Previous Article | Next Article 
Infection and Immunity, July 2001, p. 4232-4241, Vol. 69, No. 7
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.7.4232-4241.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Helicobacter hepaticus-Induced Colitis in
Interleukin-10-Deficient Mice: Cytokine Requirements for the Induction
and Maintenance of Intestinal Inflammation
Marika C.
Kullberg,1,*
Antonio Gigliotti
Rothfuchs,1,
Dragana
Jankovic,1
Patricia
Caspar,1
Thomas A.
Wynn,1,2
Peter L.
Gorelick,3
Allen W.
Cheever,4 and
Alan
Sher1
Immunobiology Section1
and Schistosomiasis Immunology and Pathology
Unit,2 Laboratory of Parasitic Diseases,
National Institute of Allergy and Infectious Diseases, Bethesda,
Maryland 20892-0425; Animal Health Diagnostic Laboratory,
Laboratory Animal Sciences Program, National Cancer Institute-Frederick
Cancer Research and Development Center, Science Applications
International Corporation, Frederick, Maryland
21702-12013; and The Biomedical
Research Institute, Rockville, Maryland 208524
Received 6 February 2001/Returned for modification 15 March
2001/Accepted 9 April 2001
 |
ABSTRACT |
We have previously shown that specific-pathogen-free interleukin-10
(IL-10)-deficient (IL-10 KO) mice reconstituted with
Helicobacter hepaticus develop severe colitis associated
with a Th1-type cytokine response. In the present study, we formally
demonstrate that IL-12 is crucial for disease induction, because mice
deficient for both IL-10 and IL-12 p40 show no intestinal pathology
following H. hepaticus infection. By using monoclonal
antibodies (MAbs) to IL-12, gamma interferon (IFN-
), and tumor
necrosis factor alpha (TNF-
), we have further analyzed the role of
these cytokines in the maintenance of the Th1 response and inflammation
in IL-10 KO mice with established H. hepaticus-induced
colitis. Treatment of infected colitic IL-10 KO mice with anti-IL-12
p40 resulted in markedly reduced intestinal inflammation, colonic
IFN-
, TNF-
, and inducible nitric oxide synthase (iNOS) mRNA
levels, and H. hepaticus-specific IFN-
secretion by
mesenteric lymph node (MLN) cells compared to the findings in control
MAb-treated mice. Moreover, the diminished pathology was associated
with decreased numbers of colonic CD3+ T cells and
significantly reduced frequencies of
Helicobacter-reactive CD4+ Th1 cells in MLN.
In contrast, anti-IFN-
and/or anti-TNF-
had no effect on
intestinal inflammation in IL-10 KO mice with established colitis.
Using IL-10/IFN-
double-deficient mice, we further show that IFN-
is not required for the development of colitis follwing H.
hepaticus infection. MLN cells from infected IL-10/IFN-
KO animals secreted elevated amounts of IL-12 and TNF-
following bacterial antigen stimulation, indicating alternative pathways of
disease induction. Taken together, our results demonstrate a crucial
role for IL-12 in both inducing and sustaining intestinal inflammation
through recruitment and maintenance of a pool of pathogenic Th1 cells.
 |
INTRODUCTION |
Inflammatory bowel disease (IBD) is
thought to be the consequence of an aberrant mucosal immune response
that damages tissues of the intestinal tract (29, 35, 39).
From experiments with different animal models, it has become clear that
the intestinal flora play an essential role in triggering the disease
(2, 13, 33, 36, 42). This is also true for the
enterocolitis that spontaneously develops in interleukin-10
(IL-10)-deficient (IL-10 KO) mice in conventional animal facilities
(24), because these animals display less severe or no
disease when reared under specific-pathogen-free (SPF) or germfree
conditions (5, 37). That gut flora also play a role in
human IBD has been suggested by studies demonstrating associations
between various bacterial species and disease, either by direct
detection or by disease-associated antimicrobial immune responses
(6, 16, 35, 41, 43), as well as diminished inflammation
following antibiotic or probiotic treatment of patients with disease
(8, 20, 21, 32, 44).
To study how the gut flora may influence the development of intestinal
pathology in IL-10 KO mice, we analyzed SPF-reared IL-10-deficient mice
on the C57BL/10SgSnAi background following reconstitution with a
defined microbial agent, Helicobacter hepaticus. As early as
2 to 4 weeks after inoculation with this gram-negative bacterium, IL-10
KO animals displayed moderate to severe inflammation of the large bowel
that was associated with a Th1-type cytokine response by mesenteric
lymph node (MLN) cells stimulated in vitro with SHelAg, a soluble
H. hepaticus antigen (Ag) preparation (25). These intestinal lesions were absent in uninfected IL-10 KO controls as
well as in simultaneously infected wild-type (WT) mice, the latter
instead mounting an IL-10-dominated cytokine response to the bacterium
(25). The H. hepaticus-induced colitis in IL-10 KO mice was prevented by administration of monoclonal antibody (MAb) to
either IL-12 p40 or gamma interferon (IFN-
) from the start of the
infection, suggesting that interference with the development of the Th1
response to the bacterium or inhibition of the Th1-effector phase can
effectively block disease induction (25). Subsequent
studies (14) analyzing germfree IL-10 KO mice on a
C57BL/6 × 129/Ola background 9 weeks after bacterial exposure
have indicated that H. hepaticus may not be sufficient for
colitis induction and suggest the contribution of resident background
flora to the pathological response. Moreover, it is clear that other
bacterial species in the absence of H. hepaticus can also
trigger intestinal inflammation in IL-10-deficient mice (18,
37).
An important goal of IBD research is the development of effective
therapies for patients with Crohn's disease and ulcerative colitis.
Because a dysregulated cytokine response has been implicated in the
pathogenesis of IBD, it is important to know which of these factors are
critical for the maintenance of disease as they may offer new
approaches for therapy. Previous studies with murine colitis models
have suggested that the continuous presence of IL-12 is crucial for
sustaining the inflammatory response (10, 27). However,
its downstream IFN-
effector molecule does not appear to play as
important a role in disease maintenance (10, 19). The
latter observation seemed somewhat surprising, because preventive
treatment with anti-IFN-
MAb blocks the development of disease in
both spontaneous enterocolitis and the H. hepaticus-induced inflammation observed in IL-10 KO mice (5, 25).
In the present study, we have addressed the requirements for IL-12,
IFN-
, and TNF-
in disease maintenance in the H. hepaticus/IL-10 KO colitis model by performing in vivo
neutralization of cytokines. In addition, for the first time in studies
of IBD, we have employed double-cytokine-deficient mice to formally
address the roles of IL-12, IFN-
, and IL-4 in disease development.
Our data demonstrate that IL-12 is crucial for both induction and
maintenance of colitis following H. hepaticus inoculation of
IL-10-deficient mice. Moreover, while IFN-
may play a role in
disease induction, this cytokine is not required for the development of
colitis or for the ongoing inflammatory process after H. hepaticus infection. Instead, neutralization of IL-12 correlates
with reduced numbers of T cells infiltrating the intestine as well as
diminished frequencies of SHelAg-specific Th1 cells in MLN, suggesting
an important role for this cytokine in maintaining the pool of
pathogenic cells.
 |
MATERIALS AND METHODS |
Experimental animals and infections.
Six- to 12-week
old, female SPF C57BL/6NAi IL-4 KO, C57BL/10SgSnAi IL-10 KO, C57BL/6
IL-12 p40 KO (backcrossed to the 12th, 10th, and 5th generations,
respectively), C57BL/10SgSnAi WT, and double-deficient IL-10/IL-4 KO
and IL-10/IL-12 p40 KO mice (generated by crossing the above-mentioned
single-cytokine-deficient mice as described previously (22,
48) were obtained from Taconic Farms (Germantown, N.Y.). The
animals employed tested negative for antibodies to specific murine
viruses and were free of Helicobacter species as assessed by
PCR. The IL-4 KO and IL-10 KO lines were originally obtained from R. Kühn and W. Müller (University of Cologne, Cologne,
Germany), and the IL-12-deficient animals were obtained from J. Magram
(Hoffmann-La Roche, Inc., Nutley, N.J.). IL-10/IFN-
double-deficient
mice were generated by crossing C57BL/10Sg SnAi IL-10 KO males with
C57BL/6Ai IFN-
KO females (Taconic Farms), and the progeny were
intercrossed to generate IL-10/IFN-
KO offspring. All animals were
housed in sterile microisolator cages with autoclaved bedding, food,
and water at the animal facility at the National Institute of Allergy
and Infectious Diseases in accordance with the procedure outlined in
the Guide for the Care and Use of Laboratory Animals (26a)
under an animal study proposal approved by the National Institute of
Allergy and Infectious Diseases Animal Care and Use Committee.
Mice were inoculated intraperitoneally (i.p.) or intragastrically
(i.g.) with 0.5 ml of an H. hepaticus suspension (standard Frederick isolate 1A) (17, 45) prepared to a McFarland
turbidity standard of 1.0 in phosphate-buffered saline (PBS),
representing 2.45 × 109 CFU/ml. We have
previously demonstrated that these two routes of inoculation with
H. hepaticus result in the same intestinal histological
changes in IL-10 KO mice (25). The bacteria were confirmed
to be H. hepaticus by PCR before injection (4).
Age-matched uninfected animals were included as controls.
In vivo MAb treatment.
