restriction recognition sites contained within the sequences of primers
SR-2, tet-4, and tet-5 and the EcoRI restriction site in
the middle of icaR were used to insert the tetracycline
resistance cassette. Deleted sequence numbers refer to database
sequence U43366.
|
|
PIA/PNSG expression is increased in vitro under anaerobic growth
conditions
We tested a number of wild-type strains
of S. aureus and S. epidermidis and
isogenic deletion mutants lacking the ica gene locus for
PIA/PNSG production and biofilm formation under aerobic and anaerobic
growth conditions in liquid cultures and in polystyrene microtiter
plates, respectively, using a polyclonal antibody raised against
S. epidermidis PIA (7, 12). In contrast to
aerobic growth conditions, anaerobiosis strongly stimulated PIA/PNSG
production in ica-positive wild-type strains of
S. aureus and S. epidermidis, whereas
isogenic ica deletion mutant strains remained PIA/PNSG negative (Fig. 2). As shown in Fig. 2A,
for S. aureus ATCC 35556 grown in CYPG medium
supplemented with 2% glucose (CYPG plus Glc) for 96 h, PIA/PNSG
expression was detectable only under anaerobic conditions. When cell
surface extracts from bacteria grown overnight in TSB supplemented with
0.25% glucose (TSB plus Glc) were examined, PIA/PNSG expression was
much stronger in cultures grown under anaerobic conditions (Fig. 2C).
In contrast to S. aureus, S. epidermidis O-47 expressed PIA/PNSG under both aerobic and anaerobic conditions in
CYPG plus Glc after 96 h; however, the expression was much stronger under anaerobic conditions (Fig. 2B). The difference between
aerobic and anaerobic expression of PIA/PNSG in cell surface extracts
was more dramatic after overnight growth in TSB plus Glc (Fig. 2D).
Since PIA/PNSG is required for biofilm formation, we measured biofilm
formation over time using an anti-PIA antibody during S.
aureus and S. epidermidis growth. Biofilm was
formed by S. aureus only under anaerobic conditions
(Fig. 3A). In contrast to S.
aureus, S. epidermidis produced biofilm under both aerobic and
anaerobic conditions; however PIA/PNSG was detectable significantly earlier under anaerobic conditions (Fig. 3B). These data suggest that
PIA/PNSG production in S. epidermidis is less
stringently regulated by oxygen than in S. aureus and
that the amount of PIA/PNSG produced under the aerobic conditions used
in this in vitro system is sufficient to mediate biofilm formation.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 2.
Increased expression of PIA/PNSG under anaerobic
conditions in S. aureus and S.
epidermidis in vitro. The ica-positive S.
aureus strain ATCC 35556 (A), an isogenic
ica-deletion mutant (ATCC
35556 ica::tet) (E), the
ica-positive S. epidermidis strain O-47
(B), and an isogenic ica transposon mutant
(O-47ica::Tn917) (F) were grown
under aerobic (+) and anaerobic ( ) conditions for 96 h in CYPG
plus Glc. PIA/PNSG expression was detected by indirect
immunofluorescence using rabbit antibodies raised against S.
epidermidis PIA and a Cy3-conjugated goat anti-rabbit IgG
antibody. Magnifications for panels A, B, E, and F, ×1,000; bar = 10 µm. Cell surface extracts from S. aureus (C and G)
and S. epidermidis (D and H) wild type and isogenic
deletion mutants, grown overnight (14 to 18 h) under aerobic or
anaerobic conditions in TSB plus Glc, were spotted on nitrocellulose
filters, and PIA/PNSG was detected using the same anti-S.
epidermidis PIA antibody used for panels A, B, E, and F.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Biofilm formation under aerobic and anaerobic
conditions. The same S. aureus (A) and S.
epidermidis (B) wild-type strains shown in Fig. 2 were grown
under aerobic and anaerobic conditions in CYPG plus Glc for up to
24 h in microtiter plates, and biofilm formation was quantified
using the S. epidermidis anti-PIA antibody. The growth
rate of the strains was determined independently by measuring the
OD600 in liquid culture.
|
|
Increased PIA/PNSG expression under anaerobic conditions is a
general phenomenon.
We examined PIA/PNSG expression in three
representative strains from each species under aerobic and anaerobic
conditions. Each of the six strains carries the ica locus
(data not shown), expresses PIA/PNSG, and forms a strong in vitro
biofilm. The results confirmed that PIA/PNSG production is stimulated
by anaerobic growth conditions in multiple representatives of each
species (Fig. 4). PIA/PNSG production
seems to be very sensitive to the presence of oxygen. Experiments
performed in an incubator with a controlled (3% oxygen) environment
compared to parallel cultures grown in an incubator with ambient air
showed only minimal differences in PIA/PNSG production. In addition,
increased CO2 concentrations (1%) in the same
experiments did not affect PIA/PNSG expression (data not shown).

