This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kullberg, M. C.
Right arrow Articles by Sher, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kullberg, M. C.
Right arrow Articles by Sher, A.

 Previous Article  |  Next Article 

Infection and Immunity, July 2001, p. 4232-4241, Vol. 69, No. 7
0019-9567/01/$04.00+0   DOI: 10.1128/IAI.69.7.4232-4241.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Helicobacter hepaticus-Induced Colitis in Interleukin-10-Deficient Mice: Cytokine Requirements for the Induction and Maintenance of Intestinal Inflammation

Marika C. Kullberg,1,* Antonio Gigliotti Rothfuchs,1,dagger Dragana Jankovic,1 Patricia Caspar,1 Thomas A. Wynn,1,2 Peter L. Gorelick,3 Allen W. Cheever,4 and Alan Sher1

Immunobiology Section1 and Schistosomiasis Immunology and Pathology Unit,2 Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland 20892-0425; Animal Health Diagnostic Laboratory, Laboratory Animal Sciences Program, National Cancer Institute-Frederick Cancer Research and Development Center, Science Applications International Corporation, Frederick, Maryland 21702-12013; and The Biomedical Research Institute, Rockville, Maryland 208524

Received 6 February 2001/Returned for modification 15 March 2001/Accepted 9 April 2001


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

We have previously shown that specific-pathogen-free interleukin-10 (IL-10)-deficient (IL-10 KO) mice reconstituted with Helicobacter hepaticus develop severe colitis associated with a Th1-type cytokine response. In the present study, we formally demonstrate that IL-12 is crucial for disease induction, because mice deficient for both IL-10 and IL-12 p40 show no intestinal pathology following H. hepaticus infection. By using monoclonal antibodies (MAbs) to IL-12, gamma interferon (IFN-gamma ), and tumor necrosis factor alpha (TNF-alpha ), we have further analyzed the role of these cytokines in the maintenance of the Th1 response and inflammation in IL-10 KO mice with established H. hepaticus-induced colitis. Treatment of infected colitic IL-10 KO mice with anti-IL-12 p40 resulted in markedly reduced intestinal inflammation, colonic IFN-gamma , TNF-alpha , and inducible nitric oxide synthase (iNOS) mRNA levels, and H. hepaticus-specific IFN-gamma secretion by mesenteric lymph node (MLN) cells compared to the findings in control MAb-treated mice. Moreover, the diminished pathology was associated with decreased numbers of colonic CD3+ T cells and significantly reduced frequencies of Helicobacter-reactive CD4+ Th1 cells in MLN. In contrast, anti-IFN-gamma and/or anti-TNF-alpha had no effect on intestinal inflammation in IL-10 KO mice with established colitis. Using IL-10/IFN-gamma double-deficient mice, we further show that IFN-gamma is not required for the development of colitis follwing H. hepaticus infection. MLN cells from infected IL-10/IFN-gamma KO animals secreted elevated amounts of IL-12 and TNF-alpha following bacterial antigen stimulation, indicating alternative pathways of disease induction. Taken together, our results demonstrate a crucial role for IL-12 in both inducing and sustaining intestinal inflammation through recruitment and maintenance of a pool of pathogenic Th1 cells.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Inflammatory bowel disease (IBD) is thought to be the consequence of an aberrant mucosal immune response that damages tissues of the intestinal tract (29, 35, 39). From experiments with different animal models, it has become clear that the intestinal flora play an essential role in triggering the disease (2, 13, 33, 36, 42). This is also true for the enterocolitis that spontaneously develops in interleukin-10 (IL-10)-deficient (IL-10 KO) mice in conventional animal facilities (24), because these animals display less severe or no disease when reared under specific-pathogen-free (SPF) or germfree conditions (5, 37). That gut flora also play a role in human IBD has been suggested by studies demonstrating associations between various bacterial species and disease, either by direct detection or by disease-associated antimicrobial immune responses (6, 16, 35, 41, 43), as well as diminished inflammation following antibiotic or probiotic treatment of patients with disease (8, 20, 21, 32, 44).

To study how the gut flora may influence the development of intestinal pathology in IL-10 KO mice, we analyzed SPF-reared IL-10-deficient mice on the C57BL/10SgSnAi background following reconstitution with a defined microbial agent, Helicobacter hepaticus. As early as 2 to 4 weeks after inoculation with this gram-negative bacterium, IL-10 KO animals displayed moderate to severe inflammation of the large bowel that was associated with a Th1-type cytokine response by mesenteric lymph node (MLN) cells stimulated in vitro with SHelAg, a soluble H. hepaticus antigen (Ag) preparation (25). These intestinal lesions were absent in uninfected IL-10 KO controls as well as in simultaneously infected wild-type (WT) mice, the latter instead mounting an IL-10-dominated cytokine response to the bacterium (25). The H. hepaticus-induced colitis in IL-10 KO mice was prevented by administration of monoclonal antibody (MAb) to either IL-12 p40 or gamma interferon (IFN-gamma ) from the start of the infection, suggesting that interference with the development of the Th1 response to the bacterium or inhibition of the Th1-effector phase can effectively block disease induction (25). Subsequent studies (14) analyzing germfree IL-10 KO mice on a C57BL/6 × 129/Ola background 9 weeks after bacterial exposure have indicated that H. hepaticus may not be sufficient for colitis induction and suggest the contribution of resident background flora to the pathological response. Moreover, it is clear that other bacterial species in the absence of H. hepaticus can also trigger intestinal inflammation in IL-10-deficient mice (18, 37).

An important goal of IBD research is the development of effective therapies for patients with Crohn's disease and ulcerative colitis. Because a dysregulated cytokine response has been implicated in the pathogenesis of IBD, it is important to know which of these factors are critical for the maintenance of disease as they may offer new approaches for therapy. Previous studies with murine colitis models have suggested that the continuous presence of IL-12 is crucial for sustaining the inflammatory response (10, 27). However, its downstream IFN-gamma effector molecule does not appear to play as important a role in disease maintenance (10, 19). The latter observation seemed somewhat surprising, because preventive treatment with anti-IFN-gamma MAb blocks the development of disease in both spontaneous enterocolitis and the H. hepaticus-induced inflammation observed in IL-10 KO mice (5, 25).

In the present study, we have addressed the requirements for IL-12, IFN-gamma , and TNF-alpha in disease maintenance in the H. hepaticus/IL-10 KO colitis model by performing in vivo neutralization of cytokines. In addition, for the first time in studies of IBD, we have employed double-cytokine-deficient mice to formally address the roles of IL-12, IFN-gamma , and IL-4 in disease development. Our data demonstrate that IL-12 is crucial for both induction and maintenance of colitis following H. hepaticus inoculation of IL-10-deficient mice. Moreover, while IFN-gamma may play a role in disease induction, this cytokine is not required for the development of colitis or for the ongoing inflammatory process after H. hepaticus infection. Instead, neutralization of IL-12 correlates with reduced numbers of T cells infiltrating the intestine as well as diminished frequencies of SHelAg-specific Th1 cells in MLN, suggesting an important role for this cytokine in maintaining the pool of pathogenic cells.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Experimental animals and infections. Six- to 12-week old, female SPF C57BL/6NAi IL-4 KO, C57BL/10SgSnAi IL-10 KO, C57BL/6 IL-12 p40 KO (backcrossed to the 12th, 10th, and 5th generations, respectively), C57BL/10SgSnAi WT, and double-deficient IL-10/IL-4 KO and IL-10/IL-12 p40 KO mice (generated by crossing the above-mentioned single-cytokine-deficient mice as described previously (22, 48) were obtained from Taconic Farms (Germantown, N.Y.). The animals employed tested negative for antibodies to specific murine viruses and were free of Helicobacter species as assessed by PCR. The IL-4 KO and IL-10 KO lines were originally obtained from R. Kühn and W. Müller (University of Cologne, Cologne, Germany), and the IL-12-deficient animals were obtained from J. Magram (Hoffmann-La Roche, Inc., Nutley, N.J.). IL-10/IFN-gamma double-deficient mice were generated by crossing C57BL/10Sg SnAi IL-10 KO males with C57BL/6Ai IFN-gamma KO females (Taconic Farms), and the progeny were intercrossed to generate IL-10/IFN-gamma KO offspring. All animals were housed in sterile microisolator cages with autoclaved bedding, food, and water at the animal facility at the National Institute of Allergy and Infectious Diseases in accordance with the procedure outlined in the Guide for the Care and Use of Laboratory Animals (26a) under an animal study proposal approved by the National Institute of Allergy and Infectious Diseases Animal Care and Use Committee.

Mice were inoculated intraperitoneally (i.p.) or intragastrically (i.g.) with 0.5 ml of an H. hepaticus suspension (standard Frederick isolate 1A) (17, 45) prepared to a McFarland turbidity standard of 1.0 in phosphate-buffered saline (PBS), representing 2.45 × 109 CFU/ml. We have previously demonstrated that these two routes of inoculation with H. hepaticus result in the same intestinal histological changes in IL-10 KO mice (25). The bacteria were confirmed to be H. hepaticus by PCR before injection (4). Age-matched uninfected animals were included as controls.