Four weeks after bacterial
inoculation, by which time colitis is established in IL-10 KO animals
(25), mice were injected i.p. every 3 to 4 days for 4 weeks with 1 mg of anti-IL-12 (MAb C17.8; initially provided by G. Trinchieri) (49), anti-IFN-
(XMG-6) (9),
anti-TNF-
(XT22-11) (1), a combination of anti-IFN-
and anti-TNF-
, or control MAb GL113 (anti-
-galactosidase) in 0.5 ml of PBS. All MAbs were purified from ascites fluid by two sequential
50% ammonium sulfate precipitations. Four days after the last MAb
injection, mice were sacrificed, MLN cells were collected for in vitro
culture, and intestinal tissues were collected for histology and
reverse transcriptase (RT)-PCR analysis.
Pathology and immunohistochemistry.
Tissues were fixed in
Bouin's fixative or 10% neutral buffered formalin, embedded in
paraffin, sectioned at 5 µm, and stained with hematoxylin and eosin
(H&E). A longitudinal section of the entire cecum was made together
with a cross section of the ascending colon about 1 cm from the cecum.
Sections were evaluated in a blinded fashion by the same pathologist
(A.W.C.), and an average score of what was seen throughout the whole
section was assigned based on a four-scale scoring system with emphasis
on the number of infiltrating cells in the lamina propria and the
number of crypt abscesses. Hyperplasia was evaluated by microscopic
examination of mucosal thickness with an ocular micrometer. A score of
0 denotes no inflammation with only a few infiltrating lymphocytes; 1 corresponds to a mild lesion equivalent to a one-cell-thick layer in
the lamina propria; 2 is roughly equivalent to an average two-cell
thickness of lymphocytes; 3 implies roughly a three-to-four-cell
thickness; and 4 is equivalent to a more-than-four-cell thickness or
the presence of severe lesions, such as ulcers or crypt abscesses. Results are presented as the mean score ± standard error (SE) of
3 to 5 mice/group. The absence of an error bar indicates that all
animals within a group had identical scores. In certain cases, histopathologic median and range values are also given.
Colonic tissues fixed in Bouin's fixative were used for
immunohistochemical staining of T cells with a polyclonal rabbit
anti-human
CD3 antibody (which cross-reacts with mouse CD3; DAKO Corp.,
Carpinteria,
Calif.) and an ABC Vectastain Elite kit (Vector
Laboratories,
Inc., Burlingame, Calif.) (
25).
Antigen preparation.
SHelAg was prepared from cultures of
H. hepaticus as described previously (25).
Briefly, the organisms were harvested and washed extensively in PBS
followed by sonication at 4°C to lyse the bacteria. Cell debris was
removed by centrifugation at 8,000 × g (Sorvall RC2-B,
SS-34 rotor) for 30 min at 4°C. The supernatant was sterile filtered,
protein content was determined by Bradford's technique (Pierce,
Rockford, Ill.), and the Ag was stored at
40°C until use.
Cell cultures and cytokine assays.
Single-cell suspensions
were prepared from MLN, and cells were resuspended in tissue culture
medium (RPMI 1640 supplemented with 10% heat-inactivated fetal calf
serum [FCS], 100 U of penicillin per ml, 100 µg of streptomycin per
ml, 2 mM glutamine, 20 mM HEPES, 1 mM sodium pyruvate, 0.1 mM
nonessential amino acids, and 50 µM 2-mercaptoethanol). Experiments
were performed with MLN suspensions from individual mice or with cells
pooled from 3 to 5 mice per group.
To measure cytokine responses, MLN cells (3 × 10
6/ml) were cultured in medium alone or with 0.3 µg of SHelAg per ml or plate-bound
anti-CD3 (2.5 µg/well; MAb
145-2C11; PharMingen, San Diego, Calif.)
in 24-well plates in a total
volume of 1 ml/well. In certain experiments,
anti-CD4 (GK1.5; rat
immunoglobulin G2b [IgG2b]; 10 µg/ml) (
12),
anti-CD8
(2.43; rat IgG2b; 10 µg/ml) (
34), or anti-IL-12 (C17.8;
rat IgG2a; 20 µg/ml) (
49) MAbs were added to parallel
SHelAg
cultures. Supernatants were collected 72 h later, and
IFN-

and
IL-12 were measured by enzyme-linked immunosorbent assay
(ELISA)
with MAb from PharMingen, while TNF-

was detected with a kit
from R&D Systems (Minneapolis, Minn.).
Intracellular staining for IFN-
.
Analysis of
intracellular cytokine expression was performed with cells from the
same SHelAg-stimulated cultures used in the cytokine secretion assays
according to a previously described protocol (23).
Briefly, MLN cells were incubated for an additional 18 h in fresh
medium added to replace the culture supernatant collected at 72 h.
Thereafter, cells were stimulated in 1-ml cultures in 24-well plates
coated overnight with 2.5 µg of anti-CD3 per well (145-2C11;
PharMingen). Nine hours later, brefeldin A (10 µg/ml; Sigma, St
Louis, Mo.) was added, and after 5 h, cells were washed once in
RPMI, stained with Cy-chrome-labeled anti-CD4 (RM4-5; PharMingen), and
fixed for 15 min in 2% paraformaldehyde (Sigma) at room temperature.
After 30 min of incubation in permeabilization buffer (PBS containing
0.1% saponin [Calbiochem-Novabiochem. Corp., La Jolla, Calif.],
0.1% FCS, and 20 mM HEPES) with 10% normal mouse serum and
anti-Fc
RII/III (2.4G2; 5 µg/ml; PharMingen) at 4°C, cells were
stained for 30 min with pretitrated phycoerythrin (PE)-labeled
anti-IFN-
(XMG1.2; PharMingen) at 4°C, washed twice with
permeabilization buffer, and resuspended in PBS plus 0.5% FCS. Cell
fluorescence was measured with a FACScan flow cytometer, and data were
analyzed with CellQuest software (Becton Dickinson).
RT-PCR and Southern blotting for detection of cytokine mRNA.
Since in general, the degree of inflammation in the colon was found to
proportionally reflect that observed in the cecum, the colon was chosen
for RT-PCR analyses to avoid lymphocyte patches present irregularly
throughout the cecum while preserving the intact cecum for histological
examination. Colonic tissue (3 to 5 mm of ascending colon) was
homogenized in RNA STAT-60 (Tel-Test, Friendswood, Tex.) with a tissue
Polytron (Omni, Waterbury, Conn.), and total RNA was isolated as
recommended by the manufacturer. An RT-PCR procedure was performed to
determine relative quantities of mRNA for various cytokines (46,
47). Briefly, 1 µg of RNA was reverse transcribed with random
hexamer oligonucleotides (Boehringer Mannheim, Indianapolis, Ind.) and
Superscript II RT (GIBCO BRL, Gaithersburg, Md.). cDNA was then
amplified with specific primer pairs for IFN-
(32 cycles), TNF-
(28 cycles), inducible nitric oxide synthase (iNOS) (26 cycles), or the
housekeeping gene hypoxanthine phosphoribosyltransferase (HPRT; 24 cycles) by using Taq DNA polymerase and deoxynucleotide
triphosphates (both from GIBCO BRL). After an initial incubation at
95°C for 3 min, temperature cycling was initiated as follows: 94°C
for 2 min, 54°C for 2 min, and 72°C for 3 min. An additional
extension for 5 min was performed at the end of the last cycle. For the
experiment shown in Fig. 8C to E, 1 min was used at the 94 and 54°C
steps, and 30 cycles were used for TNF-
. PCR products were
electrophoresed in a 1.5% agarose gel and then transferred onto
Hybond-N+ nylon membranes (Amersham, Little Chalfont, United Kingdom),
followed by hybridization with specific fluorescein-labeled probes
(46, 47). Blots were developed with the ECL enhanced
chemiluminescence detection system (Amersham) and exposed to
autoradiographic film (ECL-Hyperfilm; Amersham). The signal intensities
of bands were scanned, and the optical density was quantified with NIH
Image sortware (National Institutes of Health, Bethesda, Md.). The
primers and probes were as follows: HPRT sense,
GTTGGATACAGGCCAGACTTTGTTG; HPRT antisense,
GATTCAACTTGCGCTCATCTTAGGC; HPRT probe,
GTTGTTGGATATGCCCTTGAC; IFN-
sense,
TACTGCCACGGCACAGTCATTGAA; IFN-
antisense,
GCAGCGACTCCTTTTCCGCTTCCT; IFN-
probe,
GGAGGAACTGGCAAAAGGA; TNF-
sense,
GATCTCAAAGACAACCAACTAGTG; TNF-
antisense,
CTCCAGCTGGAAGACTCCTCCCAG; TNF-
probe,
CCCGACTACGTGCTCCTCACC; iNOS sense,
CCCTTCCGAAGTTTCTGGCAGCAGC; iNOS antisense,
GGCTGTCAGAGCCTCGTGGCTTTGG; iNOS probe, CAAGGTCTACGTTCAGGACATC.
Statistical analysis.
The statistical significance of
differences in cytokine expression between groups was evaluated by
using Student's two-tailed t test. Comparison of grades of
inflammation between the groups was performed by nonparametric
Wilcoxon-Mann-Whitney test.
 |
RESULTS |
IL-10/IL-12 double-deficient mice fail to develop colitis
after H. hepaticus infection, while IL-10/IL-4 KO
animals are as susceptible to disease as IL-10 KO mice.
We have
previously shown that SPF-reared IL-10 KO mice develop colitis after
experimental infection with H. hepaticus and that the
disease is dramatically reduced when the animals are treated with
anti-IL-12 or anti-IFN-
MAb from the start of the infection
(25). To formally investigate the role of IL-12 in disease
induction, we here analyzed intestinal pathology in mice doubly
deficient for IL-10 and IL-12 that were infected with H. hepaticus for 5 weeks. As shown in Fig.