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 4.
PIA/PNSG expression is stimulated under anaerobic
conditions in six S. aureus and S.
epidermidis biofilm-forming strains. Three S.
aureus and three S. epidermidis biofilm-forming
strains were grown under both aerobic (+) and anaerobic ( ) conditions
to early stationary phase (14 to 18 h) in TSB plus Glc. PIA/PNSG
expression (PIA/PNSG) was detected in cell surface extracts isolated
from an equal number of cells from each strain using an antibody raised
against S. epidermidis PIA. Biofilm formation in a
microtiter plate well is shown for each strain (Biofilm). Adhering
cells are stained with safranin (red color) to facilitate visualization
of the biofilm.
|
|
Increased PIA/PNSG expression levels reflect increased RNA levels
under anaerobic conditions in vitro.
Total RNA was extracted from
S. aureus strain ATCC 35556, S. epidermidis
strain O-47, and their respective isogenic ica deletion mutants grown under both aerobic and anaerobic conditions. Low levels
of ica-specific transcripts were detected in wild-type cells
of both species grown under aerobic conditions; however, much stronger
expression was detected in bacteria grown under anaerobic conditions.
This increase was reflected in the expression of PIA/PNSG in cell
surface extracts prepared from the same cultures (Fig.
5). The relative level of PIA/PNSG
expression between aerobic and anaerobic conditions in this S. epidermidis strain was less dramatic under these conditions (both
cultures were grown to an OD578 of 2) than when
both cultures were allowed to grow to stationary phase (Fig. 2D). RNA
levels, however, were dramatically different, suggesting a further
layer of regulation of PIA/PNSG production.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
Increased PIA/PNSG expression under anaerobic conditions
correlates with ica operon transcript levels in
S. aureus and S. epidermidis. Cell
surface extracts from S. aureus ATCC 35556, S.
epidermidis O-47, and their respective isogenic
ica deletion mutants were grown to an OD578
of 2.0 under aerobic (+) or anaerobic ( ) conditions in TSB plus Glc.
Cell surface extracts from an equal number of cells from each strain
were spotted onto a nitrocellulose filter, and PIA/PNSG was detected
using a polyclonal anti-S. epidermidis PIA antibody
(PIA/PNSG). RNA was extracted from cells from the same cultures,
spotted onto a nylon filter, and hybridized with an
ica-specific DNA probe (RNA).
|
|
 |
DISCUSSION |
Bacterial biofilm formation is of major concern in association
with indwelling medical devices, since the biofilm provides bacteria
with considerable resistance to host defenses and antimicrobial agents
(6, 10). Single bacterial cells can be easily eliminated by macrophages or neutrophils in the healthy host; however, bacterial colonies enclosed in a self-produced polymeric sugar matrix are far
more resistant to oxygen radicals and phagocytosis. Consequently, as
has been shown using S. epidermidis in animal models, the
virulence of S. epidermidis strains that produce
polysaccharide is greater than that of polysaccharide-negative S. epidermidis strains (25, 26, 28). The self-produced
extracellular polysaccharide that forms a matrix around the bacteria
may impair the penetration of antimicrobial agents. Once a biofilm has
formed, the low metabolic rate of the bacteria may also limit the
effectiveness of antibiotics that require active cell division and
active metabolism (15).
Until recently, little has been known about the ability of S. aureus to form a biofilm. Unlike clinical isolates of
Pseudomonas aeruginosa from patients with CF (reviewed in
reference 8), S. aureus produces very little
PIA/PNSG in vitro on culture plates but produces predominantly
polysaccharide microcapsules of type 5 or 8 (1, 14, 27,
29). Due to this in vitro phenotype, most investigators have
thought that S. aureus would also express CP5 or CP8 during
infections in animals or humans. Only recently was it shown that CP5
expression is in fact reduced in the lungs of CF patients
(13) and that PNSG expression is increased
(20). Apparently, PNSG production by S. aureus
is not restricted to the airways of patients with CF, because the
polysaccharide was also detected in a mouse renal infection model using
immunoelectron microscopy and ELISA (20).