In vivo MAb treatment. Four weeks after bacterial inoculation, by which time colitis is established in IL-10 KO animals (25), mice were injected i.p. every 3 to 4 days for 4 weeks with 1 mg of anti-IL-12 (MAb C17.8; initially provided by G. Trinchieri) (49), anti-IFN-gamma (XMG-6) (9), anti-TNF-alpha (XT22-11) (1), a combination of anti-IFN-gamma and anti-TNF-alpha , or control MAb GL113 (anti-beta -galactosidase) in 0.5 ml of PBS. All MAbs were purified from ascites fluid by two sequential 50% ammonium sulfate precipitations. Four days after the last MAb injection, mice were sacrificed, MLN cells were collected for in vitro culture, and intestinal tissues were collected for histology and reverse transcriptase (RT)-PCR analysis.

Pathology and immunohistochemistry. Tissues were fixed in Bouin's fixative or 10% neutral buffered formalin, embedded in paraffin, sectioned at 5 µm, and stained with hematoxylin and eosin (H&E). A longitudinal section of the entire cecum was made together with a cross section of the ascending colon about 1 cm from the cecum. Sections were evaluated in a blinded fashion by the same pathologist (A.W.C.), and an average score of what was seen throughout the whole section was assigned based on a four-scale scoring system with emphasis on the number of infiltrating cells in the lamina propria and the number of crypt abscesses. Hyperplasia was evaluated by microscopic examination of mucosal thickness with an ocular micrometer. A score of 0 denotes no inflammation with only a few infiltrating lymphocytes; 1 corresponds to a mild lesion equivalent to a one-cell-thick layer in the lamina propria; 2 is roughly equivalent to an average two-cell thickness of lymphocytes; 3 implies roughly a three-to-four-cell thickness; and 4 is equivalent to a more-than-four-cell thickness or the presence of severe lesions, such as ulcers or crypt abscesses. Results are presented as the mean score ± standard error (SE) of 3 to 5 mice/group. The absence of an error bar indicates that all animals within a group had identical scores. In certain cases, histopathologic median and range values are also given.

Colonic tissues fixed in Bouin's fixative were used for immunohistochemical staining of T cells with a polyclonal rabbit anti-human CD3 antibody (which cross-reacts with mouse CD3; DAKO Corp., Carpinteria, Calif.) and an ABC Vectastain Elite kit (Vector Laboratories, Inc., Burlingame, Calif.) (25).

Antigen preparation. SHelAg was prepared from cultures of H. hepaticus as described previously (25). Briefly, the organisms were harvested and washed extensively in PBS followed by sonication at 4°C to lyse the bacteria. Cell debris was removed by centrifugation at 8,000 × g (Sorvall RC2-B, SS-34 rotor) for 30 min at 4°C. The supernatant was sterile filtered, protein content was determined by Bradford's technique (Pierce, Rockford, Ill.), and the Ag was stored at -40°C until use.

Cell cultures and cytokine assays. Single-cell suspensions were prepared from MLN, and cells were resuspended in tissue culture medium (RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum [FCS], 100 U of penicillin per ml, 100 µg of streptomycin per ml, 2 mM glutamine, 20 mM HEPES, 1 mM sodium pyruvate, 0.1 mM nonessential amino acids, and 50 µM 2-mercaptoethanol). Experiments were performed with MLN suspensions from individual mice or with cells pooled from 3 to 5 mice per group.

To measure cytokine responses, MLN cells (3 × 106/ml) were cultured in medium alone or with 0.3 µg of SHelAg per ml or plate-bound anti-CD3 (2.5 µg/well; MAb 145-2C11; PharMingen, San Diego, Calif.) in 24-well plates in a total volume of 1 ml/well. In certain experiments, anti-CD4 (GK1.5; rat immunoglobulin G2b [IgG2b]; 10 µg/ml) (12), anti-CD8 (2.43; rat IgG2b; 10 µg/ml) (34), or anti-IL-12 (C17.8; rat IgG2a; 20 µg/ml) (49) MAbs were added to parallel SHelAg cultures. Supernatants were collected 72 h later, and IFN-gamma and IL-12 were measured by enzyme-linked immunosorbent assay (ELISA) with MAb from PharMingen, while TNF-alpha was detected with a kit from R&D Systems (Minneapolis, Minn.).

Intracellular staining for IFN-gamma . Analysis of intracellular cytokine expression was performed with cells from the same SHelAg-stimulated cultures used in the cytokine secretion assays according to a previously described protocol (23). Briefly, MLN cells were incubated for an additional 18 h in fresh medium added to replace the culture supernatant collected at 72 h. Thereafter, cells were stimulated in 1-ml cultures in 24-well plates coated overnight with 2.5 µg of anti-CD3 per well (145-2C11; PharMingen). Nine hours later, brefeldin A (10 µg/ml; Sigma, St Louis, Mo.) was added, and after 5 h, cells were washed once in RPMI, stained with Cy-chrome-labeled anti-CD4 (RM4-5; PharMingen), and fixed for 15 min in 2% paraformaldehyde (Sigma) at room temperature. After 30 min of incubation in permeabilization buffer (PBS containing 0.1% saponin [Calbiochem-Novabiochem. Corp., La Jolla, Calif.], 0.1% FCS, and 20 mM HEPES) with 10% normal mouse serum and anti-Fcgamma RII/III (2.4G2; 5 µg/ml; PharMingen) at 4°C, cells were stained for 30 min with pretitrated phycoerythrin (PE)-labeled anti-IFN-gamma (XMG1.2; PharMingen) at 4°C, washed twice with permeabilization buffer, and resuspended in PBS plus 0.5% FCS. Cell fluorescence was measured with a FACScan flow cytometer, and data were analyzed with CellQuest software (Becton Dickinson).

RT-PCR and Southern blotting for detection of cytokine mRNA. Since in general, the degree of inflammation in the colon was found to proportionally reflect that observed in the cecum, the colon was chosen for RT-PCR analyses to avoid lymphocyte patches present irregularly throughout the cecum while preserving the intact cecum for histological examination. Colonic tissue (3 to 5 mm of ascending colon) was homogenized in RNA STAT-60 (Tel-Test, Friendswood, Tex.) with a tissue Polytron (Omni, Waterbury, Conn.), and total RNA was isolated as recommended by the manufacturer. An RT-PCR procedure was performed to determine relative quantities of mRNA for various cytokines (46, 47). Briefly, 1 µg of RNA was reverse transcribed with random hexamer oligonucleotides (Boehringer Mannheim, Indianapolis, Ind.) and Superscript II RT (GIBCO BRL, Gaithersburg, Md.). cDNA was then amplified with specific primer pairs for IFN-gamma (32 cycles), TNF-alpha (28 cycles), inducible nitric oxide synthase (iNOS) (26 cycles), or the housekeeping gene hypoxanthine phosphoribosyltransferase (HPRT; 24 cycles) by using Taq DNA polymerase and deoxynucleotide triphosphates (both from GIBCO BRL). After an initial incubation at 95°C for 3 min, temperature cycling was initiated as follows: 94°C for 2 min, 54°C for 2 min, and 72°C for 3 min. An additional extension for 5 min was performed at the end of the last cycle. For the experiment shown in Fig. 8C to E, 1 min was used at the 94 and 54°C steps, and 30 cycles were used for TNF-alpha . PCR products were electrophoresed in a 1.5% agarose gel and then transferred onto Hybond-N+ nylon membranes (Amersham, Little Chalfont, United Kingdom), followed by hybridization with specific fluorescein-labeled probes (46, 47). Blots were developed with the ECL enhanced chemiluminescence detection system (Amersham) and exposed to autoradiographic film (ECL-Hyperfilm; Amersham). The signal intensities of bands were scanned, and the optical density was quantified with NIH Image sortware (National Institutes of Health, Bethesda, Md.). The primers and probes were as follows: HPRT sense, GTTGGATACAGGCCAGACTTTGTTG; HPRT antisense, GATTCAACTTGCGCTCATCTTAGGC; HPRT probe, GTTGTTGGATATGCCCTTGAC; IFN-gamma sense, TACTGCCACGGCACAGTCATTGAA; IFN-gamma antisense, GCAGCGACTCCTTTTCCGCTTCCT; IFN-gamma probe, GGAGGAACTGGCAAAAGGA; TNF-alpha sense, GATCTCAAAGACAACCAACTAGTG; TNF-alpha antisense, CTCCAGCTGGAAGACTCCTCCCAG; TNF-alpha probe, CCCGACTACGTGCTCCTCACC; iNOS sense, CCCTTCCGAAGTTTCTGGCAGCAGC; iNOS antisense, GGCTGTCAGAGCCTCGTGGCTTTGG; iNOS probe, CAAGGTCTACGTTCAGGACATC.

Statistical analysis. The statistical significance of differences in cytokine expression between groups was evaluated by using Student's two-tailed t test. Comparison of grades of inflammation between the groups was performed by nonparametric Wilcoxon-Mann-Whitney test.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

IL-10/IL-12 double-deficient mice fail to develop colitis after H. hepaticus infection, while IL-10/IL-4 KO animals are as susceptible to disease as IL-10 KO mice. We have previously shown that SPF-reared IL-10 KO mice develop colitis after experimental infection with H. hepaticus and that the disease is dramatically reduced when the animals are treated with anti-IL-12 or anti-IFN-gamma MAb from the start of the infection (25). To formally investigate the role of IL-12 in disease induction, we here analyzed intestinal pathology in mice doubly deficient for IL-10 and IL-12 that were infected with H. hepaticus for 5 weeks. As shown in Fig. 1A, while infected IL-10 KO mice displayed severe intestinal pathology, IL-10/IL-12 double-deficient animals showed no disease after bacterial inoculation, and their cecal histological scores were comparable to those of WT controls as well as single IL-12 KO mice. While these data obtained from a single time point postinfection do not rule out the possibility of later compensatory mechanisms, they indicate at the very minimum that IL-12 is crucial for initial disease induction.