1A, while infected IL-10 KO mice
displayed severe intestinal pathology, IL-10/IL-12 double-deficient animals showed no disease after bacterial inoculation, and their cecal
histological scores were comparable to those of WT controls as well as
single IL-12 KO mice. While these data obtained from a single time
point postinfection do not rule out the possibility of later
compensatory mechanisms, they indicate at the very minimum that IL-12
is crucial for initial disease induction.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 1.
H. hepaticus does not trigger colitis in
IL-10/IL-12 double-deficient mice. WT, IL-10 KO, IL-10/IL-12 KO, IL-12
KO, IL-10/IL-4 KO, and IL-4 KO animals were infected i.g. with
H. hepaticus (black bars), and intestinal pathology and
cytokine responses were analyzed 5 weeks later. Gray bars represent
uninfected controls. (A) Inflammation in the cecum (typhlitis). Bars
represent mean histology scores ± SE of four mice/group, with a
median value for infected IL-10 KO of 3 (all mice scored as 3) and that
of infected IL-10/IL-4 KO of 3.5 (range, 2 to 4). Similar results were
observed for the colon, although scores were lower (not shown). (B)
IFN- levels detected in 72-h supernatants from MLN cells (3 × 106/ml) stimulated with 0.3 µg of SHelAg per ml. Bars
represent means ± standard deviations of duplicate ELISA values
from MLN cells pooled from 4 mice/group. No IFN- was detected from
cells cultured in medium alone.
|
|
To examine if IL-4 plays a protective role in our model of colitis,
mice deficient in this cytokine were analyzed in parallel.
In contrast
to IL-10-deficient mice, however, IL-4 KO mice showed
no intestinal
pathology upon
H. hepaticus infection, and as expected,
only
IL-4-deficient mice also lacking IL-10 developed colitis
after
inoculation with the bacterium (Fig.
1A). Our previous findings
demonstrated a strong association between
Helicobacter-induced
colitis in IL-10 KO mice and a
Th1-cytokine response to SHelAg
(
25). This pattern was
confirmed in the present study, because
only MLN cells from
cytokine-deficient mice with disease responded
with significant IFN-

production to SHelAg stimulation (Fig.
1B).
Anti-IL-12 treatment of H. hepaticus-infected IL-10
KO mice with established disease reduces intestinal inflammation.
To investigate the role of IL-12 in the maintenance of established
H. hepaticus-induced colitis, IL-10 KO mice infected 4 weeks
earlier were treated every 3 to 4 days with 1 mg of neutralizing anti-IL-12 p40 MAb. After 4 weeks of treatment, mice were sacrificed, and large bowel inflammation was scored. Infected animals treated with
anti-IL-12 showed a marked reduction in cecal inflammation (typhlitis)
compared to mice receiving control MAb (Fig.
2A). The diminished inflammation observed
in anti-IL-12-treated infected mice was characterized by diminished
hyperplasia and reduced numbers of infiltrating cells in the lamina
propria compared to those in animals receiving control MAb (Fig.
3).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Treatment with anti-IL-12 diminishes established
H. hepaticus-induced colitis and SHelAg-induced IFN-
responses in IL-10 KO mice. IL-10 KO mice were infected i.p. with
H. hepaticus (black bars). Four weeks later, animals
were treated with anti-IL-12 or control MAb for an additional 4 weeks
before analysis. Uninfected (Uninf.) IL-10 KO mice (gray bars) were
included as controls. (A) Pathology in the cecum. Bars represent mean
histology scores ± SE of individual mice from three separate
experiments with uninfected (n = 6), infected
control MAb-treated (n = 9), and infected
anti-IL-12-treated (n = 9) IL-10 KO mice. Median
scores for the different groups were as follows: uninfected = 1 (range, 1 to 2), infected plus control MAb = 4 (range, 3 to 4),
and infected plus anti-IL-12 = 2 (all mice scored as 2). Similar
results were observed for the colon, although scores were lower (data
not shown) (Fig. 8). Comparable effects of anti-IL-12 treatment on
pathology were seen in a separate experiment (not shown) in which mice
were infected by the i.g. route. (B and C) IFN- levels detected in
72-h supernatants from MLN cells (3 × 106/ml)
stimulated with plate-bound anti-CD3 (B) or 0.3 µg of SHelAg per ml
(C). Bars represent means ± SE of ELISA values from individual
MLN cell suspensions from mice in two of the three experiments shown in
panel A in which anti-CD3 and SHelAg stimulations were performed. No
IFN- was detected from cells cultured in medium alone.
|
|

View larger version (106K):
[in this window]
[in a new window]
|
FIG. 3.
Reduced intestinal pathology after anti-IL-12 treatment
of IL-10 KO mice with established H. hepaticus-induced
cecal lesions. IL-10 KO mice were infected with H.
hepaticus and treated with anti-IL-12 or control MAb between
weeks 4 and 8 of infection. Shown are representative ceca of an
uninfected IL-10 KO mouse (A) or infected IL-10 KO mouse treated with
control MAb (B) or anti-IL-12 (C). All sections shown were located in
the mid-cecum 1 to 1.5 cm from the cecal-colic junction on a
longitudinal section of the entire cecum and represent scores of 1.0 (A), 3.5 (B), and 2.0 (C). Formalin-fixed tissues were stained with
H&E. Magnification, ×110.
|
|
Diminished colitis in anti-IL-12-treated IL-10 KO mice with
established disease correlates with reduced
Helicobacter-associated Th1-cytokine responses in vitro
and in vivo.
To further characterize the immune response in
infected IL-10 KO mice with reduced intestinal inflammation after
anti-IL-12 treatment of established disease, we measured IFN-
as a
marker of a Th1 response after in vitro stimulation of MLN cells with anti-CD3 or SHelAg. As previously reported for IL-10-deficient mice
with spontaneous enterocolitis (10), MLN cells from
anti-IL-12- and control MAb-treated IL-10 KO animals with established
H. hepaticus-induced intestinal inflammation secreted
comparable amounts of IFN-
following anti-CD3 stimulation (Fig. 2B).
Importantly, however, while infected control MAb-treated animals
displayed a strong SHelAg-induced IFN-
response, infected mice
receiving anti-IL-12 secreted significantly reduced levels of this
cytokine following bacterial Ag stimulation (Fig. 2C).
To analyze cytokine responses at the site of inflammation, ascending
colon samples were collected, and various cytokines were
analyzed by
RT-PCR. Figure
4 shows pooled data from
three independent
experiments in which such analysis was performed.
Compared to
uninfected mice, infected animals treated with control MAb
showed
markedly increased mRNA levels of IFN-

, TNF-

, and iNOS
(Fig.
4). More importantly, however, infected IL-10 KO animals
receiving
anti-IL-12 once disease was established showed significantly
reduced
levels of mRNA for IFN-

, TNF-

, and iNOS compared to the
control
MAb-treated animals (Fig.
4), suggesting a wholesale decrease
in Th1-cell activity in these mice after anti-IL-12 treatment.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 4.
IFN- , TNF- , and iNOS mRNA expression in colon of
anti-IL-12-treated H. hepaticus-infected IL-10 KO mice.
Colonic tissues from uninfected or H. hepaticus-infected
IL-10 KO mice treated with control MAb or anti-IL-12 between weeks 4 and 8 of infection were collected and processed for RT-PCR analysis of
IFN- , TNF- , iNOS, and HPRT. (A) The results shown are
autoradiographs after hybridization of PCR products with probes
specific for IFN- , TNF- , iNOS, or HPRT. (B) The intensities of
the bands in panel A were measured, the cytokine/HPRT ratio was
calculated for each mouse, and the mean ± SE for each group was
determined. ND, not detected. Data are from the same individual mice in
the three separate experiments shown in Fig. 2, with the exception of
one anti-IL-12-treated mouse from which RNA preparation was not
successful. * and #, P < 0.001 and
P = 0.039, respectively, compared to control
MAb-treated group. It should be noted that the data do not allow
quantitative comparison between the cytokines, but only comparison of
the same cytokine among groups of mice.
|
|
Anti-IL-12 treatment of IL-10 KO mice with established disease
reduces the number of colonic CD3+ T cells and the
frequency of Helicobacter-reactive IFN-
-producing
CD4+ Th1 cells.
IL-12 is known to be required for
optimal IFN-
production by CD4+ T cells.
Similarly, the SHelAg-induced IFN-
response by MLN cells from
infected IL-10 KO mice was shown to be dependent on CD4+ cells as well as IL-12, because addition of
either anti-CD4 or anti-IL-12, but not anti-CD8 MAb to cultures
completely abrogated the response (Fig.
5). Thus, to assess whether the reduced
Th1-cell activity in animals treated in vivo with anti-IL-12 was due to blocking the ability of T cells to secrete cytokines and/or to a
decrease in T-cell numbers, we performed immunohistochemical staining
for CD3+ T cells on colonic tissue sections. Data
from three independent experiments (n = 6 mice/group)
showed that, compared to uninfected controls (12.5 ± 3.5 CD3+ cells/×40 field), infected IL-10 KO mice
treated with control MAb showed an increase in the number of colonic T
cells (38.0 ± 7.2 CD3+ cells/×40 field),
and this number was significantly reduced in anti-IL-12-treated
infected mice (20.3 ± 4.5 CD3+ cells/×40
field; P = 0.023 compared to control MAb-treated
group). The colonic sections of infected control MAb-treated mice were characterized by hyperplasia and areas of higher T-cell density distributed irregularly throughout the lamina propria (Fig.
6). In colon sections of
anti-IL-12-treated mice, these accumulations of
CD3+ T cells were absent and reduced hyperplasia
was observed (Fig. 6).

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 5.