Altogether, although both S. epidermidis and S. aureus are now known to produce PIA/PNSG in vivo during human and
animal infections, little is known about the environmental factor(s)
that triggers this expression. Here, we provide evidence that at least
one environmental stimulus responsible for increased PIA/PNSG
expression is lack of oxygen. This notion is based on our findings
showing that in vitro anaerobic growth conditions trigger increased
ica gene transcription and PIA/PNSG expression by S. aureus and S. epidermidis strains that carry the
ica gene locus as detected by RNA blotting and specific
antibodies raised against S. epidermidis PIA. This does not
mean that the strains tested produced no polysaccharide product under
aerobic conditions; our data show that production is stimulated under
anaerobic conditions, an increase that may be at least partially attributable to transcriptional regulation.
The anaerobic stimulation of extracellular polysaccharide has been
confirmed using two different types of medium and three different
methods for generating anaerobic conditions. Our assays measured
ica transcription, PIA/PNSG production, and biofilm
formation. Findings by Barker et al. (3), who showed that
undefined coagulase-negative bacteria form biofilms only under aerobic
conditions, may be explained by differences in the organisms tested and
the assay(s) employed.
While some staphylococcal strains are able to form an in vitro biofilm,
others are not (3, 7). We investigated approximately 17 S. epidermidis and 41 S. aureus strains in the
course of this study and found that, for those strains that produce
PIA/PNSG, PIA/PNSG production is stimulated by anaerobic conditions.
PIA/PNSG production was observed in approximately the same proportion
of strains as reported by McKenney et al. to produce PNSG (reference 20 and data not shown). This does not necessarily mean
that apparently PIA/PNSG-negative strains produce no PIA/PNSG or
PIA/PNSG-like product(s), however. Support for this idea stems from our
observation that a few biofilm-positive strains transcribe
ica-specific RNA but produce no detectable PIA/PNSG (data
not shown). Although the ica locus appears to be transcribed
in these strains, the encoded Ica proteins may not be translated or may
contain mutations or truncations that render them unable to produce
mature PIA/PNSG. This would imply that these strains are able to form
in vitro biofilms in a PIA/PNSG-independent manner. This observation is also supported by the finding of Muller et al. (22) that a
few S. epidermidis strains that are able to form a biofilm
apparently produce no polysaccharide. Alternatively, it is possible
that PIA/PNSG is modified, for example, (de)acetylated or
(de)succinylated, in a manner such that our antibody(ies) no longer
recognizes the antigen(s) produced by these strains. The fact that
antibodies raised against S. epidermidis PIA or S. aureus PNSG detect both antigens implies that the chemical
structures of PIA and PNSG are identical or very similar. A direct
structural comparison has not been made to date, and the possibility of
other, perhaps strain-specific, modifications to the glucosamine
backbone cannot be eliminated. Nevertheless, immunological
cross-reactivity was observed in animal experiments where animals
actively immunized with the polysaccharide antigen were protected from
a challenge with S. epidermidis (31) and
S. aureus (20).
In summary, an anaerobic environment stimulates PIA/PNSG production in
both S. aureus and S. epidermidis. Anaerobic
environments may develop in localized infections and stimulate
expression of this virulence factor by both pathogens in vivo. PIA/PNSG
production and biofilm formation pose a considerable risk for the
patient. The elucidation of the molecular mechanism(s) of biofilm
formation may lead to better tools for clinical intervention in the future.
 |
ACKNOWLEDGMENTS |
We are grateful to Dietrich Mack, Hamburg, Germany, for a rabbit
antibody against PIA and Gerald B. Pier for a rabbit antibody against
PNSG. The technical assistance of Ulrike Pfitzner and Mulugeta Nega is
gratefully acknowledged.
S.E.C. was supported in part by NRSA Postdoctoral Fellowship AI09626
from the National Institute of Allergy and Infectious Diseases. This
project was supported in part by the German Bundesministerium für
Bildung, Wissenschaft, Forschung und Technologie (DLR: 01KI9751/1).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
General and Environmental Hygiene, Hygiene Institute, University of
Tübingen, Wilhelmstrasse 31, D-72074 Tübingen, Germany.
Phone: (49) 7071-298-2069. Fax: (49) 7071-29-3011. E-mail:
gerd.doering{at}uni-tuebingen.de.
Editor:
A. D. O'Brien
 |
REFERENCES |
| 1.
|
Albus, A.,
J. M. Fournier,
C. Wolz,
A. Boutonnier,
M. Ranke,
N. Hoiby,
H. Hochkeppel, and G. Döring.
1988.
Staphylococcus aureus capsular types and antibody response to lung infection in patients with cystic fibrosis.
J. Clin. Microbiol.
26:2505-2509[Abstract/Free Full Text].
|
| 2.
|
Arvidson, S.
1983.
Extracellular enzymes from Staphylococcus aureus, p. 745-808.