View larger version (31K):
[in this window]
[in a new window]
 
FIG. 1.   H. hepaticus does not trigger colitis in IL-10/IL-12 double-deficient mice. WT, IL-10 KO, IL-10/IL-12 KO, IL-12 KO, IL-10/IL-4 KO, and IL-4 KO animals were infected i.g. with H. hepaticus (black bars), and intestinal pathology and cytokine responses were analyzed 5 weeks later. Gray bars represent uninfected controls. (A) Inflammation in the cecum (typhlitis). Bars represent mean histology scores ± SE of four mice/group, with a median value for infected IL-10 KO of 3 (all mice scored as 3) and that of infected IL-10/IL-4 KO of 3.5 (range, 2 to 4). Similar results were observed for the colon, although scores were lower (not shown). (B) IFN-gamma levels detected in 72-h supernatants from MLN cells (3 × 106/ml) stimulated with 0.3 µg of SHelAg per ml. Bars represent means ± standard deviations of duplicate ELISA values from MLN cells pooled from 4 mice/group. No IFN-gamma was detected from cells cultured in medium alone.

To examine if IL-4 plays a protective role in our model of colitis, mice deficient in this cytokine were analyzed in parallel. In contrast to IL-10-deficient mice, however, IL-4 KO mice showed no intestinal pathology upon H. hepaticus infection, and as expected, only IL-4-deficient mice also lacking IL-10 developed colitis after inoculation with the bacterium (Fig. 1A). Our previous findings demonstrated a strong association between Helicobacter-induced colitis in IL-10 KO mice and a Th1-cytokine response to SHelAg (25). This pattern was confirmed in the present study, because only MLN cells from cytokine-deficient mice with disease responded with significant IFN-gamma production to SHelAg stimulation (Fig. 1B).

Anti-IL-12 treatment of H. hepaticus-infected IL-10 KO mice with established disease reduces intestinal inflammation. To investigate the role of IL-12 in the maintenance of established H. hepaticus-induced colitis, IL-10 KO mice infected 4 weeks earlier were treated every 3 to 4 days with 1 mg of neutralizing anti-IL-12 p40 MAb. After 4 weeks of treatment, mice were sacrificed, and large bowel inflammation was scored. Infected animals treated with anti-IL-12 showed a marked reduction in cecal inflammation (typhlitis) compared to mice receiving control MAb (Fig. 2A). The diminished inflammation observed in anti-IL-12-treated infected mice was characterized by diminished hyperplasia and reduced numbers of infiltrating cells in the lamina propria compared to those in animals receiving control MAb (Fig. 3).


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 2.   Treatment with anti-IL-12 diminishes established H. hepaticus-induced colitis and SHelAg-induced IFN-gamma responses in IL-10 KO mice. IL-10 KO mice were infected i.p. with H. hepaticus (black bars). Four weeks later, animals were treated with anti-IL-12 or control MAb for an additional 4 weeks before analysis. Uninfected (Uninf.) IL-10 KO mice (gray bars) were included as controls. (A) Pathology in the cecum. Bars represent mean histology scores ± SE of individual mice from three separate experiments with uninfected (n = 6), infected control MAb-treated (n = 9), and infected anti-IL-12-treated (n = 9) IL-10 KO mice. Median scores for the different groups were as follows: uninfected = 1 (range, 1 to 2), infected plus control MAb = 4 (range, 3 to 4), and infected plus anti-IL-12 = 2 (all mice scored as 2). Similar results were observed for the colon, although scores were lower (data not shown) (Fig. 8). Comparable effects of anti-IL-12 treatment on pathology were seen in a separate experiment (not shown) in which mice were infected by the i.g. route. (B and C) IFN-gamma levels detected in 72-h supernatants from MLN cells (3 × 106/ml) stimulated with plate-bound anti-CD3 (B) or 0.3 µg of SHelAg per ml (C). Bars represent means ± SE of ELISA values from individual MLN cell suspensions from mice in two of the three experiments shown in panel A in which anti-CD3 and SHelAg stimulations were performed. No IFN-gamma was detected from cells cultured in medium alone.


View larger version (106K):
[in this window]
[in a new window]
 
FIG. 3.   Reduced intestinal pathology after anti-IL-12 treatment of IL-10 KO mice with established H. hepaticus-induced cecal lesions. IL-10 KO mice were infected with H. hepaticus and treated with anti-IL-12 or control MAb between weeks 4 and 8 of infection. Shown are representative ceca of an uninfected IL-10 KO mouse (A) or infected IL-10 KO mouse treated with control MAb (B) or anti-IL-12 (C). All sections shown were located in the mid-cecum 1 to 1.5 cm from the cecal-colic junction on a longitudinal section of the entire cecum and represent scores of 1.0 (A), 3.5 (B), and 2.0 (C). Formalin-fixed tissues were stained with H&E. Magnification, ×110.

Diminished colitis in anti-IL-12-treated IL-10 KO mice with established disease correlates with reduced Helicobacter-associated Th1-cytokine responses in vitro and in vivo. To further characterize the immune response in infected IL-10 KO mice with reduced intestinal inflammation after anti-IL-12 treatment of established disease, we measured IFN-gamma as a marker of a Th1 response after in vitro stimulation of MLN cells with anti-CD3 or SHelAg. As previously reported for IL-10-deficient mice with spontaneous enterocolitis (10), MLN cells from anti-IL-12- and control MAb-treated IL-10 KO animals with established H. hepaticus-induced intestinal inflammation secreted comparable amounts of IFN-gamma following anti-CD3 stimulation (Fig. 2B). Importantly, however, while infected control MAb-treated animals displayed a strong SHelAg-induced IFN-gamma response, infected mice receiving anti-IL-12 secreted significantly reduced levels of this cytokine following bacterial Ag stimulation (Fig. 2C).

To analyze cytokine responses at the site of inflammation, ascending colon samples were collected, and various cytokines were analyzed by RT-PCR. Figure 4 shows pooled data from three independent experiments in which such analysis was performed. Compared to uninfected mice, infected animals treated with control MAb showed markedly increased mRNA levels of IFN-gamma , TNF-alpha , and iNOS (Fig. 4). More importantly, however, infected IL-10 KO animals receiving anti-IL-12 once disease was established showed significantly reduced levels of mRNA for IFN-gamma , TNF-alpha , and iNOS compared to the control MAb-treated animals (Fig. 4), suggesting a wholesale decrease in Th1-cell activity in these mice after anti-IL-12 treatment.


View larger version (45K):
[in this window]
[in a new window]
 
FIG. 4.   IFN-gamma , TNF-alpha , and iNOS mRNA expression in colon of anti-IL-12-treated H. hepaticus-infected IL-10 KO mice. Colonic tissues from uninfected or H. hepaticus-infected IL-10 KO mice treated with control MAb or anti-IL-12 between weeks 4 and 8 of infection were collected and processed for RT-PCR analysis of IFN-gamma , TNF-alpha , iNOS, and HPRT. (A) The results shown are autoradiographs after hybridization of PCR products with probes specific for IFN-gamma , TNF-alpha , iNOS, or HPRT. (B) The intensities of the bands in panel A were measured, the cytokine/HPRT ratio was calculated for each mouse, and the mean ± SE for each group was determined. ND, not detected. Data are from the same individual mice in the three separate experiments shown in Fig. 2, with the exception of one anti-IL-12-treated mouse from which RNA preparation was not successful. * and #, P < 0.001 and P = 0.039, respectively, compared to control MAb-treated group. It should be noted that the data do not allow quantitative comparison between the cytokines, but only comparison of the same cytokine among groups of mice.

Anti-IL-12 treatment of IL-10 KO mice with established disease reduces the number of colonic CD3+ T cells and the frequency of Helicobacter-reactive IFN-gamma -producing CD4+ Th1 cells. IL-12 is known to be required for optimal IFN-gamma production by CD4+ T cells. Similarly, the SHelAg-induced IFN-gamma response by MLN cells from infected IL-10 KO mice was shown to be dependent on CD4+ cells as well as IL-12, because addition of either anti-CD4 or anti-IL-12, but not anti-CD8 MAb to cultures completely abrogated the response (Fig. 5). Thus, to assess whether the reduced Th1-cell activity in animals treated in vivo with anti-IL-12 was due to blocking the ability of T cells to secrete cytokines and/or to a decrease in T-cell numbers, we performed immunohistochemical staining for CD3+ T cells on colonic tissue sections. Data from three independent experiments (n = 6 mice/group) showed that, compared to uninfected controls (12.5 ± 3.5 CD3+ cells/×40 field), infected IL-10 KO mice treated with control MAb showed an increase in the number of colonic T cells (38.0 ± 7.2 CD3+ cells/×40 field), and this number was significantly reduced in anti-IL-12-treated infected mice (20.3 ± 4.5 CD3+ cells/×40 field; P = 0.023 compared to control MAb-treated group). The colonic sections of infected control MAb-treated mice were characterized by hyperplasia and areas of higher T-cell density distributed irregularly throughout the lamina propria (Fig. 6). In colon sections of anti-IL-12-treated mice, these accumulations of CD3+ T cells were absent and reduced hyperplasia was observed (Fig. 6).