IL-12 and CD4 cell dependence of SHelAg-induced IFN-
responses in H. hepaticus-infected IL-10 KO mice. IL-10
KO mice were infected i.p. with H. hepaticus, and
cytokine responses were analyzed 7 weeks later. MLN cells (3 × 106/ml) were cultured in medium alone or with 0.3 µg of
SHelAg per ml without or with the addition of anti-CD4, anti-CD8 (both
at 10 µg/ml), or anti-IL-12 (20 µg/ml) as indicated. IFN- levels
were measured in 72-h supernatants. Bars represent means ± standard deviations of duplicate ELISA values. The data shown are from
one representative experiment of six performed (with 4- to
9-week-infected mice).
|
|

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 6.
Immunostaining for CD3+ cells in colons of
IL-10 KO mice, all with hematoxylin counterstain. IL-10 KO mice were
infected with H. hepaticus and treated with anti-IL-12
or control MAb between weeks 4 and 8 of infection. Shown are
representative colon sections of an uninfected IL-10 KO mouse (A) or
infected IL-10 KO mouse treated with control MAb (B) or anti-IL-12 (C).
Magnification, ×125.
|
|
To analyze the effect of anti-IL-12 treatment on the generation of
Helicobacter-reactive Th1 cells, the presence of
IFN-

-producing
SHelAg-reactive CD4
+ cells in
MLN was analyzed by intracellular cytokine staining.
After one round of
in vitro stimulation of MLN cells with SHelAg,
the frequency of
IFN-

-producing CD4
+ cells in cultures from
infected control MAb-treated mice was
approximately sixfold increased
compared to that of cells from
uninfected animals (Fig.
7). Importantly, this frequency was
significantly
decreased in infected anti-IL-12-treated mice (Fig.
7).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 7.
Diminished frequency of SHelAg-induced
IFN- -expressing CD4+ T cells in H.
hepaticus-infected IL-10 KO mice treated with anti-IL-12. MLN
cells from uninfected (Uninf.) or H. hepaticus-infected
IL-10 KO mice treated with control MAb or anti-IL-12 between weeks 4 and 8 of infection were cultured for 72 h with SHelAg followed by
overnight incubation in medium alone. Thereafter, cells were stimulated
for 9 h with plate-bound anti-CD3 followed by an additional 5 h in the presence of brefeldin A. The cells were then stained with
Cy-chrome-labeled anti-CD4 followed by PE-labeled anti-IFN- and
analyzed by flow cytometry. Each dot indicates the percentage of
CD4+ cells expressing IFN- from an individual mouse. The
data are pooled from four separate experiments.
|
|
Anti-IFN-
and/or anti-TNF-
treatment of IL-10 KO mice does
not ameliorate established intestinal inflammation.
We have
previously shown that treatment with neutralizing anti-IFN-
from the
start of the infection inhibits the development of colitis in IL-10 KO
mice inoculated with H. hepaticus (25). To
investigate the role of IFN-
in disease maintenance, we treated colitic IL-10 KO mice with a MAb to this cytokine between weeks 4 and 8 of the infection. In contrast to anti-IL-12-treated animals, infected
IL-10 KO mice treated in parallel with neutralizing anti-IFN-
showed
no or only minimal reduction in intestinal inflammation (cecal scores:
uninfected, 1.5 ± 0.7; infected, 4.0 ± 0; infected plus
control MAb, 3.8 ± 0.5; infected plus anti-IL-12, 2.0 ± 0; infected plus anti-IFN-
, 3.0 ± 1.2; n = 4 mice/group). The anti-IFN-
-treated mice also had similar or
increased SHelAg-stimulated IFN-
responses compared to control
MAb-treated animals as measured in supernatants from MLN cultures or by
intracellular staining (not shown). One possible explanation for these
results could be that blockade of other Th1 cytokines, in particular
TNF-
, is required to reduce pathology. Thus, to explore this
possibility, a separate experiment was performed in which groups of
five mice were treated with anti-IL-12, anti-IFN-
, anti-TNF-
, or
a combination of anti-IFN-
and anti-TNF-
between weeks 4 and 8 of
H. hepaticus infection. When histology scores were analyzed,
only the group treated with anti-IL-12 showed a reduction in intestinal
inflammation (Fig. 8A and B). The same pattern was observed when cytokine mRNA levels were analyzed at the
site of inflammation. Thus, only the group given anti-IL-12 showed a
significant reduction in colonic mRNA levels for IFN-
, TNF-
, and
iNOS, while anti-IFN-
and/or anti-TNF-
treatment had no effect on
the mRNA levels of these factors (Fig. 8C to E).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 8.
Treatment with anti-IFN- and/or anti-TNF- has no
effect on established H. hepaticus-induced intestinal
inflammation in IL-10 KO mice. IL-10 KO mice were infected with
H. hepaticus and treated with the indicated MAb between
weeks 4 and 8 of infection. Uninfected (Uninf.) animals were included
as controls. Four days after the last MAb injection, mice were
sacrificed, and intestinal inflammation and colonic cytokine mRNA
levels were determined. (A and B) Pathology in the cecum (A) and
ascending colon (B). Bars represent mean histology scores ± SE of
5 mice/group. Median scores for the cecum and colon for the different
groups were as follows: uninfected = 1 (range, 0.5 to 1) and 0.5 (range, 0 to 1), infected plus control MAb = 4 (range, 2 to 4) and
1 (range, 0.5 to 4), infected plus anti-IL-12 = 2 (range, 1 to 2)
and 0.5 (range, 0 to 2), infected plus anti-IFN- = 3 (range, 2 to 4) and 1.5 (range, 1 to 2), infected plus anti-TNF- = 2 (range, 2 to 4) and 1 (range, 1 to 2.5), and infected plus anti-IFN-
plus anti-TNF- = 4 (range, 3 to 4) and 1 (range, 0.5 to 4). (C
to E) RT-PCR analysis of IFN- (C), TNF- (D), and iNOS (E) mRNA
levels in colon expressed as a cytokine/HPRT ratio for each mouse as
described in the legend to Fig. 4. Bars represent mean values ± SE of 5 mice/group. , anti; ND, not detected.
|
|
IFN-
is not absolutely required for the development of H.
hepaticus-induced colitis.
As shown in our original study,
treatment with anti-IFN-
blocks intestinal inflammation when given
to IL-10 KO mice between weeks 0 and 4 of H. hepaticus
infection (25). Our present data suggest a less important
role for IFN-
once disease is established, because IL-10-deficient
mice given anti-IFN-
between weeks 4 and 8 of infection showed no
reduction in intestinal pathology. To analyze if
Helicobacter-induced colitis can develop in the absence of
IFN-
, we next analyzed H. hepaticus infection in
IL-10/IFN-
double-deficient mice and found that these IL-10/IFN-
KO animals were as susceptible to disease as IL-10 single-deficient
mice (Fig. 9A). Histological examination
revealed no evident differences in terms of cell types infiltrating the
intestine in the two groups of colitic mice (not shown). These data
suggested to us the existence of alternative pathways for the
development of colitis following H. hepaticus infection. As
expected, MLN cells from infected IL-10 KO mice secreted large amounts
of IFN-
when SHelAg-induced Th1-cytokine responses were analyzed
(Fig. 9B). Importantly, MLN cells from infected IL-10/IFN-
-deficient
mice produced IL-12 following SHelAg stimulation in amounts comparable
to those of infected IL-10 KO animals (Fig. 9C). Moreover, the
IL-10/IFN-
KO mice showed a dramatically increased SHelAg-specific
TNF-
response compared to that of the IL-10-deficient animals (Fig.
9D).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 9.
IL-10/IFN- KO mice develop colitis following
inoculation with H. hepaticus. WT, IL-10 KO, IL-10/IL-12
KO, and IL-10/IFN- KO animals were infected i.g. with H.
hepaticus (black bars), and intestinal pathology and cytokine
responses were analyzed 4 weeks later. Gray bars represent uninfected
controls. (A) Pathology in the cecum. Bars represent mean histology
scores ± SE of 3 to 5 mice/group, with the following median
values for infected mice: WT = 1 (all mice scored as 1, n = 3), IL-10 KO = 3 (range, 3 to 3.5, n = 4), IL-10/IL-12 KO = 1 (range, 1 to 1.5, n = 4), and IL-10/IFN- KO = 4 (range, 3 to
4, n = 5). Similar results were observed for colon,
although scores were lower (not shown). (B to D) IFN- (B), IL-12
(C), and TNF- (D) levels detected in 72-h supernatants from MLN cell
cultures stimulated with SHelAg. Bars represent means ± SD of
duplicate ELISA values from MLN cells pooled from 3 to 5 mice/group.
The data shown are from one representative experiment of two performed.
ND, not detected. No IFN- , IL-12, or TNF- was detected from cells
cultured in medium alone, and no IL-4 was detected in supernatants from
SHelAg-stimulated cultures.
|
|
 |
DISCUSSION |
In the present study, we have demonstrated a crucial role
for IL-12 in both disease induction and maintenance in the murine model
of IBD involving H. hepaticus infection of IL-10 KO mice. The mechanism by which IL-12 exerts its function involves the generation and maintenance of pathogenic Th1 cells as well as sustaining their numbers at the site of inflammation.
We have previously shown that administration of anti-IL-12 or
anti-IFN-
MAb from the start of the infection prevents colitis in
IL-10 KO animals receiving H. hepaticus (25).