In
C. S. F. Easmon, and C. Adlam (ed.), Staphylococci and staphylococcal infections. Academic Press, London, United Kingdom.
|
| 3.
|
Barker, L. P.,
W. A. Simpson, and G. D. Christensen.
1990.
Differential production of slime under aerobic and anaerobic conditions.
J. Clin. Microbiol.
28:2578-2579[Abstract/Free Full Text].
|
| 4.
|
Brückner, R.
1997.
Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus.
FEMS Microbiol. Lett.
151:1-8[Medline].
|
| 5.
|
Christensen, G. D.,
A. L. Bisno,
J. T. Parisi,
B. McLaughlin,
M. G. H. Ester, and R. W. Luther.
1982.
Nosocomial septicemia due to multiply-resistant Staphylococcus epidermidis.
Ann. Intern. Med.
96:1-10.
|
| 6.
|
Costerton, J. W.,
P. S. Stewart, and E. P. Greenberg.
1999.
Bacterial biofilms: a common cause of persistent infections.
Science
284:1318-1322[Abstract/Free Full Text].
|
| 7.
|
Cramton, S. E.,
C. Gerke,
N. F. Schnell,
W. W. Nichols, and F. Götz.
1999.
The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation.
Infect. Immun.
67:5427-5433[Abstract/Free Full Text].
|
| 8.
|
Döring, G.,
R. Knight, and G. Bellon.
1995.
Immunology of cystic fibrosis, p. 99-129.
In
M. E. Hodson, and G. Geddes (ed.), Cystic fibrosis. Chapman and Hall, London, United Kingdom.
|
| 9.
|
Gerke, C.,
A. Kraft,
R. Süßmuth,
O. Schweitzer, and F. Götz.
1998.
Characterization of the N-acetylglucosaminyltransferase activity involved in the biosynthesis of the Staphylococcus epidermidis polysaccharide intercellular adhesin (PIA).
J. Biol. Chem.
273:18586-18593[Abstract/Free Full Text].
|
| 10.
|
Götz, F., and G. Peters.
2000.
Colonization of medical devices by coagulase-negative staphylococci, p. 55-88.
In
F. A. Waldvogel, and A. L. Bisno (ed.), Infections associated with indwelling medical devices, 3rd ed. ASM Press, Washington, D.C.
|
| 11.
|
Heilmann, C.,
C. Gerke,
F. Perdreau-Remington, and F. Götz.
1996.
Characterization of Tn917 insertion mutants of Staphylococcus epidermidis affected in biofilm formation.
Infect. Immun.
64:277-282[Abstract].
|
| 12.
|
Heilmann, C.,
O. Schweitzer,
C. Gerke,
N. Vanittanakom,
D. Mack, and F. Götz.
1996.
Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis.
Mol. Microbiol.
20:1083-1091[Medline].
|
| 13.
|
Herbert, S.,
D. Worlitzsch,
B. Dassy,
A. Boutonnier,
J. M. Founier,
G. Bellon,
A. Dalhoff, and G. Döring.
1997.
Regulation of Staphylococcus aureus capsular polysaccharide type 5: CO2 inhibition in vitro and in vivo.
J. Infect. Dis.
176:431-438[Medline].
|
| 14.
|
Hochkeppel, H. K.,
D. G. Broun,
W. Vischer,
A. Imm,
S. Sutter,
U. Staeubli,
R. Guggenheim,
E. L. Kaplan,
A. Boutonnier, and J. M. Fournier.
1987.
Serotyping and electron microscopy studies of Staphylococcus aureus clinical isolates with monoclonal antibodies to capsular polysaccharide types 5 and 8.
J. Clin. Microbiol.
25:526-530[Abstract/Free Full Text].
|
| 15.
|
Hoyle, B. D., and J. W. Costerton.
1991.
Bacterial resistance to antibiotics: the role of biofilms.
Prog. Drug Res.
37:91-105[Medline].
|
| 16.
|
Iordanescu, S., and M. Surdeanu.
1976.
Two restriction and modification systems in Staphylococcus aureus NCTC 8325.
J. Gen. Microbiol.
96:277-281[Abstract/Free Full Text].
|
| 17.
|
Lowy, F. D.
1998.
Staphylococcus aureus infections.
N. Engl. J. Med.
339:520-532[Free Full Text].
|
| 18.
|
Mack, D.,
W. Fischer,
A. Krokotsch,
K. Leopold,
R. Hartmann,
H. Egge, and R. Laufs.
1996.
The intercellular adhesin involved in biofilm accumulation of Staphylococcus epidermidis is a linear -1,6-linked glucosaminoglycan: purification and structural analysis.