View larger version (12K):
[in this window]
[in a new window]
 
FIG. 5.   IL-12 and CD4 cell dependence of SHelAg-induced IFN-gamma responses in H. hepaticus-infected IL-10 KO mice. IL-10 KO mice were infected i.p. with H. hepaticus, and cytokine responses were analyzed 7 weeks later. MLN cells (3 × 106/ml) were cultured in medium alone or with 0.3 µg of SHelAg per ml without or with the addition of anti-CD4, anti-CD8 (both at 10 µg/ml), or anti-IL-12 (20 µg/ml) as indicated. IFN-gamma levels were measured in 72-h supernatants. Bars represent means ± standard deviations of duplicate ELISA values. The data shown are from one representative experiment of six performed (with 4- to 9-week-infected mice).


View larger version (73K):
[in this window]
[in a new window]
 
FIG. 6.   Immunostaining for CD3+ cells in colons of IL-10 KO mice, all with hematoxylin counterstain. IL-10 KO mice were infected with H. hepaticus and treated with anti-IL-12 or control MAb between weeks 4 and 8 of infection. Shown are representative colon sections of an uninfected IL-10 KO mouse (A) or infected IL-10 KO mouse treated with control MAb (B) or anti-IL-12 (C). Magnification, ×125.

To analyze the effect of anti-IL-12 treatment on the generation of Helicobacter-reactive Th1 cells, the presence of IFN-gamma -producing SHelAg-reactive CD4+ cells in MLN was analyzed by intracellular cytokine staining. After one round of in vitro stimulation of MLN cells with SHelAg, the frequency of IFN-gamma -producing CD4+ cells in cultures from infected control MAb-treated mice was approximately sixfold increased compared to that of cells from uninfected animals (Fig. 7). Importantly, this frequency was significantly decreased in infected anti-IL-12-treated mice (Fig. 7).


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 7.   Diminished frequency of SHelAg-induced IFN-gamma -expressing CD4+ T cells in H. hepaticus-infected IL-10 KO mice treated with anti-IL-12. MLN cells from uninfected (Uninf.) or H. hepaticus-infected IL-10 KO mice treated with control MAb or anti-IL-12 between weeks 4 and 8 of infection were cultured for 72 h with SHelAg followed by overnight incubation in medium alone. Thereafter, cells were stimulated for 9 h with plate-bound anti-CD3 followed by an additional 5 h in the presence of brefeldin A. The cells were then stained with Cy-chrome-labeled anti-CD4 followed by PE-labeled anti-IFN-gamma and analyzed by flow cytometry. Each dot indicates the percentage of CD4+ cells expressing IFN-gamma from an individual mouse. The data are pooled from four separate experiments.

Anti-IFN-gamma and/or anti-TNF-alpha treatment of IL-10 KO mice does not ameliorate established intestinal inflammation. We have previously shown that treatment with neutralizing anti-IFN-gamma from the start of the infection inhibits the development of colitis in IL-10 KO mice inoculated with H. hepaticus (25). To investigate the role of IFN-gamma in disease maintenance, we treated colitic IL-10 KO mice with a MAb to this cytokine between weeks 4 and 8 of the infection. In contrast to anti-IL-12-treated animals, infected IL-10 KO mice treated in parallel with neutralizing anti-IFN-gamma showed no or only minimal reduction in intestinal inflammation (cecal scores: uninfected, 1.5 ± 0.7; infected, 4.0 ± 0; infected plus control MAb, 3.8 ± 0.5; infected plus anti-IL-12, 2.0 ± 0; infected plus anti-IFN-gamma , 3.0 ± 1.2; n = 4 mice/group). The anti-IFN-gamma -treated mice also had similar or increased SHelAg-stimulated IFN-gamma responses compared to control MAb-treated animals as measured in supernatants from MLN cultures or by intracellular staining (not shown). One possible explanation for these results could be that blockade of other Th1 cytokines, in particular TNF-alpha , is required to reduce pathology. Thus, to explore this possibility, a separate experiment was performed in which groups of five mice were treated with anti-IL-12, anti-IFN-gamma , anti-TNF-alpha , or a combination of anti-IFN-gamma and anti-TNF-alpha between weeks 4 and 8 of H. hepaticus infection. When histology scores were analyzed, only the group treated with anti-IL-12 showed a reduction in intestinal inflammation (Fig. 8A and B). The same pattern was observed when cytokine mRNA levels were analyzed at the site of inflammation. Thus, only the group given anti-IL-12 showed a significant reduction in colonic mRNA levels for IFN-gamma , TNF-alpha , and iNOS, while anti-IFN-gamma and/or anti-TNF-alpha treatment had no effect on the mRNA levels of these factors (Fig. 8C to E).


View larger version (17K):
[in this window]
[in a new window]
 
FIG. 8.   Treatment with anti-IFN-gamma and/or anti-TNF-alpha has no effect on established H. hepaticus-induced intestinal inflammation in IL-10 KO mice. IL-10 KO mice were infected with H. hepaticus and treated with the indicated MAb between weeks 4 and 8 of infection. Uninfected (Uninf.) animals were included as controls. Four days after the last MAb injection, mice were sacrificed, and intestinal inflammation and colonic cytokine mRNA levels were determined. (A and B) Pathology in the cecum (A) and ascending colon (B). Bars represent mean histology scores ± SE of 5 mice/group. Median scores for the cecum and colon for the different groups were as follows: uninfected = 1 (range, 0.5 to 1) and 0.5 (range, 0 to 1), infected plus control MAb = 4 (range, 2 to 4) and 1 (range, 0.5 to 4), infected plus anti-IL-12 = 2 (range, 1 to 2) and 0.5 (range, 0 to 2), infected plus anti-IFN-gamma  = 3 (range, 2 to 4) and 1.5 (range, 1 to 2), infected plus anti-TNF-alpha  = 2 (range, 2 to 4) and 1 (range, 1 to 2.5), and infected plus anti-IFN-gamma plus anti-TNF-alpha  = 4 (range, 3 to 4) and 1 (range, 0.5 to 4). (C to E) RT-PCR analysis of IFN-gamma (C), TNF-alpha (D), and iNOS (E) mRNA levels in colon expressed as a cytokine/HPRT ratio for each mouse as described in the legend to Fig. 4. Bars represent mean values ± SE of 5 mice/group. alpha , anti; ND, not detected.

IFN-gamma is not absolutely required for the development of H. hepaticus-induced colitis. As shown in our original study, treatment with anti-IFN-gamma blocks intestinal inflammation when given to IL-10 KO mice between weeks 0 and 4 of H. hepaticus infection (25). Our present data suggest a less important role for IFN-gamma once disease is established, because IL-10-deficient mice given anti-IFN-gamma between weeks 4 and 8 of infection showed no reduction in intestinal pathology. To analyze if Helicobacter-induced colitis can develop in the absence of IFN-gamma , we next analyzed H. hepaticus infection in IL-10/IFN-gamma double-deficient mice and found that these IL-10/IFN-gamma KO animals were as susceptible to disease as IL-10 single-deficient mice (Fig. 9A). Histological examination revealed no evident differences in terms of cell types infiltrating the intestine in the two groups of colitic mice (not shown). These data suggested to us the existence of alternative pathways for the development of colitis following H. hepaticus infection. As expected, MLN cells from infected IL-10 KO mice secreted large amounts of IFN-gamma when SHelAg-induced Th1-cytokine responses were analyzed (Fig. 9B). Importantly, MLN cells from infected IL-10/IFN-gamma -deficient mice produced IL-12 following SHelAg stimulation in amounts comparable to those of infected IL-10 KO animals (Fig. 9C). Moreover, the IL-10/IFN-gamma KO mice showed a dramatically increased SHelAg-specific TNF-alpha response compared to that of the IL-10-deficient animals (Fig. 9D).


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 9.   IL-10/IFN-gamma KO mice develop colitis following inoculation with H. hepaticus. WT, IL-10 KO, IL-10/IL-12 KO, and IL-10/IFN-gamma KO animals were infected i.g. with H. hepaticus (black bars), and intestinal pathology and cytokine responses were analyzed 4 weeks later. Gray bars represent uninfected controls. (A) Pathology in the cecum. Bars represent mean histology scores ± SE of 3 to 5 mice/group, with the following median values for infected mice: WT = 1 (all mice scored as 1, n = 3), IL-10 KO = 3 (range, 3 to 3.5, n = 4), IL-10/IL-12 KO = 1 (range, 1 to 1.5, n = 4), and IL-10/IFN-gamma KO = 4 (range, 3 to 4, n = 5). Similar results were observed for colon, although scores were lower (not shown). (B to D) IFN-gamma (B), IL-12 (C), and TNF-alpha (D) levels detected in 72-h supernatants from MLN cell cultures stimulated with SHelAg. Bars represent means ± SD of duplicate ELISA values from MLN cells pooled from 3 to 5 mice/group. The data shown are from one representative experiment of two performed. ND, not detected. No IFN-gamma , IL-12, or TNF-alpha was detected from cells cultured in medium alone, and no IL-4 was detected in supernatants from SHelAg-stimulated cultures.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

In the present study, we have demonstrated a crucial role for IL-12 in both disease induction and maintenance in the murine model of IBD involving H. hepaticus infection of IL-10 KO mice. The mechanism by which IL-12 exerts its function involves the generation and maintenance of pathogenic Th1 cells as well as sustaining their numbers at the site of inflammation.