To further investigate the requirement for these cytokines in disease
induction, we have utilized for the first time in studies of IBD mice
doubly deficient for IL-10 and IL-12, IL-10 and IFN-
, and IL-10 and IL-4. The IL-10/IL-12 double-deficient mice showed no intestinal pathology after H. hepaticus inoculation, and levels of
IFN-
were undetectable in culture supernatants from MLN cells
stimulated with SHelAg. In contrast, both IL-10/IFN-
- and
IL-10/IL-4-deficient animals developed colitis following H. hepaticus challenge. Importantly, H. hepaticus
infection of IL-4 KO mice did not result in intestinal inflammation,
confirming that IL-10, and not IL-4, is the critical cytokine for
protection against Helicobacter-induced colitis, as well as
demonstrating that IL-4 is not required for the generation of this
IL-10-dependent mechanism.
To evaluate the importance of IL-12 for disease maintenance, 4-week
H. hepaticus-infected IL-10 KO animals were treated with MAb
to this cytokine for an additional 4 weeks before intestinal pathology
was analyzed. Following this protocol, anti-IL-12-treated infected
IL-10 KO mice showed a significant reduction in intestinal inflammation
compared to control MAb-treated animals. These results agree with those
of Neurath et al. (27) and Davidson et al. (10), who demonstrated a role for anti-IL-12 in reversing
2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis in
BALB/c mice and the spontaneous enterocolitis of IL-10 KO mice,
respectively. The reduced pathology observed after anti-IL-12 treatment
of H. hepaticus-infected IL-10 KO mice with established
colitis correlated with reduced levels of mRNA for IFN-
, TNF-
,
and iNOS in the colon. That anti-IL-12 was not merely acting by
blocking cytokine secretion by Th1 cells was confirmed by
immunohistochemical staining of colon showing reduced numbers of lamina
propria-infiltrating CD3+ cells in the mice
receiving anti-IL-12 MAb. An additional piece of evidence linking the
presence of H. hepaticus-reactive pathogenic Th1 cells with
intestinal disease was the finding of significantly reduced frequencies
of SHelAg-specific IFN-
-secreting CD4+ T
lymphocytes in MLN of anti-IL-12-treated infected mice recovering from
colitis. Importantly, analysis of culture supernatants from these MLN
cells stimulated in vitro with SHelAg showed a significantly diminished
IFN-
response to the bacterium, but not to anti-CD3 stimulation,
implying selective loss of H. hepaticus-specific CD4+ T lymphocytes. Fuss et al. (19)
have reported that the main effect of anti-IL-12 on established TNBS
colitis is the induction of Fas-mediated apoptosis of the Th1 cells
causing inflammation. Although we cannot rule out that anti-IL-12
induced apoptosis in our model as well, attempts to detect terminal
deoxynucleotidyltransferase-mediated deoxyuridine triphosphate nick
end-labeling (TUNEL)-positive cells in the anti-IL-12-treated mice in
the present study have so far been unsuccessful. It is also important
to point out that the recently described cytokine IL-23, composed of
the p19 protein in combination with the p40 subunit of IL-12, induces
strong proliferation of mouse memory CD4+ T cells
(28). Thus, it is possible that the beneficial effect of
the anti-IL-12 p40 MAb used in these and previous colitis studies is
associated with its ability to neutralize IL-23.
In the case of TNBS colitis, anti-IL-12 treatment frequently abrogated
the established inflammation completely (27). In contrast,
we observed that Helicobacter-infected anti-IL-12-treated IL-10 KO mice showed some degree of residual inflammation compared to
uninfected controls. Even if the anti-IL-12 treatment was continued for
six additional injections (total of 7 weeks of MAb treatment of
established colitis), no further reduction in pathology was observed
(not shown). Similar results have been reported for the spontaneous
enterocolitis in IL-10 KO mice in which anti-IL-12 treatment, either
alone or combined with daily administrations of recombinant
IL-10, did not reverse disease completely (10). One
important difference between the colitis models triggered by TNBS
versus those triggered by bacterial flora is the continuous presence of
the agent provoking disease. Thus, in the case of colitis induced by
TNBS, this molecule is given at a single time and subsequently
disappears from the body. In contrast, in the IL-10 KO colitis model,
H. hepaticus or other flora are continuously present,
thereby constantly recruiting new bacterium-specific Th cells from the
pool of naïve cells. Consequently, it may not be surprising
that, although ameliorating disease, anti-IL-12 administration will not
reduce the inflammation to levels observed in uninfected mice, because
this treatment preferentially affects activated T cells.
To further dissect the mechanism behind disease reversal following
anti-IL-12 treatment, we used neutralizing MAbs to IFN-
and/or
TNF-
in vivo. However, neither MAb, alone or in combination, reduced
the inflammation in infected IL-10 KO mice with established disease.
Although we cannot exclude the possibility that IFN-
and TNF-
were not completely neutralized in these experiments, the inability of
anti-IFN-
and anti-TNF-
to reverse disease is consistent with
findings from other colitis models in which these MAbs were tested
separately (5, 10, 19, 31). Similar to our data obtained
with anti-IFN-
, we have found that treatment of IL-10 KO mice with
one of the iNOS inhibitors aminoguanidine or
L-N6-(1-iminoethyl)-lysine
(L-NIL) from the start of H. hepaticus infection blocked the
development of colitis, whereas administration of aminoguanidine to
IL-10 KO mice with established disease had no effect (A.G.R. and
M.C.K., unpublished results). Thus, it appears that neutralization of
cytokines produced by T cells (such as IFN-
and TNF-
) and their
downstream effectors (e.g., NO) is not enough to block the inflammatory
process once established. Rather, the absolute number of pathogenic Th1
cells would have to be diminished in order to reduce the inflammation.
The precise mechanism by which these intestinal T cells sustain the
inflammation remains unknown. Using the TNBS colitis model,
Stüber et al. (40) have demonstrated that the
CD40-CD40L interaction is crucial for the in vivo priming of Th1 cells
via the stimulation of IL-12 secretion by antigen-presenting cells
(APCs). Recent data have shown that blockade of the CD40-CD40L
interaction by anti-CD154 MAb is efficient also in reducing established
colitis in T-cell-reconstituted SCID or RAG KO mice and in bone
marrow-transplanted Tg
26 mice (11, 26). The authors
reported reduced IL-12 production and speculate that the anti-CD154
treatment blocks T cells in their ability to activate APC, thereby
impairing the development of colitis, possibly through interference
with T-cell-dependent macrophage activation and/or cytokine secretion.
Our finding that IL-10/IFN-
double-deficient mice were as
susceptible to Helicobacter-induced colitis as IL-10 KO
animals indicates that IFN-
is not required for disease induction.
Similarly, in the two colitis models of Tg
26 mice and
CD45RBhi cell transfer into RAG KO mice,
recipients reconstituted with T cells from IFN-
KO animals developed
intestinal inflammation comparable in severity to that observed in mice
receiving wild-type cells (38). IFN-
also appears to be
dispensable for disease induction in the TNBS colitis model, because
both BALB/c IFN-
KO and 129/Sv/Ev IFN-
R1 KO mice developed
disease following administration of this hapten (7, 15).
Despite the absence of IFN-
, the intestinal inflammation in H. hepaticus-infected IL-10/IFN-
KO animals was characterized by
the same type of cell infiltrates as those of single IL-10-deficient
mice. In addition, both strains of mice displayed a Th1 response to the
bacterium. The discrepancy between the IL-10/IFN-
KO animal
experiments and our initial observation that anti-IFN-
MAb given to
IL-10 KO mice blocks disease when given from the start of the infection
could possibly be explained by the qualitatively different cytokine
profiles mounted by these two mouse strains. Thus, in IL-10 KO mice,
IFN-
may be the crucial cytokine for disease development, while in IL-10/IFN-
KO animals, TNF-
may play the important role, because this is the dominant cytokine produced after encounter with the bacterium. Importantly, MLN cells from both colitic IL-10 KO and IL-10/IFN-
KO mice infected with H. hepaticus secreted
IL-12 following SHelAg stimulation, suggesting an important function for this cytokine in disease induction regardless of the absence or
presence of IFN-
.
In humans, anti-TNF-
therapy appears to be the most effective
treatment to date for patients with Crohn's disease and ulcerative colitis (3). Interestingly, in a recent report, the
beneficial effects of anti-TNF-
treatment were described as being
attributed not merely to TNF neutralization, but rather to a more
general effect on T lymphocytes, raising new possibilities of combined anticytokine and anti-T-cell strategies to treat these chronic diseases
(30). Similarly, data from several different colitis models have now demonstrated that neutralization of cytokines produced
by T cells may not be sufficient to block an ongoing inflammatory
process in the gut. Rather, it appears crucial to reduce the number of
pathogenic cells at the site of inflammation to see improvement of
disease. Our data are consistent with these conclusions and add a
further dimension to the scenario by demonstrating a reduction in
H. hepaticus-reactive, presumably pathogenic
CD4+ Th1 cells in MLNs of mice recovering from
colitis. Further studies on the nature and mechanism of action of these
bacteria-reactive T lymphocytes may lead to new strategies for
therapeutic interventions involving targeting of microbe-specific T
cells in the treatment of patients with IBD.
 |
ACKNOWLEDGMENTS |
We are grateful to Sara Hieny for preparation of anti-cytokine
MAbs used for in vivo neutralizations, Barbara Kasprzak for assistance
with immunohistochemical stainings, Ricardo Dreyfuss for help with
photomicrographs, and Shyla Jagannatha for helpful assistance with
statistical evaluation of our data. We also thank Ivan Fuss, Warren
Strober, Jerrold Ward, and George Yap for helpful discussions and for
critical reading of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Immunobiology
Section, Laboratory of Parasitic Diseases, National Institute of
Allergy and Infectious Diseases, National Institutes of Health,
Building 4, Room 126, 4 Center Dr., Bethesda, MD 20892-0425. Phone:
(301) 496-8218. Fax: (301) 402-0890. E-mail:
mkullberg{at}niaid.nih.gov.