J. Bacteriol.
178:175-183[Abstract/Free Full Text].
|
| 19.
|
Mack, D.,
M. Haeder,
N. Siemssen, and R. Laufs.
1996.
Association of biofilm production of coagulase-negative staphylococci with expression of a specific polysaccharide intercellular adhesin.
J. Infect. Dis.
174:881-884[Medline].
|
| 20.
|
McKenney, D.,
K. L. Pouliot,
Y. Wang,
V. Murthy,
M. Ulrich,
G. Döring,
J. C. Lee,
D. A. Goldmann, and G. B. Pier.
1999.
Broadly protective vaccine for Staphylococcus aureus based on an in vivo-expressed antigen.
Science
284:1523-1527[Abstract/Free Full Text].
|
| 21.
|
Mekalanos, J. J.
1992.
Environmental signals controlling expression of virulence determinants in bacteria.
J. Bacteriol.
174:1-7[Free Full Text].
|
| 22.
|
Muller, E.,
S. Takeda,
H. Shiro,
D. Goldmann, and G. B. Pier.
1993.
Occurrence of capsular polysaccharide/adhesin among clinical isolates of coagulase-negative staphylococci.
J. Infect. Dis.
168:1211-1218[Medline].
|
| 23.
|
Novick, R. P.
1991.
Genetic systems in staphylococci.
Methods Enzymol.
204:587-636[Medline].
|
| 24.
|
Peters, G.,
R. Locci, and G. Pulverer.
1981.
Microbial colonization of prosthetic devices. II. Scanning electron microscopy of naturally infected intravenous catheters.
Zentbl. Bakteriol. Abt. 1 Orig. B
172:293-299.
|
| 25.
|
Rupp, E. M.,
J. S. Ulphani,
P. D. Fey,
K. Bartscht, and D. Mack.
1999.
Characterization of the importance of polysaccharide intercellular adhesin/hemagglutinin of Staphylococcus epidermidis in the pathogenesis of biomaterial-based infection in a mouse foreign body infection model.
Infect. Immun.
67:2627-2632[Abstract/Free Full Text].
|
| 26.
|
Rupp, E. M.,
J. S. Ulphani,
P. D. Fey, and D. Mack.
1999.
Characterization of Staphylococcus epidermidis polysaccharide intercellular adhesin/hemagglutinin in the pathogenesis of intravascular catheter-associated infection in a rat model.
Infect. Immun.
67:2656-2659[Abstract/Free Full Text].
|
| 27.
|
Ryding, U.,
J. I. Flock,
B. Soderquist, and B. Christensson.
1997.
Expression of collagen-binding protein and types 5 and 8 capsular polysaccharide in clinical isolates of Staphylococcus aureus.
J. Infect. Dis.
176:1096-1099[Medline].
|
| 28.
|
Shiro, H.,
E. Muller,
N. Gutierrez,
S. Boisot,
M. T. T. D. Grout,
D. Goldmann, and G. B. Pier.
1994.
Transposon mutants of Staphylococcus epidermidis deficient in elaboration of capsular polysaccharide/adhesin and slime are avirulent in a rabbit model of endocarditis.
J. Infect. Dis.
169:1042-1049[Medline].
|
| 29.
|
Sompolinsky, D.,
Z. Samra,
W. W. Karakawa,
W. F. Vann,
R. Schneerson, and Z. Malik.
1985.
Encapsulation and capsular types in isolates of Staphylococcus aureus from different sources and relationship to phage types.
J. Clin. Microbiol.
22:828-834[Abstract/Free Full Text].
|
| 30.
|
Sussenbach, J. S.,
C. H. Monfoort,
R. Schiphof, and E. E. Stobberingh.
1976.
A restriction endonuclease from Staphylococcus aureus.
Nucleic Acids Res.
3:3193-3202.
|
| 31.
|
Takeda, S.,
G. B. Pier,
Y. Kojima,
M. Tojo,
E. Muller,
T. Tosteson, and D. A. Goldmann.
1991.
Protection against endocarditis due to Staphylococcus epidermidis by immunization with capsular polysaccharide/adhesin.
Circulation
84:2539-2546[Abstract/Free Full Text].
|
Infection and Immunity, June 2001, p. 4079-4085, Vol. 69, No. 6
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.6.4079-4085.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nuryastuti, T., van der Mei, H. C., Busscher, H. J., Iravati, S., Aman, A. T., Krom, B. P.
(2009). Effect of Cinnamon Oil on icaA Expression and Biofilm Formation by Staphylococcus epidermidis. Appl. Environ. Microbiol.