We have previously shown that administration of anti-IL-12 or anti-IFN-gamma MAb from the start of the infection prevents colitis in IL-10 KO animals receiving H. hepaticus (25). To further investigate the requirement for these cytokines in disease induction, we have utilized for the first time in studies of IBD mice doubly deficient for IL-10 and IL-12, IL-10 and IFN-gamma , and IL-10 and IL-4. The IL-10/IL-12 double-deficient mice showed no intestinal pathology after H. hepaticus inoculation, and levels of IFN-gamma were undetectable in culture supernatants from MLN cells stimulated with SHelAg. In contrast, both IL-10/IFN-gamma - and IL-10/IL-4-deficient animals developed colitis following H. hepaticus challenge. Importantly, H. hepaticus infection of IL-4 KO mice did not result in intestinal inflammation, confirming that IL-10, and not IL-4, is the critical cytokine for protection against Helicobacter-induced colitis, as well as demonstrating that IL-4 is not required for the generation of this IL-10-dependent mechanism.

To evaluate the importance of IL-12 for disease maintenance, 4-week H. hepaticus-infected IL-10 KO animals were treated with MAb to this cytokine for an additional 4 weeks before intestinal pathology was analyzed. Following this protocol, anti-IL-12-treated infected IL-10 KO mice showed a significant reduction in intestinal inflammation compared to control MAb-treated animals. These results agree with those of Neurath et al. (27) and Davidson et al. (10), who demonstrated a role for anti-IL-12 in reversing 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis in BALB/c mice and the spontaneous enterocolitis of IL-10 KO mice, respectively. The reduced pathology observed after anti-IL-12 treatment of H. hepaticus-infected IL-10 KO mice with established colitis correlated with reduced levels of mRNA for IFN-gamma , TNF-alpha , and iNOS in the colon. That anti-IL-12 was not merely acting by blocking cytokine secretion by Th1 cells was confirmed by immunohistochemical staining of colon showing reduced numbers of lamina propria-infiltrating CD3+ cells in the mice receiving anti-IL-12 MAb. An additional piece of evidence linking the presence of H. hepaticus-reactive pathogenic Th1 cells with intestinal disease was the finding of significantly reduced frequencies of SHelAg-specific IFN-gamma -secreting CD4+ T lymphocytes in MLN of anti-IL-12-treated infected mice recovering from colitis. Importantly, analysis of culture supernatants from these MLN cells stimulated in vitro with SHelAg showed a significantly diminished IFN-gamma response to the bacterium, but not to anti-CD3 stimulation, implying selective loss of H. hepaticus-specific CD4+ T lymphocytes. Fuss et al. (19) have reported that the main effect of anti-IL-12 on established TNBS colitis is the induction of Fas-mediated apoptosis of the Th1 cells causing inflammation. Although we cannot rule out that anti-IL-12 induced apoptosis in our model as well, attempts to detect terminal deoxynucleotidyltransferase-mediated deoxyuridine triphosphate nick end-labeling (TUNEL)-positive cells in the anti-IL-12-treated mice in the present study have so far been unsuccessful. It is also important to point out that the recently described cytokine IL-23, composed of the p19 protein in combination with the p40 subunit of IL-12, induces strong proliferation of mouse memory CD4+ T cells (28). Thus, it is possible that the beneficial effect of the anti-IL-12 p40 MAb used in these and previous colitis studies is associated with its ability to neutralize IL-23.

In the case of TNBS colitis, anti-IL-12 treatment frequently abrogated the established inflammation completely (27). In contrast, we observed that Helicobacter-infected anti-IL-12-treated IL-10 KO mice showed some degree of residual inflammation compared to uninfected controls. Even if the anti-IL-12 treatment was continued for six additional injections (total of 7 weeks of MAb treatment of established colitis), no further reduction in pathology was observed (not shown). Similar results have been reported for the spontaneous enterocolitis in IL-10 KO mice in which anti-IL-12 treatment, either alone or combined with daily administrations of recombinant IL-10, did not reverse disease completely (10). One important difference between the colitis models triggered by TNBS versus those triggered by bacterial flora is the continuous presence of the agent provoking disease. Thus, in the case of colitis induced by TNBS, this molecule is given at a single time and subsequently disappears from the body. In contrast, in the IL-10 KO colitis model, H. hepaticus or other flora are continuously present, thereby constantly recruiting new bacterium-specific Th cells from the pool of naïve cells. Consequently, it may not be surprising that, although ameliorating disease, anti-IL-12 administration will not reduce the inflammation to levels observed in uninfected mice, because this treatment preferentially affects activated T cells.

To further dissect the mechanism behind disease reversal following anti-IL-12 treatment, we used neutralizing MAbs to IFN-gamma and/or TNF-alpha in vivo. However, neither MAb, alone or in combination, reduced the inflammation in infected IL-10 KO mice with established disease. Although we cannot exclude the possibility that IFN-gamma and TNF-alpha were not completely neutralized in these experiments, the inability of anti-IFN-gamma and anti-TNF-alpha to reverse disease is consistent with findings from other colitis models in which these MAbs were tested separately (5, 10, 19, 31). Similar to our data obtained with anti-IFN-gamma , we have found that treatment of IL-10 KO mice with one of the iNOS inhibitors aminoguanidine or L-N6-(1-iminoethyl)-lysine (L-NIL) from the start of H. hepaticus infection blocked the development of colitis, whereas administration of aminoguanidine to IL-10 KO mice with established disease had no effect (A.G.R. and M.C.K., unpublished results). Thus, it appears that neutralization of cytokines produced by T cells (such as IFN-gamma and TNF-alpha ) and their downstream effectors (e.g., NO) is not enough to block the inflammatory process once established. Rather, the absolute number of pathogenic Th1 cells would have to be diminished in order to reduce the inflammation. The precise mechanism by which these intestinal T cells sustain the inflammation remains unknown. Using the TNBS colitis model, Stüber et al. (40) have demonstrated that the CD40-CD40L interaction is crucial for the in vivo priming of Th1 cells via the stimulation of IL-12 secretion by antigen-presenting cells (APCs). Recent data have shown that blockade of the CD40-CD40L interaction by anti-CD154 MAb is efficient also in reducing established colitis in T-cell-reconstituted SCID or RAG KO mice and in bone marrow-transplanted Tgepsilon 26 mice (11, 26). The authors reported reduced IL-12 production and speculate that the anti-CD154 treatment blocks T cells in their ability to activate APC, thereby impairing the development of colitis, possibly through interference with T-cell-dependent macrophage activation and/or cytokine secretion.

Our finding that IL-10/IFN-gamma double-deficient mice were as susceptible to Helicobacter-induced colitis as IL-10 KO animals indicates that IFN-gamma is not required for disease induction. Similarly, in the two colitis models of Tgepsilon 26 mice and CD45RBhi cell transfer into RAG KO mice, recipients reconstituted with T cells from IFN-gamma KO animals developed intestinal inflammation comparable in severity to that observed in mice receiving wild-type cells (38). IFN-gamma also appears to be dispensable for disease induction in the TNBS colitis model, because both BALB/c IFN-gamma KO and 129/Sv/Ev IFN-gamma R1 KO mice developed disease following administration of this hapten (7, 15). Despite the absence of IFN-gamma , the intestinal inflammation in H. hepaticus-infected IL-10/IFN-gamma KO animals was characterized by the same type of cell infiltrates as those of single IL-10-deficient mice. In addition, both strains of mice displayed a Th1 response to the bacterium. The discrepancy between the IL-10/IFN-gamma KO animal experiments and our initial observation that anti-IFN-gamma MAb given to IL-10 KO mice blocks disease when given from the start of the infection could possibly be explained by the qualitatively different cytokine profiles mounted by these two mouse strains. Thus, in IL-10 KO mice, IFN-gamma may be the crucial cytokine for disease development, while in IL-10/IFN-gamma KO animals, TNF-alpha may play the important role, because this is the dominant cytokine produced after encounter with the bacterium. Importantly, MLN cells from both colitic IL-10 KO and IL-10/IFN-gamma KO mice infected with H. hepaticus secreted IL-12 following SHelAg stimulation, suggesting an important function for this cytokine in disease induction regardless of the absence or presence of IFN-gamma .

In humans, anti-TNF-alpha therapy appears to be the most effective treatment to date for patients with Crohn's disease and ulcerative colitis (3). Interestingly, in a recent report, the beneficial effects of anti-TNF-alpha treatment were described as being attributed not merely to TNF neutralization, but rather to a more general effect on T lymphocytes, raising new possibilities of combined anticytokine and anti-T-cell strategies to treat these chronic diseases (30). Similarly, data from several different colitis models have now demonstrated that neutralization of cytokines produced by T cells may not be sufficient to block an ongoing inflammatory process in the gut. Rather, it appears crucial to reduce the number of pathogenic cells at the site of inflammation to see improvement of disease. Our data are consistent with these conclusions and add a further dimension to the scenario by demonstrating a reduction in H. hepaticus-reactive, presumably pathogenic CD4+ Th1 cells in MLNs of mice recovering from colitis. Further studies on the nature and mechanism of action of these bacteria-reactive T lymphocytes may lead to new strategies for therapeutic interventions involving targeting of microbe-specific T cells in the treatment of patients with IBD.