Present address: Microbiology and Tumorbiology Center, Karolinska
Institutet, SE-171 77 Stockholm, Sweden.
Editor:
W. A. Petri Jr.
 |
REFERENCES |
| 1.
|
Abrams, J. S.,
M. G. Roncarolo,
H. Yssel,
U. Andersson,
G. J. Gleich, and J. E. Silver.
1992.
Strategies of anti-cytokine monoclonal antibody development: immunoassay of IL-10 and IL-5 in clinical samples.
Immunol. Rev.
127:5-24[CrossRef][Medline].
|
| 2.
|
Aranda, R.,
B. C. Sydora,
P. L. McAllister,
S. W. Binder,
H. Y. Yang,
S. R. Targan, and M. Kronenberg.
1997.
Analysis of intestinal lymphocytes in mouse colitis mediated by transfer of CD4+, CD45RBhigh T cells to SCID recipients.
J. Immunol.
158:3464-3473[Abstract].
|
| 3.
|
Baert, F. J., and P. J. Rutgeerts.
2000.
Medical therapies for ulcerative colitis and Crohn's disease.
Curr. Gastroenterol. Rep.
2:446-450[Medline].
|
| 4.
|
Battles, J. K.,
J. C. Williamson,
K. M. Pike,
P. L. Gorelick,
J. M. Ward, and M. A. Gonda.
1995.
Diagnostic assay for Helicobacter hepaticus based on nucleotide sequence of its 16S rRNA gene.
J. Clin. Microbiol.
33:1344-1347[Abstract].
|
| 5.
|
Berg, D. J.,
N. Davidson,
R. Kühn,
W. Müller,
S. Menon,
G. Holland,
L. Thompson-Snipes,
M. W. Leach, and D. Rennick.
1996.
Enterocolitis and colon cancer in interleukin-10-deficient mice are associated with aberrant cytokine production and CD4+ TH1-like responses.
J. Clin. Investig.
98:1010-1020[Medline].
|
| 6.
|
Blaser, M. J.,
R. A. Miller,
J. Lacher, and J. W. Singleton.
1984.
Patients with active Crohn's disease have elevated serum antibodies to antigens of seven enteric bacterial pathogens.
Gastroenterology
87:888-894[Medline].
|
| 7.
|
Camoglio, L.,
A. A. te Velde,
A. de Boer,
F. J. ten Kate,
M. Kopf, and S. J. van Deventer.
2000.
Hapten-induced colitis associated with maintained Th1 and inflammatory responses in IFN- receptor-deficient mice.
Eur. J. Immunol.
30:1486-1495[CrossRef][Medline].
|
| 8.
|
Campieri, M., and P. Gionchetti.
1999.
Probiotics in inflammatory bowel disease: new insight to pathogenesis or a possible therapeutic alternative?
Gastroenterology
116:1246-1249[CrossRef][Medline].
|
| 9.
|
Cherwinski, H. M.,
J. H. Schumacher,
K. D. Brown, and T. R. Mosmann.
1987.
Two types of mouse helper T cell clone. III. Further differences in lymphokine synthesis between Th1 and Th2 clones revealed by RNA hybridization, functionally monospecific bioassays, and monoclonal antibodies.
J. Exp. Med.
166:1229-1244[Abstract/Free Full Text].
|
| 10.
|
Davidson, N. J.,
S. A. Hudak,
R. E. Lesley,
S. Menon,
M. W. Leach, and D. M. Rennick.
1998.
IL-12, but not IFN- , plays a major role in sustaining the chronic phase of colitis in IL-10-deficient mice.
J. Immunol.
161:3143-3149[Abstract/Free Full Text].
|
| 11.
|
De Jong, Y. P.,
M. Comiskey,
S. L. Kalled,
E. Mizoguchi,
R. A. Flavell,
A. K. Bhan, and C. Terhorst.
2000.
Chronic murine colitis is dependent on the CD154/CD40 pathway and can be attenuated by anti-CD154 administration.
Gastroenterology
119:715-723[CrossRef][Medline].
|
| 12.
|
Dialynas, D. P.,
Z. S. Quan,
K. A. Wall,
A. Pierres,
J. Quintans,
M. R. Loken,
M. Pierres, and F. W. Fitch.
1983.
Characterization of the murine T cell surface molecule, designated L3T4, identified by monoclonal antibody GK1.5: similarity of L3T4 to the human Leu-3/T4 molecule.
J. Immunol.
131:2445-2451[Abstract].
|
| 13.
|
Dianda, L.,
A. M. Hanby,
N. A. Wright,
A. Sebesteny,
A. C. Hayday, and M. J. Owen.
1997.
T cell receptor- -deficient mice fail to develop colitis in the absence of a microbial environment.
Am. J. Pathol.
150:91-97[Abstract].
|
| 14.
|
Dieleman, L. A.,
A. Arends,
S. L. Tonkonogy,
M. S. Goerres,
D. W. Craft,
W. Grenther,
R. K. Sellon,
E. Balish, and R. B. Sartor.
2000.
Helicobacter hepaticus does not induce or potentiate colitis in interleukin-10-deficient mice.
Infect. Immun.
68:5107-5113[Abstract/Free Full Text].
|
| 15.
|
Dohi, T.,
K. Fujihashi,
P. D. Rennert,
K. Iwatani,
H. Kiyono, and J. R. McGhee.
1999.
Hapten-induced colitis is associated with colonic patch hypertrophy and T helper cell 2-type responses.
J. Exp. Med.
189:1169-1180[Abstract/Free Full Text].
|
| 16.
|
Elsaghier, A.,
C. Prantera,
C. Moreno, and J. Ivanyi.
1992.
Antibodies to Mycobacterium paratuberculosis-specific protein antigens in Crohn's disease.
Clin. Exp. Immunol.
90:503-508[Medline].
|
| 17.
|
Fox, J. G.,
F. E. Dewhirst,
J. G. Tully,
B. J. Paster,
L. Yan,
N. S. Taylor,
M. J. Collins, Jr.,
P. L. Gorelick, and J. M. Ward.
1994.
Helicobacter hepaticus sp. nov., a microaerophilic bacterium isolated from livers and intestinal mucosal scrapings from mice.
J. Clin. Microbiol.
32:1238-1245[Abstract/Free Full Text].
|
| 18.
|
Fox, J. G.,
P. L. Gorelick,
M. C. Kullberg,
Z. Ge,
F. E. Dewhirst, and J. M. Ward.
1999.
A novel urease-negative Helicobacter species associated with colitis and typhlitis in IL-10-deficient mice.
Infect. Immun.
67:1757-1762[Abstract/Free Full Text].
|
| 19.
|
Fuss, I. J.,
T. Marth,
M. F. Neurath,
G. R. Pearlstein,
A. Jain, and W. Strober.
1999.
Anti-interleukin 12 treatment regulates apoptosis of Th1 T cells in experimental colitis in mice.
Gastroenterology
117:1078-1088[CrossRef][Medline].
|
| 20.
|
Gionchetti, P.,
F. Rizzello,
A. Venturi,
P. Brigidi,
D. Matteuzzi,
G. Bazzocchi,
G. Poggioli,
M. Miglioli, and M. Campieri.
2000.
Oral bacteriotherapy as maintenance treatment in patients with chronic pouchitis: a double-blind, placebo-controlled trial.
Gastroenterology
119:305-309[CrossRef][Medline].
|
| 21.
|
Gionchetti, P.,
F. Rizzello,
A. Venturi,
F. Ugolini,
M. Rossi,
P. Brigidi,
R. Johansson,
A. Ferrieri,
G. Poggioli, and M. Campieri.
1999.
Review antibiotic treatment in inflammatory bowel disease: rifaximin, a new possible approach.
Eur. Rev. Med. Pharmacol. Sci.
3:27-30[Medline].
|
| 22.
|
Hoffmann, K. F.,
S. L. James,
A. W. Cheever, and T. A. Wynn.
1999.
Studies with double cytokine-deficient mice reveal that highly polarized Th1- and Th2-type cytokine and antibody responses contribute equally to vaccine-induced immunity to Schistosoma mansoni.
J. Immunol.
163:927-938[Abstract/Free Full Text].
|
| 23.
|
Jankovic, D.,
M. C. Kullberg,
N. Noben-Trauth,
P. Caspar,
W. E. Paul, and A. Sher.
2000.
Single cell analysis reveals that IL-4 receptor/Stat6 signaling is not required for the in vivo or in vitro development of CD4+ lymphocytes with a Th2 cytokine profile.
J. Immunol.
164:3047-3055[Abstract/Free Full Text].
|
| 24.
|
Kühn, R.,
J. Löhler,
D. Rennick,
K. Rajewsky, and W. Müller.
1993.
Interleukin-10-deficient mice develop chronic enterocolitis.
Cell
75:263-274[CrossRef][Medline].
|
| 25.
|
Kullberg, M. C.,
J. M. Ward,
P. L. Gorelick,
P. Caspar,
S. Hieny,
A. Cheever,
D. Jankovic, and A. Sher.
1998.
Helicobacter hepaticus triggers colitis in specific-pathogen-free interleukin-10 (IL-10)-deficient mice through an IL-12- and gamma interferon-dependent mechanism.
Infect. Immun.
66:5157-5166[Abstract/Free Full Text].
|
| 26.
|
Liu, Z.,
K. Geboes,
S. Colpaert,
L. Overbergh,
C. Mathieu,
H. Heremans,
M. de Boer,
L. Boon,
G. D'Haens,
P. Rutgeerts, and J. L. Ceuppens.
2000.
Prevention of experimental colitis in SCID mice reconstituted with CD45RBhigh CD4+ T cells by blocking the CD40-CD154 interactions.