75: 6850-6855
[Abstract]
[Full Text]
-
Cue, D., Lei, M. G., Luong, T. T., Kuechenmeister, L., Dunman, P. M., O'Donnell, S., Rowe, S., O'Gara, J. P., Lee, C. Y.
(2009). Rbf Promotes Biofilm Formation by Staphylococcus aureus via Repression of icaR, a Negative Regulator of icaADBC. J. Bacteriol.
191: 6363-6373
[Abstract]
[Full Text]
-
Kuehl, R., Al-Bataineh, S., Gordon, O., Luginbuehl, R., Otto, M., Textor, M., Landmann, R.
(2009). Furanone at Subinhibitory Concentrations Enhances Staphylococcal Biofilm Formation by luxS Repression. Antimicrob. Agents Chemother.
53: 4159-4166
[Abstract]
[Full Text]
-
Choi, A. H. K., Slamti, L., Avci, F. Y., Pier, G. B., Maira-Litran, T.
(2009). The pgaABCD Locus of Acinetobacter baumannii Encodes the Production of Poly-{beta}-1-6-N-Acetylglucosamine, Which Is Critical for Biofilm Formation. J. Bacteriol.
191: 5953-5963
[Abstract]
[Full Text]
-
Amarasinghe, J. J., Scannapieco, F. A., Haase, E. M.
(2009). Transcriptional and Translational Analysis of Biofilm Determinants of Aggregatibacter actinomycetemcomitans in Response to Environmental Perturbation. Infect. Immun.
77: 2896-2907
[Abstract]
[Full Text]
-
Cotter, J. J., O'Gara, J. P., Mack, D., Casey, E.
(2009). Oxygen-Mediated Regulation of Biofilm Development Is Controlled by the Alternative Sigma Factor {sigma}B in Staphylococcus epidermidis. Appl. Environ. Microbiol.
75: 261-264
[Abstract]
[Full Text]
-
Sadykov, M. R., Olson, M. E., Halouska, S., Zhu, Y., Fey, P. D., Powers, R., Somerville, G. A.
(2008). Tricarboxylic Acid Cycle-Dependent Regulation of Staphylococcus epidermidis Polysaccharide Intercellular Adhesin Synthesis. J. Bacteriol.
190: 7621-7632
[Abstract]
[Full Text]
-
Seidl, K., Goerke, C., Wolz, C., Mack, D., Berger-Bachi, B., Bischoff, M.
(2008). Staphylococcus aureus CcpA Affects Biofilm Formation. Infect. Immun.
76: 2044-2050
[Abstract]
[Full Text]
-
Johnson, M., Cockayne, A., Morrissey, J. A.
(2008). Iron-Regulated Biofilm Formation in Staphylococcus aureus Newman Requires ica and the Secreted Protein Emp. Infect. Immun.
76: 1756-1765
[Abstract]
[Full Text]
-
Handke, L. D., Rogers, K. L., Olson, M. E., Somerville, G. A., Jerrells, T. J., Rupp, M. E., Dunman, P. M., Fey, P. D.
(2008). Staphylococcus epidermidis saeR Is an Effector of Anaerobic Growth and a Mediator of Acute Inflammation. Infect. Immun.
76: 141-152
[Abstract]
[Full Text]
-
Schlag, S., Nerz, C., Birkenstock, T. A., Altenberend, F., Gotz, F.
(2007). Inhibition of Staphylococcal Biofilm Formation by Nitrite. J. Bacteriol.
189: 7911-7919
[Abstract]
[Full Text]
-
Zhu, Y., Weiss, E. C., Otto, M., Fey, P. D., Smeltzer, M. S., Somerville, G. A.
(2007). Staphylococcus aureus Biofilm Metabolism and the Influence of Arginine on Polysaccharide Intercellular Adhesin Synthesis, Biofilm Formation, and Pathogenesis. Infect. Immun.
75: 4219-4226
[Abstract]
[Full Text]
-
Cerca, N., Jefferson, K. K., Maira-Litran, T., Pier, D. B., Kelly-Quintos, C., Goldmann, D. A., Azeredo, J., Pier, G. B.
(2007). Molecular Basis for Preferential Protective Efficacy of Antibodies Directed to the Poorly Acetylated Form of Staphylococcal Poly-N-Acetyl-{beta}-(1-6)-Glucosamine. Infect. Immun.
75: 3406-3413
[Abstract]
[Full Text]
-
Fuchs, S., Pane-Farre, J., Kohler, C., Hecker, M., Engelmann, S.
(2007). Anaerobic Gene Expression in Staphylococcus aureus. J. Bacteriol.