    ACKNOWLEDGMENTS

We are grateful to Sara Hieny for preparation of anti-cytokine MAbs used for in vivo neutralizations, Barbara Kasprzak for assistance with immunohistochemical stainings, Ricardo Dreyfuss for help with photomicrographs, and Shyla Jagannatha for helpful assistance with statistical evaluation of our data. We also thank Ivan Fuss, Warren Strober, Jerrold Ward, and George Yap for helpful discussions and for critical reading of the manuscript.


    FOOTNOTES

* Corresponding author. Mailing address: Immunobiology Section, Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Building 4, Room 126, 4 Center Dr., Bethesda, MD 20892-0425. Phone: (301) 496-8218. Fax: (301) 402-0890. E-mail: mkullberg{at}niaid.nih.gov.

dagger Present address: Microbiology and Tumorbiology Center, Karolinska Institutet, SE-171 77 Stockholm, Sweden.

Editor:   W. A. Petri Jr.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Abrams, J. S., M. G. Roncarolo, H. Yssel, U. Andersson, G. J. Gleich, and J. E. Silver. 1992. Strategies of anti-cytokine monoclonal antibody development: immunoassay of IL-10 and IL-5 in clinical samples. Immunol. Rev. 127:5-24[CrossRef][Medline].
2. Aranda, R., B. C. Sydora, P. L. McAllister, S. W. Binder, H. Y. Yang, S. R. Targan, and M. Kronenberg. 1997. Analysis of intestinal lymphocytes in mouse colitis mediated by transfer of CD4+, CD45RBhigh T cells to SCID recipients. J. Immunol. 158:3464-3473[Abstract].
3. Baert, F. J., and P. J. Rutgeerts. 2000. Medical therapies for ulcerative colitis and Crohn's disease. Curr. Gastroenterol. Rep. 2:446-450[Medline].
4. Battles, J. K., J. C. Williamson, K. M. Pike, P. L. Gorelick, J. M. Ward, and M. A. Gonda. 1995. Diagnostic assay for Helicobacter hepaticus based on nucleotide sequence of its 16S rRNA gene. J. Clin. Microbiol. 33:1344-1347[Abstract/Free Full Text].
5. Berg, D. J., N. Davidson, R. Kühn, W. Müller, S. Menon, G. Holland, L. Thompson-Snipes, M. W. Leach, and D. Rennick. 1996. Enterocolitis and colon cancer in interleukin-10-deficient mice are associated with aberrant cytokine production and CD4+ TH1-like responses. J. Clin. Investig. 98:1010-1020[Medline].
6. Blaser, M. J., R. A. Miller, J. Lacher, and J. W. Singleton. 1984. Patients with active Crohn's disease have elevated serum antibodies to antigens of seven enteric bacterial pathogens. Gastroenterology 87:888-894[Medline].
7. Camoglio, L., A. A. te Velde, A. de Boer, F. J. ten Kate, M. Kopf, and S. J. van Deventer. 2000. Hapten-induced colitis associated with maintained Th1 and inflammatory responses in IFN-gamma receptor-deficient mice. Eur. J. Immunol. 30:1486-1495[CrossRef][Medline].
8. Campieri, M., and P. Gionchetti. 1999. Probiotics in inflammatory bowel disease: new insight to pathogenesis or a possible therapeutic alternative? Gastroenterology 116:1246-1249[CrossRef][Medline].
9. Cherwinski, H. M., J. H. Schumacher, K. D. Brown, and T. R. Mosmann. 1987. Two types of mouse helper T cell clone. III. Further differences in lymphokine synthesis between Th1 and Th2 clones revealed by RNA hybridization, functionally monospecific bioassays, and monoclonal antibodies. J. Exp. Med. 166:1229-1244[Abstract/Free Full Text].
10. Davidson, N. J., S. A. Hudak, R. E. Lesley, S. Menon, M. W. Leach, and D. M. Rennick. 1998. IL-12, but not IFN-gamma , plays a major role in sustaining the chronic phase of colitis in IL-10-deficient mice. J. Immunol. 161:3143-3149[Abstract/Free Full Text].
11. De Jong, Y. P., M. Comiskey, S. L. Kalled, E. Mizoguchi, R. A. Flavell, A. K. Bhan, and C. Terhorst. 2000. Chronic murine colitis is dependent on the CD154/CD40 pathway and can be attenuated by anti-CD154 administration. Gastroenterology 119:715-723[CrossRef][Medline].
12. Dialynas, D. P., Z. S. Quan, K. A. Wall, A. Pierres, J. Quintans, M. R. Loken, M. Pierres, and F. W. Fitch. 1983. Characterization of the murine T cell surface molecule, designated L3T4, identified by monoclonal antibody GK1.5: similarity of L3T4 to the human Leu-3/T4 molecule. J. Immunol. 131:2445-2451[Abstract].
13. Dianda, L., A. M. Hanby, N. A. Wright, A. Sebesteny, A. C. Hayday, and M. J. Owen. 1997. T cell receptor-alpha beta -deficient mice fail to develop colitis in the absence of a microbial environment. Am. J. Pathol. 150:91-97[Abstract].
14. Dieleman, L. A., A. Arends, S. L. Tonkonogy, M. S. Goerres, D. W. Craft, W. Grenther, R. K. Sellon, E. Balish, and R. B. Sartor. 2000. Helicobacter hepaticus does not induce or potentiate colitis in interleukin-10-deficient mice. Infect. Immun. 68:5107-5113[Abstract/Free Full Text].
15. Dohi, T., K. Fujihashi, P. D. Rennert, K. Iwatani, H. Kiyono, and J. R. McGhee. 1999. Hapten-induced colitis is associated with colonic patch hypertrophy and T helper cell 2-type responses. J. Exp. Med. 189:1169-1180[Abstract/Free Full Text].
16. Elsaghier, A., C. Prantera, C. Moreno, and J. Ivanyi. 1992. Antibodies to Mycobacterium paratuberculosis-specific protein antigens in Crohn's disease. Clin. Exp. Immunol. 90:503-508[Medline].
17. Fox, J. G., F. E. Dewhirst, J. G. Tully, B. J. Paster, L. Yan, N. S. Taylor, M. J. Collins, Jr., P. L. Gorelick, and J. M. Ward. 1994. Helicobacter hepaticus sp. nov., a microaerophilic bacterium isolated from livers and intestinal mucosal scrapings from mice. J. Clin. Microbiol. 32:1238-1245[Abstract/Free Full Text].
18. Fox, J. G., P. L. Gorelick, M. C. Kullberg, Z. Ge, F. E. Dewhirst, and J. M. Ward. 1999. A novel urease-negative Helicobacter species associated with colitis and typhlitis in IL-10-deficient mice. Infect. Immun. 67:1757-1762[Abstract/Free Full Text].
19. Fuss, I. J., T. Marth, M. F. Neurath, G. R. Pearlstein, A. Jain, and W. Strober. 1999. Anti-interleukin 12 treatment regulates apoptosis of Th1 T cells in experimental colitis in mice. Gastroenterology 117:1078-1088[CrossRef][Medline].
20. Gionchetti, P., F. Rizzello, A. Venturi, P. Brigidi, D. Matteuzzi, G. Bazzocchi, G. Poggioli, M. Miglioli, and M. Campieri. 2000. Oral bacteriotherapy as maintenance treatment in patients with chronic pouchitis: a double-blind, placebo-controlled trial. Gastroenterology 119:305-309[CrossRef][Medline].
21. Gionchetti, P., F. Rizzello, A. Venturi, F. Ugolini, M. Rossi, P. Brigidi, R. Johansson, A. Ferrieri, G. Poggioli, and M. Campieri. 1999. Review---antibiotic treatment in inflammatory bowel disease: rifaximin, a new possible approach. Eur. Rev. Med. Pharmacol. Sci. 3:27-30[Medline].
22. Hoffmann, K. F., S. L. James, A. W. Cheever, and T. A. Wynn. 1999. Studies with double cytokine-deficient mice reveal that highly polarized Th1- and Th2-type cytokine and antibody responses contribute equally to vaccine-induced immunity to Schistosoma mansoni. J. Immunol. 163:927-938[Abstract/Free Full Text].
23. Jankovic, D., M. C. Kullberg, N. Noben-Trauth, P. Caspar, W. E. Paul, and A. Sher. 2000. Single cell analysis reveals that IL-4 receptor/Stat6 signaling is not required for the in vivo or in vitro development of CD4+ lymphocytes with a Th2 cytokine profile. J. Immunol. 164:3047-3055[Abstract/Free Full Text].