J. Immunol.
164:6005-6014[Abstract/Free Full Text].
|
| 26a.
|
National Institutes of Health.
1996.
Guide for the care and use of laboratory animals.
National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Md.
|
| 27.
|
Neurath, M. F.,
I. Fuss,
B. L. Kelsall,
E. Stuber, and W. Strober.
1995.
Antibodies to interleukin 12 abrogate established experimental colitis in mice.
J. Exp. Med.
182:1281-1290[Abstract/Free Full Text].
|
| 28.
|
Oppmann, B.,
R. Lesley,
B. Blom,
J. C. Timans,
Y. Xu,
B. Hunte,
F. Vega,
N. Yu,
J. Wang,
K. Singh,
F. Zonin,
E. Vaisberg,
T. Churakova,
M. Liu,
D. Gorman,
J. Wagner,
S. Zurawski,
Y. Liu,
J. S. Abrams,
K. W. Moore,
D. Rennick,
R. de Waal-Malefyt,
C. Hannum,
J. F. Bazan, and R. A. Kastelein.
2000.
Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12.
Immunity
13:715-725[CrossRef][Medline].
|
| 29.
|
Powrie, F.
1995.
T cells in inflammatory bowel disease: protective and pathogenic roles.
Immunity
3:171-174[CrossRef][Medline].
|
| 30.
|
Raza, A.
2000.
Anti-TNF therapies in rheumatoid arthritis, Crohn's disease, sepsis, and myelodysplastic syndromes.
Microsc. Res. Tech.
50:229-235[CrossRef][Medline].
|
| 31.
|
Rennick, D. M.,
M. M. Fort, and N. J. Davidson.
1997.
Studies with IL-10 / mice: an overview.
J. Leukoc. Biol.
61:389-396[Abstract].
|
| 32.
|
Rutgeerts, P.,
M. Hiele,
K. Geboes,
M. Peeters,
F. Penninckx,
R. Aerts, and R. Kerremans.
1995.
Controlled trial of metronidazole treatment for prevention of Crohn's recurrence after ileal resection.
Gastroenterology
108:1617-1621[CrossRef][Medline].
|
| 33.
|
Sadlack, B.,
H. Merz,
H. Schorle,
A. Schimpl,
A. C. Feller, and I. Horak.
1993.
Ulcerative colitis-like disease in mice with a disrupted interleukin-2 gene.
Cell
75:253-261[CrossRef][Medline].
|
| 34.
|
Sarmiento, M.,
A. L. Glasebrook, and F. W. Fitch.
1980.
IgG or IgM monoclonal antibodies reactive with different determinants on the molecular complex bearing Lyt 2 antigen block T cell-mediated cytolysis in the absence of complement.
J. Immunol.
125:2665-2672[Abstract].
|
| 35.
|
Sartor, R. B.
1997.
Pathogenesis and immune mechanisms of chronic inflammatory bowel diseases.
Am. J. Gastroenterol.
92:5.S-11.S[Medline].
|
| 36.
|
Schultz, M.,
S. L. Tonkonogy,
R. K. Sellon,
C. Veltkamp,
V. L. Godfrey,
J. Kwon,
W. B. Grenther,
E. Balish,
I. Horak, and R. B. Sartor.
1999.
IL-2-deficient mice raised under germfree conditions develop delayed mild focal intestinal inflammation.
Am. J. Physiol.
276:G1461-G1472[Abstract/Free Full Text].
|
| 37.
|
Sellon, R. K.,
S. Tonkonogy,
M. Schultz,
L. A. Dieleman,
W. Grenther,
E. Balish,
D. M. Rennick, and R. B. Sartor.
1998.
Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice.
Infect. Immun.
66:5224-5231[Abstract/Free Full Text].
|
| 38.
|
Simpson, S. J.,
S. Shah,
M. Comiskey,
Y. P. de Jong,
B. Wang,
E. Mizoguchi,
A. K. Bhan, and C. Terhorst.
1998.
T cell-mediated pathology in two models of experimental colitis depends predominantly on the interleukin 12/signal transducer and activator of transcription (Stat)-4 pathway, but is not conditional on interferon expression by T cells.
J. Exp. Med.
187:1225-1234[Abstract/Free Full Text].
|
| 39.
|
Strober, W., and R. O. Ehrhardt.
1993.
Chronic intestinal inflammation: an unexpected outcome in cytokine or T cell receptor mutant mice.
Cell
75:203-205[CrossRef][Medline].
|
| 40.
|
Stüber, E.,
W. Strober, and M. Neurath.
1996.
Blocking the CD40L-CD40 interaction in vivo specifically prevents the priming of T helper 1 cells through the inhibition of interleukin 12 secretion.
J. Exp. Med.
183:693-698[Abstract/Free Full Text].
|
| 41.
|
Sutton, C. L.,
J. Kim,
A. Yamane,
H. Dalwadi,
B. Wei,
C. Landers,
S. R. Targan, and J. Braun.
2000.
Identification of a novel bacterial sequence associated with Crohn's disease.
Gastroenterology
119:23-31[CrossRef][Medline].
|
| 42.
|
Taurog, J. D.,
J. A. Richardson,
J. T. Croft,
W. A. Simmons,
M. Zhou,
J. L. Fernandez-Sueiro,
E. Balish, and R. E. Hammer.
1994.
The germfree state prevents development of gut and joint inflammatory disease in HLA-B27 transgenic rats.
J. Exp. Med.
180:2359-2364[Abstract/Free Full Text].
|
| 43.
|
Tiveljung, A.,
J. D. Soderholm,
G. Olaison,
J. Jonasson, and H. J. Monstein.
1999.
Presence of eubacteria in biopsies from Crohn's disease inflammatory lesions as determined by 16S rRNA gene-based PCR.
J. Med. Microbiol.
48:263-268[Abstract/Free Full Text].
|
| 44.
|
Venturi, A.,
P. Gionchetti,
F. Rizzello,
R. Johansson,
E. Zucconi,
P. Brigidi,
D. Matteuzzi, and M. Campieri.
1999.
Impact on the composition of the faecal flora by a new probiotic preparation: preliminary data on maintenance treatment of patients with ulcerative colitis.
Aliment. Pharmacol. Ther.
13:1103-1108[CrossRef][Medline].
|
| 45.
|
Ward, J. M.,
J. G. Fox,
M. R. Anver,
D. C. Haines,
C. V. George,
M. J. Collins, Jr.,
P. L. Gorelick,
K. Nagashima,
M. A. Gonda,
R. V. Gilden,
J. G. Tully,
R. J. Russell,
R. E. Benveniste,
B. J. Paster,
F. E. Dewhirst,
J. C. Donovan,
L. M. Anderson, and J. M. Rice.
1994.
Chronic active hepatitis and associated liver tumors in mice caused by a persistent bacterial infection with a novel Helicobacter species.
J. Natl. Cancer Inst.
86:1222-1227[Abstract/Free Full Text].
|
| 46.
|
Wynn, T. A.,
I. Eltoum,
A. W. Cheever,
F. A. Lewis,
W. C. Gause, and A. Sher.
1993.
Analysis of cytokine mRNA expression during primary granuloma formation induced by eggs of Schistosoma mansoni.
J. Immunol.
151:1430-1440[Abstract].
|
| 47.
|
Wynn, T. A.,
I. Eltoum,
I. P. Oswald,
A. W. Cheever, and A. Sher.
1994.
Endogenous interleukin 12 (IL-12) regulates granuloma formation induced by eggs of Schistosoma mansoni and exogenous IL-12 both inhibits and prophylactically immunizes against egg pathology.
J. Exp. Med.
179:1551-1561[Abstract/Free Full Text].
|
| 48.
|
Wynn, T. A.,
R. Morawetz,
T. Scharton-Kersten,
S. Hieny,
H. C. Morse III,
R. Kuhn,
W. Muller,
A. W. Cheever, and A. Sher.
1997.
Analysis of granuloma formation in double cytokine-deficient mice reveals a central role for IL-10 in polarizing both T helper cell 1- and T helper cell 2-type cytokine responses in vivo.
J. Immunol.
159:5014-5023[Abstract].
|
| 49.
|
Wysocka, M.,
M. Kubin,
L. Q. Vieira,
L. Ozmen,
G. Garotta,
P. Scott, and G. Trinchieri.
1995.
Interleukin-12 is required for interferon- production and lethality in lipopolysaccharide-induced shock in mice.
Eur. J. Immunol.
25:672-676[Medline].
|
Infection and Immunity, July 2001, p. 4232-4241, Vol. 69, No. 7
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.7.4232-4241.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Shen, Z., Feng, Y., Rogers, A. B., Rickman, B., Whary, M. T., Xu, S., Clapp, K. M., Boutin, S. R., Fox, J. G.
(2009). Cytolethal Distending Toxin Promotes Helicobacter cinaedi-Associated Typhlocolitis in Interleukin-10-Deficient Mice. Infect. Immun.
77: 2508-2516
[Abstract]
[Full Text]
-
McBee, M. E., Zheng, P. Z., Rogers, A. B., Fox, J. G., Schauer, D. B.
(2008). Modulation of Acute Diarrheal Illness by Persistent Bacterial Infection. Infect. Immun.
76: 4851-4858
[Abstract]
[Full Text]
-
Londono, D., Marques, A., Hornung, R. L., Cadavid, D.
(2008). IL-10 Helps Control Pathogen Load during High-Level Bacteremia. J. Immunol.
181: 2076-2083
[Abstract]
[Full Text]
-
Sarangi, P. P., Sehrawat, S., Suvas, S., Rouse, B. T.
(2008). IL-10 and Natural Regulatory T Cells: Two Independent Anti-Inflammatory Mechanisms in Herpes Simplex Virus-Induced Ocular Immunopathology. J. Immunol.