189: 4275-4289
[Abstract]
[Full Text]
-
O'Neill, E., Pozzi, C., Houston, P., Smyth, D., Humphreys, H., Robinson, D. A., O'Gara, J. P.
(2007). Association between Methicillin Susceptibility and Biofilm Regulation in Staphylococcus aureus Isolates from Device-Related Infections. J. Clin. Microbiol.
45: 1379-1388
[Abstract]
[Full Text]
-
Cerca, N., Maira-Litran, T., Jefferson, K. K., Grout, M., Goldmann, D. A., Pier, G. B.
(2007). Protection against Escherichia coli infection by antibody to the Staphylococcus aureus poly-N-acetylglucosamine surface polysaccharide. Proc. Natl. Acad. Sci. USA
104: 7528-7533
[Abstract]
[Full Text]
-
Tu Quoc, P. H., Genevaux, P., Pajunen, M., Savilahti, H., Georgopoulos, C., Schrenzel, J., Kelley, W. L.
(2007). Isolation and Characterization of Biofilm Formation-Defective Mutants of Staphylococcus aureus. Infect. Immun.
75: 1079-1088
[Abstract]
[Full Text]
-
Cerca, N., Jefferson, K. K., Oliveira, R., Pier, G. B., Azeredo, J.
(2006). Comparative Antibody-Mediated Phagocytosis of Staphylococcus epidermidis Cells Grown in a Biofilm or in the Planktonic State.. Infect. Immun.
74: 4849-4855
[Abstract]
[Full Text]
-
Baillif, S., Casoli, E., Marion, K., Roques, C., Pellon, G., Hartmann, D. J., Freney, J., Burillon, C., Kodjikian, L.
(2006). A Novel In Vitro Model to Study Staphylococcal Biofilm Formation on Intraocular Lenses under Hydrodynamic Conditions.. IOVS
47: 3410-3416
[Abstract]
[Full Text]
-
Doherty, N., Holden, M. T. G., Qazi, S. N., Williams, P., Winzer, K.
(2006). Functional Analysis of luxS in Staphylococcus aureus Reveals a Role in Metabolism but Not Quorum Sensing.. J. Bacteriol.
188: 2885-2897
[Abstract]
[Full Text]
-
Rowlinson, M.-C., LeBourgeois, P., Ward, K., Song, Y., Finegold, S. M., Bruckner, D. A.
(2006). Isolation of a Strictly Anaerobic Strain of Staphylococcus epidermidis.. J. Clin. Microbiol.
44: 857-860
[Abstract]
[Full Text]
-
Johnson, M., Cockayne, A., Williams, P. H., Morrissey, J. A.
(2005). Iron-Responsive Regulation of Biofilm Formation in Staphylococcus aureus Involves Fur-Dependent and Fur-Independent Mechanisms. J. Bacteriol.
187: 8211-8215
[Abstract]
[Full Text]
-
Urquhart, D S, Montgomery, H, Jaffe, A
(2005). Assessment of hypoxia in children with cystic fibrosis. Arch. Dis. Child.
90: 1138-1143
[Abstract]
[Full Text]
-
Kropec, A., Maira-Litran, T., Jefferson, K. K., Grout, M., Cramton, S. E., Gotz, F., Goldmann, D. A., Pier, G. B.
(2005). Poly-N-Acetylglucosamine Production in Staphylococcus aureus Is Essential for Virulence in Murine Models of Systemic Infection. Infect. Immun.
73: 6868-6876
[Abstract]
[Full Text]
-
Cerca, N., Martins, S., Cerca, F., Jefferson, K. K., Pier, G. B., Oliveira, R., Azeredo, J.
(2005). Comparative assessment of antibiotic susceptibility of coagulase-negative staphylococci in biofilm versus planktonic culture as assessed by bacterial enumeration or rapid XTT colorimetry. J Antimicrob Chemother
56: 331-336
[Abstract]
[Full Text]
-
Resch, A., Rosenstein, R., Nerz, C., Gotz, F.
(2005). Differential Gene Expression Profiling of Staphylococcus aureus Cultivated under Biofilm and Planktonic Conditions. Appl. Environ. Microbiol.
71: 2663-2676
[Abstract]
[Full Text]
-
Sadovskaya, I., Vinogradov, E., Flahaut, S., Kogan, G., Jabbouri, S.
(2005). Extracellular Carbohydrate-Containing Polymers of a Model Biofilm-Producing Strain, Staphylococcus epidermidis RP62A. Infect. Immun.
73: 3007-3017
[Abstract]
[Full Text]
-
Vuong, C., Kidder, J. B., Jacobson, E. R., Otto, M., Proctor, R. A., Somerville, G. A.