24. Kühn, R., J. Löhler, D. Rennick, K. Rajewsky, and W. Müller. 1993. Interleukin-10-deficient mice develop chronic enterocolitis. Cell 75:263-274[CrossRef][Medline].
25. Kullberg, M. C., J. M. Ward, P. L. Gorelick, P. Caspar, S. Hieny, A. Cheever, D. Jankovic, and A. Sher. 1998. Helicobacter hepaticus triggers colitis in specific-pathogen-free interleukin-10 (IL-10)-deficient mice through an IL-12- and gamma interferon-dependent mechanism. Infect. Immun. 66:5157-5166[Abstract/Free Full Text].
26. Liu, Z., K. Geboes, S. Colpaert, L. Overbergh, C. Mathieu, H. Heremans, M. de Boer, L. Boon, G. D'Haens, P. Rutgeerts, and J. L. Ceuppens. 2000. Prevention of experimental colitis in SCID mice reconstituted with CD45RBhigh CD4+ T cells by blocking the CD40-CD154 interactions. J. Immunol. 164:6005-6014[Abstract/Free Full Text].
26a. National Institutes of Health. 1996. Guide for the care and use of laboratory animals. National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Md.
27. Neurath, M. F., I. Fuss, B. L. Kelsall, E. Stuber, and W. Strober. 1995. Antibodies to interleukin 12 abrogate established experimental colitis in mice. J. Exp. Med. 182:1281-1290[Abstract/Free Full Text].
28. Oppmann, B., R. Lesley, B. Blom, J. C. Timans, Y. Xu, B. Hunte, F. Vega, N. Yu, J. Wang, K. Singh, F. Zonin, E. Vaisberg, T. Churakova, M. Liu, D. Gorman, J. Wagner, S. Zurawski, Y. Liu, J. S. Abrams, K. W. Moore, D. Rennick, R. de Waal-Malefyt, C. Hannum, J. F. Bazan, and R. A. Kastelein. 2000. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity 13:715-725[CrossRef][Medline].
29. Powrie, F. 1995. T cells in inflammatory bowel disease: protective and pathogenic roles. Immunity 3:171-174[CrossRef][Medline].
30. Raza, A. 2000. Anti-TNF therapies in rheumatoid arthritis, Crohn's disease, sepsis, and myelodysplastic syndromes. Microsc. Res. Tech. 50:229-235[CrossRef][Medline].
31. Rennick, D. M., M. M. Fort, and N. J. Davidson. 1997. Studies with IL-10-/- mice: an overview. J. Leukoc. Biol. 61:389-396[Abstract].
32. Rutgeerts, P., M. Hiele, K. Geboes, M. Peeters, F. Penninckx, R. Aerts, and R. Kerremans. 1995. Controlled trial of metronidazole treatment for prevention of Crohn's recurrence after ileal resection. Gastroenterology 108:1617-1621[CrossRef][Medline].
33. Sadlack, B., H. Merz, H. Schorle, A. Schimpl, A. C. Feller, and I. Horak. 1993. Ulcerative colitis-like disease in mice with a disrupted interleukin-2 gene. Cell 75:253-261[CrossRef][Medline].
34. Sarmiento, M., A. L. Glasebrook, and F. W. Fitch. 1980. IgG or IgM monoclonal antibodies reactive with different determinants on the molecular complex bearing Lyt 2 antigen block T cell-mediated cytolysis in the absence of complement. J. Immunol. 125:2665-2672[Abstract].
35. Sartor, R. B. 1997. Pathogenesis and immune mechanisms of chronic inflammatory bowel diseases. Am. J. Gastroenterol. 92:5.S-11.S[Medline].
36. Schultz, M., S. L. Tonkonogy, R. K. Sellon, C. Veltkamp, V. L. Godfrey, J. Kwon, W. B. Grenther, E. Balish, I. Horak, and R. B. Sartor. 1999. IL-2-deficient mice raised under germfree conditions develop delayed mild focal intestinal inflammation. Am. J. Physiol. 276:G1461-G1472[Abstract/Free Full Text].
37. Sellon, R. K., S. Tonkonogy, M. Schultz, L. A. Dieleman, W. Grenther, E. Balish, D. M. Rennick, and R. B. Sartor. 1998. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect. Immun. 66:5224-5231[Abstract/Free Full Text].
38. Simpson, S. J., S. Shah, M. Comiskey, Y. P. de Jong, B. Wang, E. Mizoguchi, A. K. Bhan, and C. Terhorst. 1998. T cell-mediated pathology in two models of experimental colitis depends predominantly on the interleukin 12/signal transducer and activator of transcription (Stat)-4 pathway, but is not conditional on interferon gamma  expression by T cells. J. Exp. Med. 187:1225-1234[Abstract/Free Full Text].
39. Strober, W., and R. O. Ehrhardt. 1993. Chronic intestinal inflammation: an unexpected outcome in cytokine or T cell receptor mutant mice. Cell 75:203-205[CrossRef][Medline].
40. Stüber, E., W. Strober, and M. Neurath. 1996. Blocking the CD40L-CD40 interaction in vivo specifically prevents the priming of T helper 1 cells through the inhibition of interleukin 12 secretion. J. Exp. Med. 183:693-698[Abstract/Free Full Text].
41. Sutton, C. L., J. Kim, A. Yamane, H. Dalwadi, B. Wei, C. Landers, S. R. Targan, and J. Braun. 2000. Identification of a novel bacterial sequence associated with Crohn's disease. Gastroenterology 119:23-31[CrossRef][Medline].
42. Taurog, J. D., J. A. Richardson, J. T. Croft, W. A. Simmons, M. Zhou, J. L. Fernandez-Sueiro, E. Balish, and R. E. Hammer. 1994. The germfree state prevents development of gut and joint inflammatory disease in HLA-B27 transgenic rats. J. Exp. Med. 180:2359-2364[Abstract/Free Full Text].
43. Tiveljung, A., J. D. Soderholm, G. Olaison, J. Jonasson, and H. J. Monstein. 1999. Presence of eubacteria in biopsies from Crohn's disease inflammatory lesions as determined by 16S rRNA gene-based PCR. J. Med. Microbiol. 48:263-268[Abstract/Free Full Text].
44. Venturi, A., P. Gionchetti, F. Rizzello, R. Johansson, E. Zucconi, P. Brigidi, D. Matteuzzi, and M. Campieri. 1999. Impact on the composition of the faecal flora by a new probiotic preparation: preliminary data on maintenance treatment of patients with ulcerative colitis. Aliment. Pharmacol. Ther. 13:1103-1108[CrossRef][Medline].
45. Ward, J. M., J. G. Fox, M. R. Anver, D. C. Haines, C. V. George, M. J. Collins, Jr., P. L. Gorelick, K. Nagashima, M. A. Gonda, R. V. Gilden, J. G. Tully, R. J. Russell, R. E. Benveniste, B. J. Paster, F. E. Dewhirst, J. C. Donovan, L. M. Anderson, and J. M. Rice. 1994. Chronic active hepatitis and associated liver tumors in mice caused by a persistent bacterial infection with a novel Helicobacter species. J. Natl. Cancer Inst. 86:1222-1227[Abstract/Free Full Text].
46. Wynn, T. A., I. Eltoum, A. W. Cheever, F. A. Lewis, W. C. Gause, and A. Sher. 1993. Analysis of cytokine mRNA expression during primary granuloma formation induced by eggs of Schistosoma mansoni. J. Immunol. 151:1430-1440[Abstract].
47. Wynn, T. A., I. Eltoum, I. P. Oswald, A. W. Cheever, and A. Sher. 1994. Endogenous interleukin 12 (IL-12) regulates granuloma formation induced by eggs of Schistosoma mansoni and exogenous IL-12 both inhibits and prophylactically immunizes against egg pathology. J. Exp. Med. 179:1551-1561[Abstract/Free Full Text].
48. Wynn, T. A., R. Morawetz, T. Scharton-Kersten, S. Hieny, H. C. Morse III, R. Kuhn, W. Muller, A. W. Cheever, and A. Sher. 1997. Analysis of granuloma formation in double cytokine-deficient mice reveals a central role for IL-10 in polarizing both T helper cell 1- and T helper cell 2-type cytokine responses in vivo. J. Immunol. 159:5014-5023[Abstract].
49. Wysocka, M., M. Kubin, L. Q. Vieira, L. Ozmen, G. Garotta, P. Scott, and G. Trinchieri. 1995. Interleukin-12 is required for interferon-gamma production and lethality in lipopolysaccharide-induced shock in mice. Eur. J. Immunol. 25:672-676[Medline].