180: 6297-6306
[Abstract]
[Full Text]
-
Sterzenbach, T., Lee, S. K., Brenneke, B., von Goetz, F., Schauer, D. B., Fox, J. G., Suerbaum, S., Josenhans, C.
(2007). Inhibitory Effect of Enterohepatic Helicobacter hepaticus on Innate Immune Responses of Mouse Intestinal Epithelial Cells. Infect. Immun.
75: 2717-2728
[Abstract]
[Full Text]
-
Karrasch, T., Kim, J.-S., Muhlbauer, M., Magness, S. T., Jobin, C.
(2007). Gnotobiotic IL-10-/-;NF-{kappa}BEGFP Mice Reveal the Critical Role of TLR/NF-{kappa}B Signaling in Commensal Bacteria-Induced Colitis. J. Immunol.
178: 6522-6532
[Abstract]
[Full Text]
-
Mansfield, L. S., Bell, J. A., Wilson, D. L., Murphy, A. J., Elsheikha, H. M., Rathinam, V. A. K., Fierro, B. R., Linz, J. E., Young, V. B.
(2007). C57BL/6 and Congenic Interleukin-10-Deficient Mice Can Serve as Models of Campylobacter jejuni Colonization and Enteritis. Infect. Immun.
75: 1099-1115
[Abstract]
[Full Text]
-
Beiting, D. P., Gagliardo, L. F., Hesse, M., Bliss, S. K., Meskill, D., Appleton, J. A.
(2007). Coordinated Control of Immunity to Muscle Stage Trichinella spiralis by IL-10, Regulatory T Cells, and TGF-beta. J. Immunol.
178: 1039-1047
[Abstract]
[Full Text]
-
Tomczak, M. F., Erdman, S. E., Davidson, A., Wang, Y. Y., Nambiar, P. R., Rogers, A. B., Rickman, B., Luchetti, D., Fox, J. G., Horwitz, B. H.
(2006). Inhibition of Helicobacter hepaticus-Induced Colitis by IL-10 Requires the p50/p105 Subunit of NF-{kappa}B. J. Immunol.
177: 7332-7339
[Abstract]
[Full Text]
-
Kullberg, M. C., Jankovic, D., Feng, C. G., Hue, S., Gorelick, P. L., McKenzie, B. S., Cua, D. J., Powrie, F., Cheever, A. W., Maloy, K. J., Sher, A.
(2006). IL-23 plays a key role in Helicobacter hepaticus-induced T cell-dependent colitis. JEM
203: 2485-2494
[Abstract]
[Full Text]
-
Hue, S., Ahern, P., Buonocore, S., Kullberg, M. C., Cua, D. J., McKenzie, B. S., Powrie, F., Maloy, K. J.
(2006). Interleukin-23 drives innate and T cell-mediated intestinal inflammation. JEM
203: 2473-2483
[Abstract]
[Full Text]
-
Vojdani, A., Erde, J.
(2006). Regulatory T Cells, a Potent Immunoregulatory Target for CAM Researchers: Modulating Allergic and Infectious Disease Pathology (II). Evid Based Complement Alternat Med
3: 209-215
[Abstract]
[Full Text]
-
Tomczak, M. F., Gadjeva, M., Wang, Y. Y., Brown, K., Maroulakou, I., Tsichlis, P. N., Erdman, S. E., Fox, J. G., Horwitz, B. H.
(2006). Defective Activation of ERK in Macrophages Lacking the p50/p105 Subunit of NF-{kappa}B Is Responsible for Elevated Expression of IL-12 p40 Observed after Challenge with Helicobacter hepaticus. J. Immunol.
176: 1244-1251
[Abstract]
[Full Text]
-
Kamada, N., Hisamatsu, T., Okamoto, S., Sato, T., Matsuoka, K., Arai, K., Nakai, T., Hasegawa, A., Inoue, N., Watanabe, N., Akagawa, K. S., Hibi, T.
(2005). Abnormally Differentiated Subsets of Intestinal Macrophage Play a Key Role in Th1-Dominant Chronic Colitis through Excess Production of IL-12 and IL-23 in Response to Bacteria. J. Immunol.
175: 6900-6908
[Abstract]
[Full Text]
-
Ge, Z., Feng, Y., Whary, M. T., Nambiar, P. R., Xu, S., Ng, V., Taylor, N. S., Fox, J. G.
(2005). Cytolethal Distending Toxin Is Essential for Helicobacter hepaticus Colonization in Outbred Swiss Webster Mice. Infect. Immun.
73: 3559-3567
[Abstract]
[Full Text]
-
Pena, J. A., Rogers, A. B., Ge, Z., Ng, V., Li, S. Y., Fox, J. G., Versalovic, J.
(2005). Probiotic Lactobacillus spp. Diminish Helicobacter hepaticus-Induced Inflammatory Bowel Disease in Interleukin-10-Deficient Mice. Infect. Immun.
73: 912-920
[Abstract]
[Full Text]
-
Roers, A., Siewe, L., Strittmatter, E., Deckert, M., Schluter, D., Stenzel, W., Gruber, A. D., Krieg, T., Rajewsky, K., Muller, W.
(2004). T Cell-specific Inactivation of the Interleukin 10 Gene in Mice Results in Enhanced T Cell Responses but Normal Innate Responses to Lipopolysaccharide or Skin Irritation. JEM
200: 1289-1297
[Abstract]
[Full Text]
-
Drakes, M., Blanchard, T., Czinn, S.
(2004). Bacterial Probiotic Modulation of Dendritic Cells. Infect. Immun.
72: 3299-3309
[Abstract]
[Full Text]
-
Kullberg, M. C., Andersen, J. F., Gorelick, P. L., Caspar, P., Suerbaum, S., Fox, J. G., Cheever, A. W., Jankovic, D., Sher, A.
(2003). Induction of colitis by a CD4+ T cell clone specific for a bacterial epitope. Proc. Natl. Acad. Sci. USA
100: 15830-15835
[Abstract]
[Full Text]
-
Erdman, S. E., Rao, V. P., Poutahidis, T., Ihrig, M. M., Ge, Z., Feng, Y., Tomczak, M., Rogers, A. B., Horwitz, B. H., Fox, J. G.
(2003). CD4+CD25+ Regulatory Lymphocytes Require Interleukin 10 to Interrupt Colon Carcinogenesis in Mice. Cancer Res.
63: 6042-6050
[Abstract]
[Full Text]
-
Higgins, S. C., Lavelle, E. C., McCann, C., Keogh, B., McNeela, E., Byrne, P., O'Gorman, B., Jarnicki, A., McGuirk, P., Mills, K. H. G.
(2003). Toll-Like Receptor 4-Mediated Innate IL-10 Activates Antigen-Specific Regulatory T Cells and Confers Resistance to Bordetella pertussis by Inhibiting Inflammatory Pathology. J. Immunol.
171: 3119-3127
[Abstract]
[Full Text]
-
Tomczak, M. F., Erdman, S. E., Poutahidis, T., Rogers, A. B., Holcombe, H., Plank, B., Fox, J. G., Horwitz, B. H.
(2003). NF-{kappa}B Is Required Within the Innate Immune System to Inhibit Microflora-Induced Colitis and Expression of IL-12 p40. J. Immunol.
171: 1484-1492
[Abstract]
[Full Text]
-
Myles, M. H., Livingston, R. S., Livingston, B. A., Criley, J. M., Franklin, C. L.
(2003). Analysis of Gene Expression in Ceca of Helicobacter hepaticus-Infected A/JCr Mice before and after Development of Typhlitis. Infect. Immun.
71: 3885-3893
[Abstract]
[Full Text]
-
Avenaud, P., Le Bail, B., Mayo, K., Marais, A., Fawaz, R., Bioulac-Sage, P., Megraud, F.
(2003). Natural History of Helicobacter hepaticus Infection in Conventional A/J Mice, with Special Reference to Liver Involvement. Infect. Immun.
71: 3667-3672
[Abstract]
[Full Text]
-
Erdman, S. E., Poutahidis, T., Tomczak, M., Rogers, A. B., Cormier, K., Plank, B., Horwitz, B. H., Fox, J. G.
(2003). CD4+ CD25+ Regulatory T Lymphocytes Inhibit Microbially Induced Colon Cancer in Rag2-Deficient Mice. Am. J. Pathol.
162: 691-702
[Abstract]
[Full Text]
-
Maloy, K. J., Salaun, L., Cahill, R., Dougan, G., Saunders, N. J., Powrie, F.
(2003). CD4+CD25+ TR Cells Suppress Innate Immune Pathology Through Cytokine-dependent Mechanisms. JEM
197: 111-119
[Abstract]
[Full Text]
-
Myers, K. J., Murthy, S., Flanigan, A., Witchell, D. R., Butler, M., Murray, S., Siwkowski, A., Goodfellow, D., Madsen, K., Baker, B.
(2003). Antisense Oligonucleotide Blockade of Tumor Necrosis Factor-alpha in Two Murine Models of Colitis. J. Pharmacol. Exp. Ther.
304: 411-424
[Abstract]
[Full Text]
-
Kullberg, M. C., Jankovic, D., Gorelick, P. L., Caspar, P., Letterio, J. J., Cheever, A. W., Sher, A.
(2002). Bacteria-triggered CD4+ T Regulatory Cells Suppress Helicobacter hepaticus-induced Colitis. JEM
196: 505-515
[Abstract]
[Full Text]
-
Balish, E., Warner, T.
(2002). Enterococcus faecalis Induces Inflammatory Bowel Disease in Interleukin-10 Knockout Mice. Am. J. Pathol.
160: 2253-2257
[Abstract]
[Full Text]