(2005). Staphylococcus epidermidis Polysaccharide Intercellular Adhesin Production Significantly Increases during Tricarboxylic Acid Cycle Stress. J. Bacteriol.
187: 2967-2973
[Abstract]
[Full Text]
-
Fitzpatrick, F., Humphreys, H., O'Gara, J. P
(2005). Evidence for low temperature regulation of biofilm formation in Staphylococcus epidermidis. J Med Microbiol
54: 509-510
[Full Text]
-
Tormo, M. A., Marti, M., Valle, J., Manna, A. C., Cheung, A. L., Lasa, I., Penades, J. R.
(2005). SarA Is an Essential Positive Regulator of Staphylococcus epidermidis Biofilm Development. J. Bacteriol.
187: 2348-2356
[Abstract]
[Full Text]
-
Fitzpatrick, F., Humphreys, H., O'Gara, J. P.
(2005). Evidence for icaADBC-Independent Biofilm Development Mechanism in Methicillin-Resistant Staphylococcus aureus Clinical Isolates. J. Clin. Microbiol.
43: 1973-1976
[Abstract]
[Full Text]
-
Fluckiger, U., Ulrich, M., Steinhuber, A., Doring, G., Mack, D., Landmann, R., Goerke, C., Wolz, C.
(2005). Biofilm Formation, icaADBC Transcription, and Polysaccharide Intercellular Adhesin Synthesis by Staphylococci in a Device-Related Infection Model. Infect. Immun.
73: 1811-1819
[Abstract]
[Full Text]
-
Conlon, K. M., Humphreys, H., O'Gara, J. P.
(2004). Inactivations of rsbU and sarA by IS256 Represent Novel Mechanisms of Biofilm Phenotypic Variation in Staphylococcus epidermidis. J. Bacteriol.
186: 6208-6219
[Abstract]
[Full Text]
-
Beenken, K. E., Dunman, P. M., McAleese, F., Macapagal, D., Murphy, E., Projan, S. J., Blevins, J. S., Smeltzer, M. S.
(2004). Global Gene Expression in Staphylococcus aureus Biofilms. J. Bacteriol.
186: 4665-4684
[Abstract]
[Full Text]
-
Jefferson, K. K., Pier, D. B., Goldmann, D. A., Pier, G. B.
(2004). The Teicoplanin-Associated Locus Regulator (TcaR) and the Intercellular Adhesin Locus Regulator (IcaR) Are Transcriptional Inhibitors of the ica Locus in Staphylococcus aureus. J. Bacteriol.
186: 2449-2456
[Abstract]
[Full Text]
-
Knobloch, J. K.-M., Nedelmann, M., Kiel, K., Bartscht, K., Horstkotte, M. A., Dobinsky, S., Rohde, H., Mack, D.
(2003). Establishment of an Arbitrary PCR for Rapid Identification of Tn917 Insertion Sites in Staphylococcus epidermidis: Characterization of Biofilm-Negative and Nonmucoid Mutants. Appl. Environ. Microbiol.
69: 5812-5818
[Abstract]
[Full Text]
-
Dobinsky, S., Kiel, K., Rohde, H., Bartscht, K., Knobloch, J. K.-M., Horstkotte, M. A., Mack, D.
(2003). Glucose-Related Dissociation between icaADBC Transcription and Biofilm Expression by Staphylococcus epidermidis: Evidence for an Additional Factor Required for Polysaccharide Intercellular Adhesin Synthesis. J. Bacteriol.
185: 2879-2886
[Abstract]
[Full Text]
-
Conlon, K. M., Humphreys, H., O'Gara, J. P.
(2002). icaR Encodes a Transcriptional Repressor Involved in Environmental Regulation of ica Operon Expression and Biofilm Formation in Staphylococcus epidermidis. J. Bacteriol.
184: 4400-4408
[Abstract]
[Full Text]
-
Masalha, M., Borovok, I., Schreiber, R., Aharonowitz, Y., Cohen, G.
(2001). Analysis of Transcription of the Staphylococcus aureus Aerobic Class Ib and Anaerobic Class III Ribonucleotide Reductase Genes in Response to Oxygen. J. Bacteriol.
183: 7260-7272
[Abstract]
[Full Text]
-
Rohde, H., Knobloch, J. K. M., Horstkotte, M. A., Mack ;, D., Arciola, C. R., Montanaro, L., Baldassarri, L.
(2001). Correlation of Staphylococcus aureus icaADBC Genotype and Biofilm Expression Phenotype. J. Clin. Microbiol.
39: 4595-4596
[Full Text]