Infection and Immunity, July 2001, p. 4232-4241, Vol. 69, No. 7
0019-9567/01/$04.00+0   DOI: 10.1128/IAI.69.7.4232-4241.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Shen, Z., Feng, Y., Rogers, A. B., Rickman, B., Whary, M. T., Xu, S., Clapp, K. M., Boutin, S. R., Fox, J. G. (2009). Cytolethal Distending Toxin Promotes Helicobacter cinaedi-Associated Typhlocolitis in Interleukin-10-Deficient Mice. Infect. Immun. 77: 2508-2516 [Abstract] [Full Text]  
  • McBee, M. E., Zheng, P. Z., Rogers, A. B., Fox, J. G., Schauer, D. B. (2008). Modulation of Acute Diarrheal Illness by Persistent Bacterial Infection. Infect. Immun. 76: 4851-4858 [Abstract] [Full Text]  
  • Londono, D., Marques, A., Hornung, R. L., Cadavid, D. (2008). IL-10 Helps Control Pathogen Load during High-Level Bacteremia. J. Immunol. 181: 2076-2083 [Abstract] [Full Text]  
  • Sarangi, P. P., Sehrawat, S., Suvas, S., Rouse, B. T. (2008). IL-10 and Natural Regulatory T Cells: Two Independent Anti-Inflammatory Mechanisms in Herpes Simplex Virus-Induced Ocular Immunopathology. J. Immunol. 180: 6297-6306 [Abstract] [Full Text]  
  • Sterzenbach, T., Lee, S. K., Brenneke, B., von Goetz, F., Schauer, D. B., Fox, J. G., Suerbaum, S., Josenhans, C. (2007). Inhibitory Effect of Enterohepatic Helicobacter hepaticus on Innate Immune Responses of Mouse Intestinal Epithelial Cells. Infect. Immun. 75: 2717-2728 [Abstract] [Full Text]  
  • Karrasch, T., Kim, J.-S., Muhlbauer, M., Magness, S. T., Jobin, C. (2007). Gnotobiotic IL-10-/-;NF-{kappa}BEGFP Mice Reveal the Critical Role of TLR/NF-{kappa}B Signaling in Commensal Bacteria-Induced Colitis. J. Immunol. 178: 6522-6532 [Abstract] [Full Text]  
  • Mansfield, L. S., Bell, J. A., Wilson, D. L., Murphy, A. J., Elsheikha, H. M., Rathinam, V. A. K., Fierro, B. R., Linz, J. E., Young, V. B. (2007). C57BL/6 and Congenic Interleukin-10-Deficient Mice Can Serve as Models of Campylobacter jejuni Colonization and Enteritis. Infect. Immun. 75: 1099-1115 [Abstract] [Full Text]  
  • Beiting, D. P., Gagliardo, L. F., Hesse, M., Bliss, S. K., Meskill, D., Appleton, J. A. (2007). Coordinated Control of Immunity to Muscle Stage Trichinella spiralis by IL-10, Regulatory T Cells, and TGF-beta. J. Immunol. 178: 1039-1047 [Abstract] [Full Text]  
  • Tomczak, M. F., Erdman, S. E., Davidson, A., Wang, Y. Y., Nambiar, P. R., Rogers, A. B., Rickman, B., Luchetti, D., Fox, J. G., Horwitz, B. H. (2006). Inhibition of Helicobacter hepaticus-Induced Colitis by IL-10 Requires the p50/p105 Subunit of NF-{kappa}B. J. Immunol. 177: 7332-7339 [Abstract] [Full Text]  
  • Kullberg, M. C., Jankovic, D., Feng, C. G., Hue, S., Gorelick, P. L., McKenzie, B. S., Cua, D. J., Powrie, F., Cheever, A. W., Maloy, K. J., Sher, A. (2006). IL-23 plays a key role in Helicobacter hepaticus-induced T cell-dependent colitis. JEM 203: 2485-2494 [Abstract] [Full Text]  
  • Hue, S., Ahern, P., Buonocore, S., Kullberg, M. C., Cua, D. J., McKenzie, B. S., Powrie, F., Maloy, K. J. (2006). Interleukin-23 drives innate and T cell-mediated intestinal inflammation. JEM 203: 2473-2483 [Abstract] [Full Text]  
  • Vojdani, A., Erde, J. (2006). Regulatory T Cells, a Potent Immunoregulatory Target for CAM Researchers: Modulating Allergic and Infectious Disease Pathology (II). Evid Based Complement Alternat Med 3: 209-215 [Abstract] [Full Text]  
  • Tomczak, M. F., Gadjeva, M., Wang, Y. Y., Brown, K., Maroulakou, I., Tsichlis, P. N., Erdman, S. E., Fox, J. G., Horwitz, B. H. (2006). Defective Activation of ERK in Macrophages Lacking the p50/p105 Subunit of NF-{kappa}B Is Responsible for Elevated Expression of IL-12 p40 Observed after Challenge with Helicobacter hepaticus. J. Immunol. 176: 1244-1251 [Abstract] [Full Text]  
  • Kamada, N., Hisamatsu, T., Okamoto, S., Sato, T., Matsuoka, K., Arai, K., Nakai, T., Hasegawa, A., Inoue, N., Watanabe, N., Akagawa, K. S., Hibi, T. (2005). Abnormally Differentiated Subsets of Intestinal Macrophage Play a Key Role in Th1-Dominant Chronic Colitis through Excess Production of IL-12 and IL-23 in Response to Bacteria. J. Immunol. 175: 6900-6908 [Abstract] [Full Text]  
  • Ge, Z., Feng, Y., Whary, M. T., Nambiar, P. R., Xu, S., Ng, V., Taylor, N. S., Fox, J. G. (2005). Cytolethal Distending Toxin Is Essential for Helicobacter hepaticus Colonization in Outbred Swiss Webster Mice. Infect. Immun. 73: 3559-3567 [Abstract] [Full Text]  
  • Pena, J. A., Rogers, A. B., Ge, Z., Ng, V., Li, S. Y., Fox, J. G., Versalovic, J. (2005). Probiotic Lactobacillus spp. Diminish Helicobacter hepaticus-Induced Inflammatory Bowel Disease in Interleukin-10-Deficient Mice. Infect. Immun. 73: 912-920 [Abstract] [Full Text]  
  • Roers, A., Siewe, L., Strittmatter, E., Deckert, M., Schluter, D., Stenzel, W., Gruber, A. D., Krieg, T., Rajewsky, K., Muller, W. (2004). T Cell-specific Inactivation of the Interleukin 10 Gene in Mice Results in Enhanced T Cell Responses but Normal Innate Responses to Lipopolysaccharide or Skin Irritation. JEM 200: 1289-1297 [Abstract] [Full Text]  
  • Drakes, M., Blanchard, T., Czinn, S. (2004). Bacterial Probiotic Modulation of Dendritic Cells. Infect. Immun. 72: 3299-3309 [Abstract] [Full Text]  
  • Kullberg, M. C., Andersen, J. F., Gorelick, P. L., Caspar, P., Suerbaum, S., Fox, J. G., Cheever, A. W., Jankovic, D., Sher, A. (2003). Induction of colitis by a CD4+ T cell clone specific for a bacterial epitope. Proc. Natl. Acad. Sci. USA 100: 15830-15835 [Abstract] [Full Text]  
  • Erdman, S. E., Rao, V. P., Poutahidis, T., Ihrig, M. M., Ge, Z., Feng, Y., Tomczak, M., Rogers, A. B., Horwitz, B. H., Fox, J. G. (2003). CD4+CD25+ Regulatory Lymphocytes Require Interleukin 10 to Interrupt Colon Carcinogenesis in Mice. Cancer Res. 63: 6042-6050 [Abstract] [Full Text]  
  • Higgins, S. C., Lavelle, E. C., McCann, C., Keogh, B., McNeela, E., Byrne, P., O'Gorman, B., Jarnicki, A., McGuirk, P., Mills, K. H. G. (2003). Toll-Like Receptor 4-Mediated Innate IL-10 Activates Antigen-Specific Regulatory T Cells and Confers Resistance to Bordetella pertussis by Inhibiting Inflammatory Pathology. J. Immunol. 171: 3119-3127 [Abstract] [Full Text]  
  • Tomczak, M. F., Erdman, S. E., Poutahidis, T., Rogers, A. B., Holcombe, H., Plank, B., Fox, J. G., Horwitz, B. H. (2003). NF-{kappa}B Is Required Within the Innate Immune System to Inhibit Microflora-Induced Colitis and Expression of IL-12 p40. J. Immunol. 171: 1484-1492 [Abstract] [Full Text]  
  • Myles, M. H., Livingston, R. S., Livingston, B. A., Criley, J. M., Franklin, C. L. (2003). Analysis of Gene Expression in Ceca of Helicobacter hepaticus-Infected A/JCr Mice before and after Development of Typhlitis. Infect. Immun. 71: 3885-3893 [Abstract] [Full Text]  
  • Avenaud, P., Le Bail, B., Mayo, K., Marais, A., Fawaz, R., Bioulac-Sage, P., Megraud, F. (2003). Natural History of Helicobacter hepaticus Infection in Conventional A/J Mice, with Special Reference to Liver Involvement. Infect. Immun. 71: 3667-3672 [Abstract] [Full Text]  
  • Erdman, S. E., Poutahidis, T., Tomczak, M., Rogers, A. B., Cormier, K., Plank, B., Horwitz, B. H., Fox, J. G. (2003). CD4+ CD25+ Regulatory T Lymphocytes Inhibit Microbially Induced Colon Cancer in Rag2-Deficient Mice. Am. J. Pathol. 162: 691-702 [Abstract] [Full Text]  
  • Maloy, K. J., Salaun, L., Cahill, R., Dougan, G., Saunders, N. J., Powrie, F. (2003). CD4+CD25+ TR Cells Suppress Innate Immune Pathology Through Cytokine-dependent Mechanisms. JEM 197: 111-119 [Abstract] [Full Text]  
  • Myers, K. J., Murthy, S., Flanigan, A., Witchell, D. R., Butler, M., Murray, S., Siwkowski, A., Goodfellow, D., Madsen, K., Baker, B. (2003). Antisense Oligonucleotide Blockade of Tumor Necrosis Factor-alpha in Two Murine Models of Colitis. J. Pharmacol. Exp. Ther. 304: 411-424 [Abstract] [Full Text]  
  • Kullberg, M. C., Jankovic, D., Gorelick, P. L., Caspar, P., Letterio, J. J., Cheever, A. W., Sher, A. (2002). Bacteria-triggered CD4+ T Regulatory Cells Suppress Helicobacter hepaticus-induced Colitis. JEM 196: 505-515 [Abstract] [Full Text]  
  • Balish, E., Warner, T. (2002). Enterococcus faecalis Induces Inflammatory Bowel Disease in Interleukin-10 Knockout Mice. Am. J. Pathol. 160: 2253-2257 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kullberg, M. C.
Right arrow Articles by Sher, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kullberg, M. C.
Right arrow Articles by Sher, A.